CN116265582A

CN116265582A - Nucleic acid aptamer capable of specifically binding African swine fever p30 protein and application thereof

Info

Publication number: CN116265582A
Application number: CN202210926063.4A
Authority: CN
Inventors: 王艳玲; 李凯; 王伟波; 杨建宇; 郝琴芳; 闫雷; 徐晓芳; 赵晨辰; 于晶晶; 王瑜; 刘祖宾; 娄群; 赵忠良; 董照洋; 宋明轩; 李宸辉; 张馨予; 王娇
Original assignee: Qingdao Animal Protection National Engineering Technology Research Center Co ltd; QINGDAO VLAND BIOTECH Inc
Current assignee: Qingdao Animal Protection National Engineering Technology Research Center Co ltd; QINGDAO VLAND BIOTECH Inc
Priority date: 2021-12-16
Filing date: 2022-08-03
Publication date: 2023-06-20

Abstract

The invention discloses a nucleic acid aptamer capable of specifically binding p30 protein of African swine fever ASFV and application thereof, and belongs to the field of molecular immunity. According to the invention, by using a SELEX technology, ASFV p30 protein is used as a binding antigen to screen a nucleic acid aptamer from a nucleic acid library, and then two nucleic acid aptamers with highest binding force and good specificity are identified through aptamer secondary structure prediction, aptamer affinity measurement, aptamer specificity detection and the like, wherein the core sequences of the nucleic acid aptamers are respectively shown as SEQ ID No:1 and SEQ ID No. 2. The ASFV p30 protein specific nucleic acid aptamer screened and prepared by the invention has excellent specificity and affinity, and provides important technical support for further research of ASFV antigen detection technology.

Description

Nucleic acid aptamer capable of specifically binding African swine fever p30 protein and application thereof

Technical Field

The invention belongs to the technical field of molecular immunity, and particularly relates to a nucleic acid aptamer capable of specifically binding African swine fever p30 protein and application thereof.

Background

The etiology of African Swine Fever (ASF) is African Swine Fever Virus (ASFV), and ASFV is mainly circulated in three modes of domestic pigs/pigs, domestic pigs/soft ticks/wild pigs, domestic pigs/soft ticks; the major target cells of viruses are monocytes and alveolar macrophages; soft ticks (Blunt ticks) are the primary vehicle for transmission and storage of the virus. ASFV is the only member of the African swine fever virus family and genus African swine fever virus; the genome encodes 151-167 proteins, and the mature virions contain 54 structural proteins. Among them, p30 protein is a protein produced early in viral infection, a protein of about 30kD encoded by the CP204L gene, and p30 is capable of inducing a strong immune response in the body due to its strong immunogenicity, and is generally used as a diagnostic antigen.

The existing method for detecting ASFV has the defects of high cost, low specificity and sensitivity, difficult commercialization, batch detection and the like. In particular, some detection methods based on antibody establishment have the problems of complex preparation process, long period and influence and limit the clinical application of the related detection method due to the instability of the antibody.

Disclosure of Invention

The invention aims to provide a nucleic acid aptamer capable of specifically binding African swine fever p30 protein and application thereof, so as to make up for the defects of the prior art.

The invention firstly provides a nucleic acid aptamer, and the sequence of the provided nucleic acid aptamer is as follows: 5'-AACCGCCCAAATCCCTAAGAGTC- (N) 42-TGTGCGTGTGTAGTGTGTCTGTG-3'; wherein (N) 42 has the sequence of SEQ ID NO:1 (CGTGCCGCCGTACTGCCCCCGACTAGAGACACACACCAACCC) or SEQ ID NO:2 (CGTGCCCGCCTCAATACCGCACCATTACACACACAGCGCCAC).

Further, the nucleic acid aptamer is combined with amino acid and derivatives thereof, polypeptide, protein, vitamin, hormone, nucleotide, biotin, digoxin, fluorescent substance, nano luminescent material, enzyme or colloidal gold.

Furthermore, the invention provides application of the nucleic acid aptamer in preparing an anti-ASFV medicament.

Further, the invention provides application of the nucleic acid aptamer in preparation of an ASFV-combined reagent.

Furthermore, the invention also provides a medicine containing the nucleic acid aptamer.

