CN116286768A - Oxidation squalene cyclase, recombinant vector, recombinant engineering bacterium, application of recombinant engineering bacterium and paclitaxel and preparation method of paclitaxel - Google Patents

Abstract

The invention relates to an oxidation squalene cyclase, a recombinant vector, a recombinant engineering bacterium, application thereof and a parkeol and a preparation method thereof. The oxidation squalene cyclase comprises: a polypeptide consisting of an amino acid sequence as shown in SEQ ID No. 1; or a polypeptide consisting of one or more amino acids deleted, substituted or added from the amino acid sequence shown in SEQ ID No. 1; or a polypeptide having at least 80% homology with a polypeptide consisting of the amino acid sequence shown in SEQ ID No. 1. The oxidation squalene cyclase can catalyze 2,3 oxidation squalene to produce paclitaxel, and the cyclase can be expressed by genetic engineering means according to the coding sequence of the cyclase, and then a substrate is catalyzed to improve the yield of the paclitaxel.

Description

Oxidation squalene cyclase, recombinant vector, recombinant engineering bacterium, application of recombinant engineering bacterium and paclitaxel and preparation method of paclitaxel

Technical Field

The invention relates to the technical field of biology, in particular to an oxidation squalene cyclase, a recombinant vector, a recombinant engineering bacterium, application thereof, paclitaxel and a preparation method thereof.

Background

Studies show that after the paclitaxel with different concentrations is taken, the contents of intracellular Triglyceride (TG), total Cholesterol (TC) and low-density lipoprotein cholesterol (LDL-c) all tend to decrease, and the effect is better and more remarkable along with the increase of the paclitaxel concentration. When the concentration of the paclobutrol is increased to 20 mu mol/L, the content of TG, TC, LDL-c in the cells is respectively reduced by 59.54%, 33.69% and 40.03% compared with that of a model group, and the effect of improving the accumulation of the lipid in the cells is quite remarkable. When the concentration of the paclitaxel is lower than 20 mu mol/L, the paclitaxel has no obvious cytotoxicity, and in the concentration range, the paclitaxel has obvious improvement effect on the accumulation of cell lipid and oxidative stress, and the improvement effect is obviously enhanced along with the increase of the concentration of the paclitaxel. The intake of paclitaxel significantly changes the expression of genes related to lipid anabolism such as FASN, ACSL1, CPT1A, PIK CB and the like in cells, and simultaneously changes the expression of genes related to oxidative stress such as NQO-1, PRXL2A, NF-KB2, TXNRD1 and the like, and the genes with expression differences from the model group mainly relate to amino acid metabolism, carbohydrate metabolism, energy metabolism, glycan synthesis and metabolism, lipid metabolism, metabolism of coenzyme factors, vitamin, aging, cardiovascular diseases and the like. And, the price of paclitaxel is relatively high, and currently 5mg of paclitaxel is sold for about 3200 yuan. Thus, the preparation of the paclitaxel has extremely high practical value and economic value. At present, the paclitaxel is mainly extracted from plants and animals, so that the extraction rate is low, and the large-scale industrial production is not facilitated. How to increase the yield of paclitaxel is an urgent problem to be solved.

Disclosure of Invention

Based on this, it is necessary to provide an oxidosqualene cyclase capable of catalyzing a substrate to produce paclitaxel, which can be expressed by genetic engineering means based on the coding sequence of the cyclase, and then catalyzing the substrate to increase the yield of paclitaxel, and its use.

In addition, it is necessary to provide a recombinant vector, recombinant engineering bacteria, a preparation method and application thereof, and paclitaxel and a preparation method thereof.

An oxidosqualene cyclase, comprising:

a polypeptide consisting of an amino acid sequence as shown in SEQ ID No. 1; or (b)

A polypeptide consisting of one or more amino acids deleted, substituted or added from the amino acid sequence shown in SEQ ID No. 1; or alternatively, the first and second heat exchangers may be,

a polypeptide having at least 80% homology with a polypeptide consisting of the amino acid sequence shown in SEQ ID No. 1.

The research shows that the oxidation squalene cyclase can catalyze 2,3 oxidation squalene to produce paclitaxel, and the cyclase can be expressed by using a genetic engineering means according to a coding sequence of the cyclase, and then a substrate is catalyzed to improve the yield of the paclitaxel. Experiments prove that eukaryotic expression vectors are constructed according to the coding sequences of the oxidosqualene cyclase, and the eukaryotic expression vectors are transferred into GIL77 microzyme to induce and express the cyclase, and the cyclase can catalyze the recombinant microzyme substrate 2,3 oxidosqualene to produce paclitaxel.

