CN1162541C - Cnidarian cytotoxin gene and its expression and application - Google Patents

Abstract

The present invention discloses a new sea anemone cytotoxin gene SrcI, which encodes toxin precursor proteins with 216 amino acids, signal peptide comprising 19 amino acids, propartmotif comprising 19 amino acids and mature proteins comprising 178 amino acids, wherein the molecular weight of the mature proteins is 19, 500 dalton, and the isoelectric point is 4.8. The gene of the present invention is acid sea anemone cytolysin. The present invention also discloses expression and an application of the new gene, which designs two pairs of primers which respectively constructs a recombinant prokaryotic expression carrier pBV220-SrcI and a recombinant eukaryotic expression carrier Adeno-SrcI. The recombinant sea anemone cytotoxin of the present invention has the anti-tumor activity. The present invention establishes a colibacillus expression system and an adenovirus expression system of rose and green sea anemone cytolysin, and can be used for developing new anti-tumor medicines.

Description

A kind of Cnidarian cytotoxin gene, its encoded protein and application

(1) technical field

The present invention relates to the new gene of a kind of Cnidarian cytotoxin.The invention still further relates to the expression and the application of encoded protein in preparation treatment tumor disease medicine thereof of said gene.

(2) background technology

Sea anemone (anthopleura) belongs to the Anthozoa (anthozoa) of Coelenterata (soelenterata), is than primary animal class in the ocean.In secular organic evolution process, in order to resist harmful animal and to catch food, the stinging capsule of sea anemone tentacle can be secreted multiple congestin, is the polypeptide toxoid basically, and humans and animals is had multiple physiological activity.Physiological function according to congestin is divided into 3 classes with it: Actinia neurotoxin, sea anemone cytolysin and sea anemone potassium-channel inhibitor.

Marine biotoxins with cytotoxicity is as one of source of screening anticancer and anti-virus formulation.In marine organisms, find the multiple polypeptides synocytotoxin.These marine organisms comprise: sea anemone, jellyfish, marine alga, sea urchin, sea hare, sponge etc.The sea anemone cytolysin can destroy the structure of cell, mainly is to act on cytolemma, with the lipid or the protein bound of cytolemma, makes it the perforation dissolving.The sea anemone cytolysin is a class basic protein, and the about 20kDa of molecular weight contains more than 30 strong basicity amino acid, lacks halfcystine, has cytolytic, cardiac toxic and other activity.Its secondary structure contains α spiral, βZhe Die, βZhuan Jiao and coiled structure at random; Combine the then increase to some extent of back α spiral, βZhe Die with film, coiled structure then reduces at random.The sea anemone cytolysin has at least two zones to participate in the combination of film fat (phosphatidylcholine, sphingosine, Sphingolipids,sialo) or membranin directly: the parents α spiral (amino-acid residue 13-20) of N-terminal and be rich in tryptophane zone (amino-acid residue 105-120); Parents α spiral inserts cytolemma, and the hydrophilic region that is rich in the tryptophane zone is reverse βZhe Die structure, extend in surface of cell membrane, arginine, Threonine and near amino acid can with the polar end effect of film fat, this mode of action with film fat is different with bacterium class cytolysin, and (the α spiral of bacterium class cytolysin is to combine with cholesterol in the cytolemma, form big hole, the dissolved cell film); The sea anemone cytolysin can be used as the model of eukaryote cytolysin.The sea anemone cytolysin often forms oligomer and works, and its mode of action can be described as: water-soluble sea anemone cytolysin → combine → insert cytolemma → formation oligomer → formation fenestra road → lysis with cytolemma or membrane receptor.For example: from the isolating a kind of cytolysin Sticholysin II of sea anemone (Stichodactyla helianthus), form the tetramer, insert cytolemma and form cationic channel, destroy cell.