According to the invention, by using a SELEX technology, ASFV p30 protein is used as a binding antigen to screen a nucleic acid aptamer from a nucleic acid library, and then two nucleic acid aptamers with highest binding force and good specificity are identified through aptamer secondary structure prediction, aptamer affinity measurement, aptamer specificity detection and the like, wherein the core sequences of the nucleic acid aptamers are respectively shown as SEQ ID No:1 and SEQ ID No:2. The ASFV p30 protein specific nucleic acid aptamer screened and prepared by the invention has excellent specificity and affinity, and provides important technical support for further research of ASFV antigen detection technology.

Drawings

FIG. 1 is a diagram showing the prediction of secondary structures of nucleic acid aptamers, wherein a, b, c and d are secondary structures in which p30-ASFV-1, p30-ASFV-10, p30-ASFV-13 and p30-ASFV-46, respectively.

Fig. 2: a nucleic acid aptamer specificity identification map, wherein the dissociation equilibrium constant of p30-ASFV-13 is kd= 5.211nM; the dissociation equilibrium constant of p30-ASFV-46 was kd=3.896 nM.

Fig. 3: nucleic acid aptamer affinity assay.

Fig. 4: sandwich ELISA assay aptamer sensitivity assay.

Detailed Description

Nucleic acid aptamers (abbreviated as aptamers) are single-stranded DNA or RNA fragments capable of specifically binding to a variety of target substances; it can be obtained by screening by exponential enriched ligand system evolution (systematic evolution of ligands by exponential enrichments, SELEX) technique. Compared with antibodies, the aptamer has the advantages of wide variety of binding target substances (viruses, bacteria, cells, proteins, polypeptides, heavy metal ions and the like), low immunogenicity, good stability, low cost, quick and simple preparation, easy labeling, small molecular weight and the like. Therefore, the aptamer has wide application prospects in the fields of biomolecule detection, disease diagnosis and treatment, drug residue detection and the like, and the aptamer can become a powerful weapon for detecting or detecting biological and chemical molecules and treating diseases.

The experimental methods in the following examples are all conventional methods unless otherwise specified; the materials used in the examples are all conventional biochemical reagents, unless otherwise specified, and are commercially available.

The sources of the specific experimental materials described in the examples of the present invention are as follows:

1. protein screening kit was purchased from the company of Biotechnology, inc. of Onptuomai

The protein screening kit mainly comprises the following materials: carboxyl magnetic beads, fluorescent quantitative PCR Mix, an initial library to be screened with the sequence of 5'-CCTATGCGTGCTACCGTGAA-N (42) -GCTATGCGTGGAGTGCTGAA-3', common PCR Mix, ePCR micro-droplet generation oil, micro nucleic acid dialysis membrane and the like;

2. ASFV p30 protein gene is synthesized by Shanghai biological engineering Co., ltd, recombinant ASFV-p30, ASFV-p72, ASFV-p54 and ASFV-CD2v proteins with His tag are obtained by adopting a prokaryotic expression mode through Qingdao national animal health care product engineering center,

3. two mouse anti-ASFV p30 protein monoclonal antibodies (1C 3 and 10B 10) were given away by Harbin veterinary institute, his protein was purchased from Shanghai Bioengineering Co., ltd,

4. nitrocellulose membrane NC membrane is purchased from HRP-Streptavidin, TMB developing solution and TMB developing stop solution is purchased from Shanghai Biyun biotechnology Co., ltd,

5. ECL luminescence kit was purchased from Affinity Biosciences, ethyl [3- (dimethylamino) propyl ] carbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS) from Sigma-Aldrich.

Example 1: screening ASFV p30 protein specific nucleic acid aptamer

1.1 chromatographic purification of ASFV p30 protein

The ASFV p30 protein was coupled to the Ni-NTA medium using a histidine (His) tag carried by the recombinant protein. The method for fixing the recombinant ASFV p30 protein by using the Ni-NTA medium can be used for the following aptamer screening work, and the specific steps for fixing the p30 protein to the Ni-NTA medium are as follows: 1mL ASFV p30 protein was thawed at 4℃for use. Using a 1mL Ni-NTA column, the stock solution was discarded, and 5-10mL ddH was used ₂ O the Ni-NTA column was washed to remove the residue. Loading the melted recombinant ASFV p30 protein into a chromatographic column containing Ni-NTA medium. At 25℃the mixture was placed in a shaker and slowly shaken at 180rpm for about 4 hours.