In one embodiment, the coding sequence of the oxidosqualene cyclase comprises:

a nucleotide sequence as shown in SEQ ID No. 2;

or, a nucleotide sequence having 80% homology with the nucleotide sequence shown in SEQ ID No. 2;

or a nucleotide sequence obtained by deleting, substituting or adding one or more bases in the nucleotide sequence shown in SEQ ID No. 2.

A recombinant vector carrying the coding sequence of the above-described oxidosqualene cyclase.

In one embodiment, the recombinant vector is a eukaryotic cell expression vector carrying the coding sequence for the oxidosqualene cyclase.

In one embodiment, the recombinant vector is a pYES2.0 expression vector carrying the coding sequence of the oxidosqualene cyclase.

In one embodiment, the method comprises the following steps: and carrying out PCR amplification on the coding sequence of the oxidation squalene cyclase by adopting an amplification primer pair with nucleotide sequences shown as SEQ ID No.3 and SEQ ID No.4, and connecting the coding sequence into an empty vector to obtain the recombinant vector.

A recombinant engineering bacterium, which is transformed with the recombinant vector.

In one embodiment, the recombinant engineering bacterium contains 2, 3-oxidosqualene in a host bacterium.

In one embodiment, the host strain of the recombinant engineering bacterium is a lanosterol-deficient yeast strain.

In one embodiment, the host strain of the recombinant engineering bacterium is lanosterol-deficient yeast strain Gil77.

The application of the oxidation squalene cyclase, the recombinant vector or the recombinant engineering bacteria in preparing the Pakkol.

A process for preparing paclitaxel comprising the steps of: performing amplification culture on recombinant engineering bacteria to obtain the paclitaxel, wherein the recombinant engineering bacteria are transformed with the recombinant vector, and the recombinant engineering bacteria contain 2, 3-oxidosqualene.

In one embodiment, the recombinant engineering bacterium is a lanosterol-deficient yeast strain Gil77 transformed with the recombinant vector, and the step of performing expansion culture on the recombinant engineering bacterium to obtain the paclitaxel comprises the following steps:

performing amplification culture on the recombinant engineering bacteria, performing solid-liquid separation and collecting amplified culture thalli;

performing induction culture on the expanded culture thalli to induce lanosterol synthase gene expression in the expanded culture thalli;

after the induction is finished, solid-liquid separation is carried out, the bacteria subjected to induction culture are collected, and then the bacteria subjected to induction culture are cracked, so that the paclitaxel is obtained.

The paclitaxel is prepared by the preparation method of the paclitaxel.

Drawings

FIG. 1 shows the results of GC-MS detection in example 1.

Detailed Description

In order that the above-recited objects, features and advantages of the present invention can be readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. The invention may be embodied in many other forms than described herein and similarly modified by those skilled in the art without departing from the spirit or scope of the invention, which is therefore not limited to the specific embodiments disclosed below.

One embodiment of the present study provides an oxidosqualene cyclase comprising:

a polypeptide consisting of an amino acid sequence as shown in SEQ ID No. 1; or (b)

A polypeptide consisting of one or more amino acids deleted, substituted or added from the amino acid sequence shown in SEQ ID No. 1; or alternatively, the first and second heat exchangers may be,

a polypeptide having at least 80% homology with a polypeptide consisting of the amino acid sequence shown in SEQ ID No. 1. The research shows that the oxidation squalene cyclase can catalyze 2,3 oxidation squalene to produce paclitaxel, and the cyclase can be expressed by using a genetic engineering means according to a coding sequence of the cyclase, and then a substrate is catalyzed to improve the yield of the paclitaxel. Experiments prove that eukaryotic expression vectors are constructed according to the coding sequences of the oxidosqualene cyclase, and the eukaryotic expression vectors are transferred into GIL77 microzyme to induce and express the cyclase, and the cyclase can catalyze the recombinant microzyme substrate 2,3 oxidosqualene to produce paclitaxel.

The amino acid sequence shown as SEQ ID No.1 is used as a source of the deep sea cucumber.