1.2 screening of nucleic acid aptamer of ASFV p30 protein

High specificity, high affinity nucleic acid aptamers can be obtained using stringent screening conditions. In the screening process, the incubation time of ssDNA and recombinant protein is gradually reduced, ASFV p30 protein concentration is reduced, washing times are increased, and the negative selection procedure is performed, and the SELEX protocol for screening nucleic acid aptamers is specifically shown in fig. 1.

TABLE 1 ASFV p30 protein nucleic acid aptamer SELEX screening protocol table

Screening order	Recombinant proteins	Number of washes after incubation	Negative selection
				1～3	20μg	3	+
4～6	17.5μg	4	-
				7～10	15μg	5	+
11～14	12.5μg	6	-
				15～20	10μg	7	+
20～30	10μg	8	+

Note that: (+) means that a negative selection step is added at the beginning of the selection; (-) indicates that no negative selection step was added at the start of the selection.

1.3 negative selection of nucleic acid aptamers

Because of the extremely high abundance of nucleic acid sequences in the aptamer library, sequences exist that are capable of binding to the Ni-NTA medium in order to avoid non-specific sequences in the sequences that are subsequently screened that are compatible with the Ni-NTA medium but have low affinity for the target molecule. Prior to binding the recombinant protein to the aptamer library, the library is subjected to a negative selection process by incubation with a blank Ni-NTA medium. To remove part of the nucleic acid ligand which is compatible with the Ni-NTA medium, thereby improving the screening efficiency of target molecules and the specificity of the nucleic acid aptamer. The negative screening steps are as follows:

(1) preparation of cDNA Single-stranded library: mu.L of the aptamer library (150. Mu.M) was mixed in 200. Mu.L of coupling buffer. Heating at 98deg.C for 10min, and cooling at 4deg.C.

(2) Washing of Ni-NTA medium: the preservation solution was discarded using a Ni-NTA medium chromatography column which had been pre-assembled. With 5-10 volumes of ddH ₂ O washes the Ni-NTA medium to remove the residual solution.

(3) Upper column binding of single-stranded library: the aptamer library was column bound to the Ni-NTA medium while 2mL of coupling buffer was added and the Ni-NTA medium was stirred using a glass rod to be completely suspended. Shake at room temperature 120rpm for 2h.

(4) Collection of the screened starting library: the flow through was collected in the column while washing the Ni-NTA medium with 2mL of coupling buffer as many times as in Table 1.1. The flow-through was used as the starting library for screening.

1.4 Forward screening of nucleic acid aptamers

Because of the His tag carried by the ASFV p30 protein, the recombinant protein can be coupled to Ni-NTA medium. The recombinant ASFV p30 protein is immobilized in Ni-NTA medium, so that subsequent aptamer screening work can be performed. The forward screening procedure for nucleic acid aptamers is shown below.

(1) Taking the assembled chromatographic column for later use, screwing the lower outlet of the chromatographic column, loading the recombinant protein-Ni-NTA compound into the chromatographic column, opening the outlet, flushing the chromatographic column with coupling buffer solution according to the times of the table 1.1, and discarding the buffer solution.

(2) The first round of screening began with a direct incubation of 25. Mu.L (150. Mu.M) of the primary aptamer library (commissioned by Shanghai Biotechnology Co., ltd.) with Ni-NTA medium. In other screening steps, the prepared secondary aptamer library and the conjugate are uniformly mixed, and incubated for 1h at room temperature.

(3) Removing the non-specific nucleic acid aptamer: the column was washed with coupling buffer the number of times as in table 1.1 to remove non-specifically bound single stranded library.

(4) Establishment of a secondary aptamer library: single-stranded DNA-ASFV p30 protein complex was eluted using 3-4 column volumes of elution buffer (50mM,EDTA,10m M PBS solution) while ssDNA was recovered from the collection:

a. all the collections were added to a final volume of 20% isopropyl alcohol to increase recovery of ssDNA. After mixing, the liquid is loaded into an adsorption column for multiple times, and after centrifugation at 12000rpm for 1min, the waste liquid is discarded.

b. To effectively remove impurities such as proteins contained in the sample, 700. Mu.L of 80% absolute ethanol was added to the collection tube for rinsing, centrifugation at 12000rpm for 1min, discarding the waste liquid, and washing was repeated once.

c. Centrifuge at 12000rpm for 2min to remove the residual liquid. Placing at room temperature for 10-15 min, and airing.

d. Collecting ss DNA, transferring the adsorption column into clean EP tube, suspending, adding preheated sterile dd H ₂ O30-80 mu L, standing at room temperature for 10min, centrifuging at 12000rpm for 2min, and collecting a single-stranded library of the aptamer. (the filtrate may be re-introduced into the adsorption column and centrifuged again to increase the recovery rate of ss DNA.)