Specifically, the sequence shown in SEQ ID No.1 is as follows:

MSSIRRNRGGPHKTPEVTDLTRWRLTSTNGRRIWKYYTNVETPPHAQNVLEKYSVGADYTEDVPKYSEARTPQEAANNGMAFFSLLQAEDGHWANDYCGPLFLMPGLAIVFYITKTPLPDAFRAEMVRYLRSVQCPGGGWGLHTEDKATVFGTALNYAVMRIFGISADDPDLVKARKLLHYHGGAIAIPQWGKFWLCVLNCYKWEGLHTLFPELWLLPSWIPAHPSTLWVHCRQVYVSMSYLYGRKYQAPEDNLIHSLRKELFIEDFETINWPKQKDNVAKVDLYTPHSTLYQIIFGFLDVYELYAHPSSRLKALELCYEHIQQDDIMTNFVSIGPISKMINMLVRWLVDGPDSEAYKIHIDRVYDYLWMGLDGMKMQGTNGTQVWDAAFAAMAFIEAGAHENPKFQGVLKKAYSYFEVTQMLENSPKCVEYFRQANKGGYPLTTRDHGLIVSDTTAEGLKAAILLEEHCPFLKEKIPRQRHRDAVDLLISMVNSNGGFASYETLRGGYILENLNPSEVFGDIMIDYTYVECTSSVMQVLRHYVEVDPEYRQADIWDIMDGGLKYISDMQRPDGSFEGSWGVCFTYGTWFVLEAFACLGYGYHLYTATPAVEKACEFLISKQMEDGGWGENFESCEERRYVESETSQVVNTCWAVMGLMAVRYPDVSVIERGIKVIMDRQDAYGNWPQNDLTSQA*。

in some of these embodiments, the coding sequence for an oxidosqualene cyclase comprises:

a nucleotide sequence as shown in SEQ ID No. 2;

or, a nucleotide sequence having 80% homology with the nucleotide sequence shown in SEQ ID No. 2;

or a nucleotide sequence obtained by deleting, substituting or adding one or more bases in the nucleotide sequence shown in SEQ ID No. 2.

The nucleotide sequence shown as SEQ ID No.2 is used as a source of the deep sea cucumber.

Specifically, the sequence shown in SEQ ID No.2 is ATGTCCTCCATTAGAAGGAATAGAGGTGGTCCACACAAAACTCCTGAAGTGACTGATTTGACTAGATGGAGGCTAACTTCAACAAATGGTAGAAGGATTTGGAAATATTACACTAATGTGGAAACGCCCCCACATGCTCAAAACGTTTTGGAAAAGTATTCTGTCGGCGCTGATTATACTGAAGATGTCCCAAAGTATTCTGAAGCTAGAACACCACAAGAAGCTGCTAACAACGGTATGGCCTTTTTTTCATTATTGCAAGCAGAAGATGGTCATTGGGCAAATGATTACTGTGGTCCATTGTTCTTAATGCCAGGCCTAGCTATTGTTTTCTATATTACCAAGACCCCTTTACCAGATGCTTTTAGAGCCGAAATGGTGAGATATCTAAGGTCTGTTCAATGTCCAGGTGGTGGCTGGGGTTTGCATACTGAAGACAAAGCTACTGTTTTCGGTACAGCATTGAATTATGCTGTTATGAGGATTTTTGGTATTTCTGCCGATGATCCAGATTTGGTCAAAGCTAGAAAGTTGTTGCATTATCATGGTGGTGCCATTGCTATTCCACAATGGGGAAAATTCTGGTTGTGCGTTTTGAATTGTTATAAGTGGGAAGGTTTACATACTTTATTTCCTGAATTATGGTTGTTACCATCTTGGATTCCAGCTCACCCATCAACATTATGGGTTCACTGTAGACAGGTATATGTTAGCATGTCATACTTATACGGCAGAAAATATCAAGCACCTGAAGACAACCTGATCCATTCTTTGAGAAAAGAATTGTTTATAGAAGATTTCGAAACAATAAATTGGCCTAAACAAAAAGATAATGTTGCTAAAGTGGATTTATACACACCACATTCCACTTTATATCAAATCATATTTGGTTTCTTAGACGTTTATGAGCTGTACGCTCATCCATCTTCAAGATTAAAGGCTTTAGAATTGTGTTATGAACATATTCAACAGGATGATATCATGACCAACTTTGTTAGTATTGGCCCAATTTCTAAAATGATTAATATGTTGGTCAGGTGGTTAGTTGATGGACCAGATTCGGAAGCCTACAAAATCCATATTGATAGAGTTTATGACTATTTGTGGATGGGCTTGGATGGTATGAAGATGCAAGGTACAAATGGTACACAAGTTTGGGATGCAGCATTTGCTGCTATGGCTTTCATCGAAGCCGGTGCTCACGAAAATCCTAAATTTCAAGGTGTGTTGAAGAAgGCTTATTCTTACTTCGAAGTTACCCAAATGTTAGAGAATTCACCTAAATGCGTTGAATACTTCAGACAAGCAAATAAGGGTGGTTATCCATTAACAACTAGAGATCATGGTTTGATCGTTAGCGATACTACCGCTGAAGGTTTAAAAGCTGCCATTTTGTTAGAAGAACATTGCCCATTCTTAAAAGAAAAGATACCTAGGCAAAGACATAGAGATGCTGTTGATTTGTTGATTTCAATGGTTAATAGTAACGGTGGTTTCGCTAGTTACGAAACATTGAGAGGTGGCTATATTTTAGAGAACTTGAATCCATCCGAGGTGTTTGGAGACATTATGATTGATTATACATACGTTGAATGTACGTCATCAGTCATGCAAGTTTTAAGACATTATGTTGAAGTCGATCCAGAATATAGACAAGCTGATATATGGGATATTATGGACGGTGGTCTGAAATATATCAGTGATATGCAAAGACCAGATGGTTCATTTGAAGGTTCTTGGGGTGTTTGTTTCACATATGGTACTTGGTTCGTTTTAGAAGCATTTGCTTGTTTAGGTTATGGTTATCACTTGTATACTGCTACTCCAGCAGTTGAAAAAGCCTGTGAATTTTTGATCTCCAAACAAATGGAAGATGGTGGTTGGGGTGAAAATTTTGAATCTTGTGAAGAAAGAAGATACGTTGAATCCGAAACTTCTCAAGTCGTGAATACTTGTTGGGCTGTCATGGGTTTGATGGCAGTTAGATATCCTGATGTTTCCGTTATTGAAAGAGGTATTAAAGTTATAATGGACAGACAAGATGCCTATGGTAATTGGCCTCAAAATGATTTGACTTCCCAAGCCTAA. Wherein the conserved region is at the 232 th to 2076 th base.

Since the same amino acid may be determined by several different codons, the same amino acid may correspond to different nucleotide sequences and different amino acids may correspond to the same nucleotide sequence. Thus, the amino acid sequence of the oxidosqualene cyclase in the present application is encoded by a nucleotide sequence of a synonymous mutation of codons obtained by 1 or several nucleotide substitutions of the nucleotide sequence shown as SEQ ID No. 2. The person skilled in the art can obtain the oxidosqualene cyclase of the present application by means of cDNA cloning and site-directed mutagenesis or other suitable methods according to the amino acid sequences of the oxidosqualene cyclases disclosed in the present application, according to existing molecular biology techniques, and thus the encoding of the above-mentioned oxidosqualene cyclase is not limited to the nucleotide sequence as shown in SEQ ID No. 2. It is also within the scope of the present invention if the encoded protein has no significant functional difference from the oxidosqualene cyclase.

In addition, naturally occurring proteins may exhibit genetic mutations due to polymorphisms and variations in the coding sequence of the protein, deletions, substitutions or additions of bases, or deletions, insertions, substitutions or other variations of amino acids in the coding sequence, resulting in the occurrence of one or more amino acids in the amino acid sequence of the protein. Thus, there are proteins whose physiological and biological activities are substantially equivalent to those of the non-variant proteins. These polypeptides or proteins which differ from the corresponding protein but which do not differ significantly in function from the protein are referred to as functionally equivalent variants.

Functionally equivalent variants are equally suitable for polypeptides which are produced by artificial means such as deletion, insertion and mutation to alter one or more codons, thereby introducing such variants into the amino acid sequence of a protein. Although more variants can be obtained in this way, the resulting variants are premised on their physiological activity being substantially equivalent to that of the original non-variant protein as functionally equivalent variants.

In general, the coding sequences of functionally equivalent variants are homologous, and thus, polypeptides or proteins resulting from at least one alteration, such as a deletion, insertion or substitution of one or more bases in the coding sequence of a protein or a deletion, insertion or substitution of one or more amino acids in the amino acid sequence of a protein, are generally functionally equivalent to the activity of the protein, and thus, polypeptides consisting of the polypeptides encoded by the above nucleotide sequences or the above amino acid sequences are also included within the scope of the present application, if the encoded protein has no significant functional difference from an oxidosqualene cyclase.

The present study discloses the coding sequence of the above-mentioned oxidosqualene cyclase, which can be expressed by genetic engineering means based on the coding sequence of the cyclase, and then catalyze substrates to increase the yield of pachymol. Experiments prove that eukaryotic expression vectors are constructed according to the coding sequences of the oxidosqualene cyclase, and the eukaryotic expression vectors are transferred into GIL77 microzyme to induce and express the cyclase, and the cyclase can catalyze the recombinant microzyme substrate 2,3 oxidosqualene to produce paclitaxel.

An embodiment of the present study also provides a recombinant vector carrying the coding sequence of the above-described oxidosqualene cyclase.