(5) The secondary screening library was obtained by PCR amplification, the recovered solution was labeled, and PCR was performed using the collected ss DNA as a template to prepare a secondary screening library. The PCR reaction system is shown below, with the upstream primer being 5'-CCTATGCGTGCTACCGTGAA-3' and the downstream primer being 5'-TTCAGCACTCCACGCATAGC-3'.

Table 2: single-stranded DNA library amplification System Table

Reagent(s)	Volume (mu L)
		Premix Taq	10
Upstream primer (100 mM)	1
		Downstream primer (100 mM)	1
cDNA	3
		DdH ₂ O	5
Total volume of	20

The PCR reaction procedure after 20. Mu.L of the system was completed was: 94 ℃ for 5min;94 ℃,30s,55 ℃,30s,72 ℃,20s,35 cycles; 72 ℃ for 5min; the reaction was terminated at 4 ℃.

The library amplified by the PCR was recovered by agarose gel, thereby purifying the library fragment. Heating the recovered liquid in a water bath at 95 ℃ for 10min, and then cooling the recovered liquid in 4 ℃. Thereby obtaining ssDNA as a next library screening.

(6) The above procedure was repeated for 30 rounds of screening. The coupled ASFV p30 protein Ni-NTA is added into a chromatographic column. The conjugate complex was first washed multiple times with buffer and then bound by adding 10 μl of the secondary library prepared in the upper round. After which a one-step negative selection was added every 3 rounds until round 20. The high specificity and high affinity aptamer could be obtained by decreasing the concentration of recombinant protein and increasing the number of elution times, and the detailed screening system is shown in Table 2.

(7) After 30 rounds of SELEX screening, the resulting PCR amplification products were subjected to agarose gel electrophoresis and recovered, and the resulting ssDNA recovered for subsequent clone sequencing.

Example 2: sequencing of ASFV p30 protein nucleic acid aptamer

The preparation method of the escherichia coli DH5 alpha competent cells comprises the following steps:

(1) activation of bacterial cells: the frozen E.coli DH 5. Alpha. Strain was streaked on LB solid plates and cultured overnight in a constant temperature incubator at 37 ℃.

(2) And (3) performing expansion culture: selecting DH5 alpha monoclonal colony with good growth condition from solid LB plate, shake culturing in 3mL LB liquid medium at 37deg.C to OD ₆₀₀ About 0.6. Inoculating the strain into 250mL of LB liquid medium with an inoculum size of 1:100, and culturing until OD ₆₀₀ About 0.5 to 0.6. The medium just started to become turbid.

(3) And (3) thallus collection: the bacterial solution was transferred to a sterile test tube and centrifuged at 4000rpm at 4℃for 10min.

(4) The upper medium was removed and the tube was inverted on sterile filter paper to blot the remaining medium.

(5) With pre-chilled 0.1M CaCl ₂ The solution resuspended cells.

(6) Cells were recovered by centrifugation at 4000rpm at 4℃for 10min. The tube was inverted to remove excess medium.

(7) With pre-chilled 0.1M CaCl ₂ The cells were resuspended in the solution and then mixed with glycerol solution. The cells were packed in centrifuge tubes and stored at-80℃until use.

Table 3: nucleic acid aptamer library-pMD-19T vector construction system

Reagent(s)	Volume of
		Recovery of target fragment from gel	1μg
pMD-19T	3μL
		Solution I	Supplement to 10 mu L
	Total volume of 10. Mu.L

The clone sequencing steps were as follows:

the above 10. Mu.L system was prepared and ligated overnight at 16 ℃. After detection by agarose gel electrophoresis, the vector was transformed into host DH 5. Alpha.

Recombinant vector transformation experiments:

(1) competent DH 5. Alpha. Was taken and dissolved on ice.

(2) The ligated system was added to competent DH 5. Alpha. And placed on ice for 30min.

(3) Heat-shocking at 42 deg.c for 90s, and then placing on ice for 10min.

(4) The cells were centrifuged at 8000rpm, and the supernatant was discarded. Fresh 1mL of LB medium was added, and the cells at the bottom of the centrifuge tube were gently blown up.