Wherein the recombinant vector is a recombinant cloning vector or a recombinant expression vector.

Further, the recombinant vector is a eukaryotic cell expression vector carrying the coding sequence of the above-mentioned oxidation squalene cyclase. The expression of the above-mentioned oxidosqualene cyclase by a eukaryotic expression vector is advantageous for improving the enzyme activity of the enzyme.

Specifically, the recombinant vector is a pYES2.0 plasmid vector carrying the coding sequence of the above-mentioned oxidation squalene cyclase. The use of the pYES2.0 plasmid vector facilitates efficient expression of the above-described oxidosqualene cyclase gene.

The present study provides recombinant vectors carrying the coding sequences for the above-described oxidosqualene cyclase, which facilitate cloning or expression of the enzyme by genetic engineering means, followed by catalytic substrate to increase the yield of pachymol. The recombinant vector of this study can be used for the preparation of paclitaxel.

An embodiment of the present invention further provides a method for preparing the recombinant vector, comprising the steps of: and carrying out PCR reaction on the coding sequence of the oxidosqualene cyclase and the empty vector by adopting amplification primer pairs with nucleotide sequences shown as SEQ ID No.3 and SEQ ID No.4 so as to connect the coding sequence of the oxidosqualene cyclase into the empty vector to obtain the recombinant vector.

The empty vector is a cloning vector or an expression vector. Further, the empty vector is a eukaryotic cell expression vector. In a specific example, the empty vector is a pyes2.0 plasmid vector.

Specifically, the sequence shown as SEQ ID No.3 is GGGGTACCTACACAATGTCCTCCATTA; the sequence shown as SEQ ID No.4 is GCTCTAGATTAGGCTTGGGAAGTCAAA. Wherein the streaking part GGTACC represents KpnI cleavage site, and TCTAGA represents XbaI cleavage site, and the cleavage site is designed. The oxidation squalene cyclase gene and the PYES2.0 expression vector were digested with KpnI and XbaI. The oxidation squalene cyclase gene was ligated to pYES2.0 vector using T4 ligase to obtain a recombinant plasmid.

An embodiment of the present invention provides a recombinant engineering bacterium transformed with the recombinant vector.

In some embodiments, the host bacteria of the recombinant engineering bacteria contain 2, 3-oxidosqualene. The expression of the oxidosqualene cyclase by the recombinant engineering bacteria can directly catalyze the 2, 3-oxidosqualene in the strain to directly express the paclitaxel.

In some of these embodiments, the host strain of the recombinant engineering bacterium is a lanosterol-deficient yeast strain. Lanosterol-deficient yeast strains are used as host organisms and are unable to synthesize ergosterol, which is an important constituent of the yeast cell membrane, thereby accumulating the substrate 2, 3-oxidosqualene in the cell, and therefore the conversion and expression of lanosterol-deficient yeast strains with OSC genes leads to the conversion of the substrate 2, 3-oxidosqualene into the corresponding reaction products.

Further, the host strain of the recombinant engineering bacteria is lanosterol-deficient yeast strain Gil77. Lanosterol-deficient yeast strain Gil77 contains substrate 2, 3-oxidosqualene, and can directly catalyze 2, 3-oxidosqualene in the strain by expressing the oxidosqualene cyclase to directly express paclitaxel.

The research provides that recombinant engineering bacteria can clone or express the oxidation squalene cyclase of the research, and then catalyze a substrate to improve the yield of the paclitaxel, and can be used for preparing the paclitaxel.

An embodiment of the present study provides a method for preparing paclitaxel, comprising the steps of: performing amplification culture on recombinant engineering bacteria to obtain the paclitaxel, wherein the recombinant engineering bacteria are transformed with the recombinant vector, and the recombinant engineering bacteria contain 2, 3-oxidosqualene.

The present study creatively found that the oxidation squalene cyclase of the present study was used to catalyze the production of paclitaxel from 2, 3-oxidosqualene.

In some embodiments, the recombinant engineering bacterium is lanosterol-deficient yeast strain Gil77 transformed with a recombinant vector, and the step of performing expansion culture on the recombinant engineering bacterium to obtain the paclitaxel comprises the steps of S110-S130:

s110, performing expansion culture on recombinant engineering bacteria, performing solid-liquid separation and collecting the expanded culture bacteria.

Wherein, the culture medium for the enlarged culture of recombinant engineering bacteria is SC liquid culture medium SD-URA containing 2% (mass percent) glucose, 20 mug/mL supplement, 13 mug/mL heme and 5mg/mLTween 80. Wherein the supplement is ergosterol. For example: ergosterol from Fluka. Heme is for example heme from Sigma-Aldrich. Tween80 is, for example, tween80 from Sigma-Aldrich.