(5) The cells were placed in a shaking table at 37℃and cultured at 200rpm for 1 hour to resuscitate the cells.

(6) The resuscitated cells were centrifuged at 8000rpm for 1min to pellet the cells and part of the medium was discarded.

(7) The residual culture medium is used for suspending the thalli, and the thalli after suspension is taken and coated in an LB solid plate containing ampicillin. The coated plates were incubated at 37℃for 1h in the normal position and overnight in the inverted position.

Sequencing: the monoclonal colonies were picked in plates in 1mL of ampicillin-containing LB liquid medium, and the culture medium was just turbid at 37℃and 200 rpm. And (3) performing PCR amplification on the bacterial liquid, and selecting a PCR positive monoclonal bacterial liquid for sequencing. To Shanghai Biotechnology Inc., using the universal primer M13F. And (5) manually comparing the sequencing result and analyzing the sequencing result.

In the screening process, the screening pressure is increased to obtain the nucleic acid aptamer with excellent performance. After 10 rounds of screening. The resulting library of round 10 was subjected to clonal sequencing to obtain the full length of the nucleic acid sequence in the library. In the invention, 50 positive monoclonals are randomly selected, and the sequencing result is analyzed. From Table 4, it can be seen that repeated sequences appear in these 50 sequences, indicating that these sequences are enriched during the SELEX screening process. The cloning and sequencing result shows that 4 non-repeated nucleic acid aptamer sequences are obtained, wherein the frequency of occurrence of p30-ASFV-1 and p30-ASFV-10 sequences is highest.

Table 4: aptamer generation sequencing

Example 3: aptamer secondary structure prediction

The results obtained were sequenced and analyzed by bioinformatics methods. The resulting sequences were subjected to sequence alignment analysis using Clustal X software and set to 26℃by on-line software (http:// unafild. Rna. Albany. Edu/=mfold, conditions Na) ⁺ Concentration 150mM, mg ²⁺ Concentration 1 mM) for predicting and analyzing the secondary structure of the aptamer obtained by screening. The two-level structure of four kinds of aptamer with high occurrence frequency is predicted sequentially by using online Mfold software, and the result is shown in fig. 1. The predicted results show that the aptamer has a more common secondary structure of nucleic acid, namely a stem-loop structure, and is mostly used as a recognition structure in tRNA. It is speculated that the stem-loop structure in the secondary structure of the aptamer is the predominant form of its recognition target molecule. Comparison of the gibbs free energy of the four aptamer nucleotides shows that the gibbs free energy of the aptamer p30-ASFV-10 is the lowest and is more stable than the other aptamers. By observing the two-dimensional structure prediction diagrams of the four bars, p30-ASFV-1, p30-ASFV-10 and p30-ASFV-13 have similar structures, it is possible to recognize the same recognition site of the target molecule. While p30-ASFV-46 has a major difference in secondary structure from other nucleic acid aptamers and from other nucleic acid aptamers, potentially recognizing another site of the target molecule.

Example 4: ASFV p30 protein aptamer affinity detection

Binding of the target molecule to the aptamer can be considered as a chemodynamic equilibrium. The aptamer is continually bound to and dissociated from the target molecule until the rates of binding and dissociation reach equilibrium. Wherein the amounts of aptamer, target molecule, and complex remain in balance. Characterization of the affinity capacity for a nucleic acid aptamer can be characterized using dissociation constants. Based on the ELONA method, quantitative target molecules are immobilized in enzyme-labeled holes to be incubated with the nucleic acid aptamer, and the dissociation constant for the binding of the nucleic acid aptamer to the target molecules is measured to be used for characterization of the affinity of the nucleic acid aptamer. The experimental procedure was as follows:

(1) coating of antigen: the recombinant proteins were dissolved in 50mM carbonate coating buffer to a final concentration of 10. Mu.g/mL, 100. Mu.L protein solution was added to the 96-well ELISA plate, and the coating was allowed to stand at 4℃overnight.

(2) Closing: the next day the coating was discarded and washed three times with PBST on a horizontal shaker, 150. Mu.L of 1% BSA was added to each well and blocked for 1h.

(3) Adding biotin-labeled aptamer for incubation: the blocking solution was discarded, PBST was washed three times in a horizontal shaker, and 100. Mu.L of 1, 5, 10, 15, 20nM aptamer in PBS was added; incubate at 37℃for 2h.

(4) Incubation of streptavidin-labeled horseradish peroxidase: PBST wash three times, add 100 μl 1 per well: 500-1: the 1000 diluted SM-HRP secondary antibody was incubated at 100rpm for 1h at 37℃in a constant temperature shaker. After the incubation, 200. Mu.L of PBST wash solution was added to each well and placed in a constant temperature shaker with shaking at 37 ℃. The washing was performed 5 times in total.

(5) Color development: adding 100 μl of TMB substrate, developing for 20min in dark, and adding 2M H ₂ SO ₄ The reaction was terminated and absorbance was measured at 450 nm. To reduce experimental error, three replicates were set per sample.

The measurement of KD values was performed by ELONA method, the concentration of recombinant ASFV p30 protein was immobilized, and the concentrations of the aptamers p30-ASFV-1, p30-ASFV-10, p30-ASFV-13 and p30-ASFV-46 were varied to measure absorbance at a wavelength of 450 nm. OD with aptamer concentration on the abscissa ₄₅₀ A nonlinear fitting curve is established as the ordinate, and KD values are calculated. The results are shown in FIG. 2, where both p30-ASFV-13 and p30-ASFV-46 have a dissociation constant KD on the order of nanomoles with p30-ASFV-13 of 5.211nM and p30-ASFV-46 of 3.896nM, indicating that the two aptamers have a higher affinity for recombinant ASFV p30 protein, p30-ASFV-46 has a higher affinity than p30-ASFV-13 (FIG. 2).

Example 5: ASFV p30 protein aptamer specificity detection

Enzyme-linked immunosorbent assay (ELISA) is a basic detection technique in the fields of immunology, medicine, biochemistry and the like. ELISA is based on antigen-antibody interaction binding photometry, usually performed in microtiter plates. It is intended to detect and quantify very small amounts of antigens, such as proteins, peptides, hormones or antibodies, in liquid samples. With the advent of novel molecular recognition elements such as aptamer, droet et al have systematically analyzed the potential of aptamer to replace or supplement antibodies in ELISA, facilitating the development of Enzyme-linked oligonucleotide assays (Enzyme-Linked Oligo Nucleotide Assay, ELONA). The specificity of the aptamer based on ELONA is thus characterized by immobilization of different target molecules. The experimental procedure for the identification of the aptamer specificity of the ASFV p30 protein is as follows:

(1) coating of antigen: the recombinant protein was dissolved to 10. Mu.g/mL with 50mM carbonate coating buffer, 100. Mu.L per well was added to 96-well ELISA plates and left overnight at 4 ℃. Coating different proteins comprises the following steps: proteins such as ASFV-p30, ASFV-p72, ASFV-p54 and ASFV-CD2v.

(3) Adding biotin-labeled aptamer for incubation: the blocking solution was discarded, PBST was washed three times in a horizontal shaker and 100. Mu.L of 20nM aptamer in PBS was added; incubate at 37℃for 2h.

(4) Incubation of streptavidin-labeled horseradish peroxidase: PBST wash three times, add 100 μl of 1 per well: 500-1: the 1000 diluted SM-HRP secondary antibody was incubated at 100rpm for 1h at 37℃in a constant temperature shaker. After the incubation, 200. Mu.L of PBST wash solution was added to each well and placed in a constant temperature shaker with shaking at 37 ℃. The washing was performed 5 times in total.

Example 5: gel blocking to verify binding of aptamer to recombinant protein

Electrophoretic mobility measurement (Electrophoretic Mobility Shift Assay, EMSA), also known as gel blocking assay, is a commonly used technique of affinity electrophoresis for studying protein interactions with DNA or RNA. In order to verify whether there is an interaction between the recombinant protein and the aptamer, the present study uses EMSA technology to verify the aptamer and recombinant ASFV p30 protein. The experimental procedure was as follows:

mu.g of recombinant ASFV p30 protein was incubated with 20. Mu.M aptamer p30-ASFV-13, p30-ASFV-46, respectively, in 20mM phosphate buffer (pH 7.0) for 2h. A5% TAE-PAGE gel was prepared as shown in Table 5 and, after solidification, electrophoresed in a 1 XTAE solution. And uniformly mixing the sample after incubating the aptamer with the recombinant ASFV p30 protein and a non-denaturing loading buffer, loading the sample, and carrying out electrophoresis for 40min at 120V. After electrophoresis was completed, the gel was stained with SYBR Green I for 30min, and the results were observed in a gel imaging system.