Wherein, the solid-liquid separation mode is centrifugation. The solid-liquid separation method is not limited to centrifugation, and may be performed by other methods, such as filtration.

In some embodiments, the method further comprises the step of transforming the recombinant vector into host bacteria to obtain recombinant engineering bacteria before the step of performing the expansion culture on the recombinant engineering bacteria.

Further, the step of transforming the recombinant vector into host bacteria to obtain recombinant engineering bacteria comprises the following steps: performing amplification culture on host bacteria, performing solid-liquid separation and collecting the host bacteria; preparing competent cells from host bacteria, mixing and incubating competent cells, recombinant vector and denatured salmon sperm DNA, and then carrying out solid-liquid separation and collecting cells; and culturing the collected cells on a selective culture medium to obtain the recombinant engineering bacteria. Wherein, the selective medium is SC liquid medium SD-URA with 2% (mass percent) glucose, 20 mug/mL supplement, 13 mug/mL heme, 5 mg/mLTwen 80, 5mg/mL agar. Wherein the supplement is ergosterol. For example: ergosterol from Fluka. Heme is for example heme from Sigma-Aldrich. Tween80 is, for example, tween80 from Sigma-Aldrich.

S120, performing induction culture on the expanded culture thalli to induce lanosterol synthase gene expression in the expanded culture thalli.

Wherein, the SC-U screening culture medium of raffinose and galactose is adopted to carry out induction culture on the bacterial cells which are cultivated in an enlarged way. The induction temperature was 30 ℃. The induction time was 2 days.

S130, after the induction is finished, solid-liquid separation is carried out, the bacteria subjected to induction culture are collected, and then the bacteria subjected to induction culture are cracked, so that the pachymol is obtained.

Wherein, the solid-liquid separation mode is centrifugation. The solid-liquid separation method is not limited to centrifugation, and may be performed by other methods, such as filtration.

Wherein, the lysate is used for lysing the induced culture thalli. The cracking liquid comprises 20% of alkali and 50% of absolute ethyl alcohol by mass percent. Wherein the base may be KOH or NaOH, for example. The cleavage temperature was 65 ℃. The cleavage time was 2h.

In some embodiments, the step of lysing the induced-cultured cells further comprises the step of: and (3) carrying out solid-liquid separation on a cracking mixture obtained after cracking, and collecting supernatant to obtain the paclitaxel. Further, after the step of collecting the supernatant, a step of verifying whether the supernatant contains paclitaxel is further included: the supernatant was detected using a gas chromatograph-mass spectrometer (GC-MS).

Through the preparation method of the parkinsonism, the parkinsonism can be directly produced by expressing the oxidation squalene cyclase to directly catalyze the 2,3 oxidation squalene in the strain, so that the one-step synthesis of the parkinsonism is realized.

The saponin is a secondary metabolite produced in the sea cucumber body, and has remarkable biological activities of resisting bacteria, tumors, inflammation, viruses, liver protection, blood fat reduction and the like. The process of saponin biosynthesis has not been fully elucidated, and this study has resolved a key step in the process of saponin synthesis, namely oxidation of squalene cyclase to catalyze the formation of paclitaxel from substrate 2,3 oxidation of squalene, which can be beneficial to increasing the amount of saponin by increasing the amount of the intermediate product, paclitaxel.

The following is a detailed description of embodiments.

Reagents and apparatus used in the examples, unless otherwise specified, are all routine choices in the art. The experimental methods without specific conditions noted in the examples are generally carried out according to conventional conditions, such as those described in the literature, books, or recommended by the manufacturer of the kit. The reagents used in the examples are all commercially available.

The selective plates were SC liquid medium SD-URA with 2% (mass percent) glucose, 20. Mu.g/mL supplement, 13. Mu.g/mL heme, 5 mg/mLTwen 80, 5mg/mL agar, unless otherwise specified. The liquid screening medium was SC liquid medium SD-URA with 2% (mass percent) glucose, 20. Mu.g/mL supplement, 13. Mu.g/mL heme, 5mg/mLTween 80. Wherein the supplement is ergosterol from Fluka. Heme is heme from Sigma-Aldrich. Tween80 is Tween80 from Sigma-Aldrich.

Example 1

1. Deep sea cucumber is obtained from deep sea (please provide a public source), a small amount of tissue is taken, TRIZOL reagent is extracted to extract RNA, transcriptome is measured, quality control, assembly, detection integrity, redundancy elimination, prediction, library establishment, comparison and OSC gene (namely oxidation squalene cyclase) are performed on transcriptome data. Wherein deep sea cucumber refers to sea cucumber Chiridota sp. The sea cucumber is collected from south China sea 1900m water depth (17 ° 9000'N,111 ° 2967' E). Reference is made to the following literature on OSC genes selected from the transcriptome: li, Y, wang, R, xun, X, wang, J, bao, L, thimmappa, R, … Wang, S (2018), sea cucumber genome provides insights into saponin biosynthesis and aestivation regulation.cell Discovery,4 (1), doi, 10.1038/s41421-018-0030-5.

2. The PCR reaction system used in the obtaining of the OSC gene was 50. Mu.L, which includes 10. Mu. L PrimeSTAR GXL Buffer, 4. Mu.L dNTPs, F and R primers each L. Mu.L, and template cDNAl. Mu.L, 2. Mu. L PrimeSTARGXL DNA Polymerase (TaKARa Co.) using H ₂ O the total volume was made up to 50. Mu.L. The primer pair in the PCR reaction system is a primer F and a primer R, wherein the primer F is GGGGTACCTACACAATGTCCTCCATTA; primer R, GCTCTAGATTAGGCTTGGGAAGTCAAA; the underlined part GGTACC represents KpnI cleavage site, TCTAGA represents XbaI cleavage site, and the cleavage site was designed to cleave the OSC gene and pYES2.0 expression vector with KpnI and XbaI. The PCR reaction conditions used in the obtaining of the target gene are as follows: storing at 98deg.C for 10s, 55deg.C for 15s, 68deg.C for 10s,30cycles, and 4deg.C. Recombinant plasmids were constructed by ligating the OSC gene to the pyes2.0 vector using T4 ligase.

3. The recombinant plasmid was transformed into lanosterol-deficient yeast strain Gil77, as follows:

5ml YPD medium was inoculated with Gil77 colonies and incubated overnight at 30 ℃. The colonies were centrifuged at 2500 rpm and the colonies were resuspended in 1ml of 1 XTE. The colonies were collected by centrifugation at 2500 rpm and resuspended in 1ml of 1 XLiAC/0.5 XTE. The cells were incubated at room temperature for 10min. The supernatant was removed by centrifugation, and 100. Mu.L of 1 XLiAC/0.5 XTE was added to prepare competent cells. To 100. Mu.L of yeast competent cell suspension was added 1. Mu.g of recombinant plasmid and 100. Mu.g of denatured salmon sperm DNA, 700. Mu.L of 1 XLiAc/40% PEG-3350/1 XTE, mixed well and incubated at 30℃for 30 minutes. 88 mu L of DMSO is added, stirred well and heat-shocked at 42 ℃ for 7min. The supernatant was centrifuged for 10s with a micro-centrifuge and discarded. Resuspended in 1ml of 1 XTE, centrifuged, the supernatant removed, 100. Mu.L of 1 XTE added and incubated on selective plates in an incubator at 30℃for 3 days.

4. Colonies on the plates were picked and grown in liquid screening media overnight. And centrifuging again, collecting thalli, and inducing lanosterol synthase gene expression by using an SC-U screening medium containing raffinose and galactose, wherein the induction temperature is 30 ℃ and the induction time is 2 days. After the induction, the thalli are collected by centrifugation, and the thalli are cracked by using a cracking liquid (NaOH with the mass percentage of 20 percent and absolute ethyl alcohol with the mass percentage of 50 percent), wherein the cracking temperature is 65 ℃, and the cracking time is 2 hours. The product was extracted with n-hexane, the supernatant was aspirated, dried with nitrogen, and 1mL of the n-hexane solution was used to detect the product by gas chromatography-mass spectrometry (GC-MS). Gas chromatograph-mass spectrometer conditions: the meteorological chromatographic column is HP-5MS (30 m multiplied by 0.25mm multiplied by 0.25um,Agilent Technologies); the carrier gas is helium, the flow rate is 0.8ml/min, the temperature of the sample inlet is 250 ℃, a non-split flow mode is adopted, the initial temperature is 80 ℃, the temperature is kept for 2min and is raised to 310 ℃, and the temperature is kept for 15min. EI ionization source EI, electron energy 70eV, full scan mode, scan area 50-600m/z. The sample loading was 1. Mu.L. The measurement results are shown in FIG. 1. FIG. 1 shows the results of GC-MS detection in example 1. In FIG. 1, the entire curve indicated by the arrow (1) represents the peak-out curve of the empty vector, the entire curve indicated by the arrow (2) represents the expression vector of the oxidosqualene cyclase, the peak indicated by the arrow (3) is paclitaxel, and the ordinate of FIG. 1 is abundance, and the abscissa is the peak-out time (in seconds).