Table 5:5% TAE-PAGE gel formulation table

Two nucleic acid aptamers p30-ASFV-13 and p30-ASFV-46 were specifically identified by ELONA. In order to exclude the possibility of false positives, BSA was used as a blank. The negative controls were recombinant ASFV-p72, ASFV-p54 and ASFV-CD2v, respectively. The two proteins are derived from different species, are all proteins which are expressed by the laboratory in a prokaryotic mode, and are provided with histidine tags. Four nucleic acid aptamers obtained by sequencing are detected. The results are shown in FIG. 3, where BSA, ASFV-p72, ASFV-p54 and ASFV-CD2v were not specifically recognized. Since all of ASFV-p72, ASFV-p54 and ASFV-CD2v contain a histidine tag, it is suggested that the aptamer has no specific recognition for the histidine tag. The results show that the aptamer p30-ASFV-13 and p30-ASFV-46 can specifically recognize recombinant ASFV p30 protein.

Example 6: aptamer-based sandwich ELISA assay for ASFV p30 protein

(1) The purified mouse anti-ASFV p30 protein monoclonal antibody (1C 3) was diluted to 4. Mu.g/mL with NanoDrop 2000 assay concentration, coated in 96-well plates, incubated at 37℃for 1h per well and washed 3 times with PBST for 3min each;

(2) Removing washing liquid, adding 100 mu L of blocking solution into each hole, and incubating for 1h at 37 ℃;

(3) ASFV p30 protein was diluted with dilution to 10. Mu.g/mL, 7.5. Mu.g/mL, 5. Mu.g/mL, 2.5. Mu.g/mL, 1. Mu.g/mL, 0.5. Mu.g/mL, 0.25. Mu.g/mL into the blocked wells, 100. Mu.L per well with PBS control wells established, incubated for 1h at 37℃and PBST washed 3 times for 3min each;

(4) Diluting biotin-labeled aptamer p30-ASFV-46 to 100nM, denaturing at 95℃for 5-8min for 15min in rapid ice bath, adding treated aptamer to test wells, adding 100 μl per well, adding 1:400-fold diluted murine anti-ASFV p30 monoclonal antibody (10B 10), PRRSV, CSFV, PRV and PCV2 as negative controls, cell supernatant and PBS as blank controls, incubating at 37℃for 1h, and washing with PBST 3 times for 3min each time;

(5) HRP-labeled streptavidin was added to wells incubated with biotin-labeled aptamer, HRP-labeled goat anti-mouse IgG was added to control wells incubated with mouse anti-ASFV p30 monoclonal (10B 10), diluted 1:1500 fold, 100 μl per well, 45min incubated at 37 ℃ and pbst washed 3 times for 3min each;

(6) 100 mu L of TMB single-component color development liquid is added into each hole, the color development is carried out for 15min in dark, and OD is measured ₄₅₀ As shown in FIG. 4, the result shows that the OD value is equal to or greater than the OD value of the negative control OD value multiplied by 2.1, which is a positive judgment, so that the lowest detection amount of the aptamer p30-ASFV-46 to the ASFV p30 protein is 0.25 mug/mL, and the lowest detection amount of the aptamer p30-ASFV-46 is 0.5 mug/mL superior to the mouse anti-ASFV p30 monoclonal antibody (10B 10).

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims

1. A nucleic acid aptamer, characterized in that the sequence of the nucleic acid aptamer is as follows: 5'-AACCGCCCAAATCCCTAAGAGTC- (N) 42-TGTGCGTGTGTAGTGTGTCTGTG-3'; wherein (N) 42 has the sequence of SEQ ID NO:1 or SEQ ID NO:2.

2. the aptamer of claim 1, wherein the aptamer is conjugated with an amino acid or a derivative thereof, a polypeptide, a protein, a vitamin, a hormone, a nucleotide, biotin, digoxin, a fluorescent substance, a nano luminescent material, an enzyme, or colloidal gold.

3. Use of the aptamer of claim 1 or 2 in the preparation of an anti-african swine fever virus medicament.

4. Use of a nucleic acid aptamer according to claim 1 or 2 in the preparation of a reagent for binding to african swine fever virus.

5. A medicament comprising the nucleic acid aptamer of claim 1 or 2.