As can be seen from fig. 1, the present application constructs its eukaryotic expression vector by constructing an oxidosqualene cyclase comprising a polypeptide consisting of the amino acid sequence as shown in SEQ ID No.1, and transferring the eukaryotic expression vector into GIL77 yeast to induce expression of the cyclase, which is capable of catalyzing the production of paclitaxel from squalene oxide, a substrate 2,3 of the recombinant yeast.

The saponin is a secondary metabolite produced in the sea cucumber body, and has remarkable biological activities of resisting bacteria, tumors, inflammation, viruses, liver protection, blood fat reduction and the like. The process of saponin biosynthesis has not been fully elucidated, and this study has resolved a key step in the process of saponin synthesis, namely oxidation of squalene cyclase to catalyze the formation of paclitaxel from substrate 2,3 oxidation of squalene, which can be beneficial to increasing the amount of saponin by increasing the amount of the intermediate product, paclitaxel.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims (14)

1. An oxidosqualene cyclase, characterized in that the oxidosqualene cyclase comprises:

a polypeptide consisting of an amino acid sequence as shown in SEQ ID No. 1; or (b)

A polypeptide consisting of one or more amino acids deleted, substituted or added from the amino acid sequence shown in SEQ ID No. 1; or alternatively, the first and second heat exchangers may be,

a polypeptide having at least 80% homology with a polypeptide consisting of the amino acid sequence shown in SEQ ID No. 1.

2. The oxidosqualene cyclase according to claim 1, characterized in that the coding sequence of the oxidosqualene cyclase comprises:

a nucleotide sequence as shown in SEQ ID No. 2;

or, a nucleotide sequence having 80% homology with the nucleotide sequence shown in SEQ ID No. 2;

or a nucleotide sequence obtained by deleting, substituting or adding one or more bases in the nucleotide sequence shown in SEQ ID No. 2.

3. A recombinant vector carrying a coding sequence for an oxidosqualene cyclase according to any one of claims 1-2.

4. The recombinant vector according to claim 3, wherein the recombinant vector is a eukaryotic cell expression vector carrying the coding sequence of the oxidosqualene cyclase.

5. The recombinant vector according to claim 3, wherein the recombinant vector is a pyes2.0 expression vector carrying the coding sequence of the oxidosqualene cyclase.

6. The method for preparing a recombinant vector according to any one of claims 3 to 5, comprising the steps of: and carrying out PCR amplification on the coding sequence of the oxidation squalene cyclase by adopting an amplification primer pair with nucleotide sequences shown as SEQ ID No.3 and SEQ ID No.4, and connecting the coding sequence into an empty vector to obtain the recombinant vector.

7. A recombinant engineering bacterium, characterized in that the recombinant engineering bacterium is transformed with the recombinant vector of any one of claims 3-5.

8. The recombinant engineering bacterium according to claim 7, wherein the host bacterium of the recombinant engineering bacterium contains 2, 3-oxidosqualene.

9. The recombinant engineering bacterium according to claim 7, wherein the host bacterium of the recombinant engineering bacterium is a lanosterol-deficient yeast strain.

10. The recombinant engineering bacterium according to claim 9, wherein the host bacterium of the recombinant engineering bacterium is lanosterol-deficient yeast strain Gil77.

11. Use of an oxidosqualene cyclase according to any of claims 1-2, a recombinant vector according to any of claims 3-5, or a recombinant engineering bacterium according to any of claims 7-10 for the preparation of pachymol.

12. A process for preparing paclitaxel comprising the steps of: performing amplification culture on recombinant engineering bacteria to obtain the paclitaxel, wherein the recombinant engineering bacteria are transformed with the recombinant vector according to any one of claims 3-5, and the recombinant engineering bacteria contain 2, 3-oxidosqualene.

13. The method of preparing paclitaxel according to claim 12, wherein the recombinant engineering bacterium is a lanosterol-deficient yeast strain Gil77 transformed with the recombinant vector, and the step of performing the expansion culture on the recombinant engineering bacterium to obtain the paclitaxel comprises:

performing amplification culture on the recombinant engineering bacteria, performing solid-liquid separation and collecting amplified culture thalli;

performing induction culture on the expanded culture thalli to induce lanosterol synthase gene expression in the expanded culture thalli;

after the induction is finished, solid-liquid separation is carried out, the bacteria subjected to induction culture are collected, and then the bacteria subjected to induction culture are cracked, so that the paclitaxel is obtained.

14. A parkeol prepared by the method of any one of claims 12-13.

Images