The sea anemone cytolysin shows the various biological activity; Hemolytic activity, cytotoxicity, cardiac stimulation activity, blocking-up potassium-channel etc.Isolating HmT is 0.15ug/ml to half concentration of ordinary dissolution of HRBC from sea anemone (Heteractis magnifica).Is 35ug/kg from the isolating Equinatoxin II of sea anemone (Actinia equina) to the toxic limit medium dose of mouse, and the cause of death is a myocardial ischemia; Experiment shows that Equinatoxin II can directly act on heart, and toxicity is relevant with the concentration of toxin, causes that ventricular pressure reduces, and the thresholding that the blood exchange is slowed down is 0.1-1nM.Stichlysin I, Stichlysin II, Equinatoxin II have lethal effect, LC to pathogenic agent Giardia (a kind of protozoon) ₅₀Be respectively 0.5nM, 1.6nM, 0.8nM.When Ca++ existed, Equinatoxin II (100nM) can obviously make neurocytoma NG108-15 expand to break.Cytolysin III can kill and wound the Ehrlich ascitic tumour cell of vitro culture, and this tumour that is inoculated in mouse is also had certain restraining effect.The cytotoxic further research new to sea anemone is expected to obtain some medicine with cardiovascular effect or anticancer and anti-virus formulation.

The sea anemone cytolysin can carry out amalgamation and expression in E.Coli, the dissolved cell activity of recombinant protein and cytotoxic activity and native protein are quite active, but add that at N-terminal additional amino acid just reduces the activity of recombinant protein, the multiple more histone activity of additional amino acid is low more.The additional amino acid that N-terminal adds has disturbed the effect of α spiral and cytolemma, reduces the activity of toxin.

At present, after measured the secondary structure of some sea anemone synocytotoxins, but the higher structure of these toxin, molecular mechanism of action, film insert and the detail of the formation of oligomer is not clear.But, obtained high-resolution toxin protein crystalline structure (comprising that water-soluble state, film bonding state and fenestra form state) recently, higher structure, molecular mechanism of action, the film of illustrating the sea anemone synocytotoxin inserted and the formation of oligomer is helpful.

(3) summary of the invention

The object of the present invention is to provide a kind of new Cnidarian cytotoxin gene Src I.

Another object of the present invention is to provide above-mentioned new expression of gene.

Another object of the present invention is to provide the application of above-mentioned new gene in preparation prevention or medicine for treating tumor thing.

The selected sea anemone of the present invention is rose-red green sea anemone (Sagartia rosea), picks up from surrounding waters, Weizhou Island, Beihai, Guangxi Zhuang Autonomous Region.

The present invention has made up rose-red green sea anemone poison gland cDNA expression library: at first separate the sea anemone tentacle, extract total RNA, press the SMART of Clontech company then ^TMThe operation of cDNA LibraryConstruction Kit specification sheets is carried out, and obtains double-stranded cDNA, and the plasmid vector pcDNA3.0 that at last double-stranded cDNA is connected to transformation goes up and Transformed E .coli, thereby is built into the cDNA expression library of rose-red green sea anemone poison gland.

The present invention passes through the sequencing to the cDNA library clone of rose-red green sea anemone poison gland, has therefrom obtained the cDNA clone of a rose-red green sea anemone cytolysin of coding, is numbered Src I.216 amino acid whose toxin precursor proteins of this cDNA sequence encoding, comprise 19 amino acid whose signal peptides, 19 amino acid whose propart motif and 178 amino acid whose maturation proteins, the iso-electric point of maturation protein is 4.8, molecular weight is 19,500 dalton, be a kind of acidic protein, this is the acid sea anemone cytolysin of reported first.The N-terminal of maturation protein has the characteristic feature of sea anemone cytolysin, promptly has parents' α spiral.

The present invention is by a pair of special primer of design, the nucleotide sequence of the rose-red green sea anemone cytolysin maturation protein of coding is come out from the amplification of pcDNA3.0 carrier with PCR method, be cloned on the prokaryotic expression carrier pBV220, be built into expression plasmid pBV220-Src I and its transformed into escherichia coli DH5 α.Through to the groping and optimize of conditions such as incubation time, culture temperature, induction time, the Recombinant Protein Expression amount accounts for more than 15% of bacterial protein, and is in insoluble inclusion body state basically.

It is synthetic that above-mentioned primer is cut the site according to the multienzyme of maturation protein two terminal sequences of Src I genes encoding and prokaryotic expression carrier pBV220, upstream primer contains EcoR I enzyme and cuts sequence (GAATTC) and initiator codon (ATG), downstream primer contains BamH I enzyme and cuts sequence (GGATCC) and terminator codon (TTA), and sequence is as follows:

Upstream primer, 5 ' G GAATTC ATC TCG GGT GGT ACT GTT ATT 3 '

EcoR I enzyme is cut ATG code of sequence

Downstream primer, 5 ' TA GGATCC

TGG CCA GAC GAC TTC AAT C 3 '

BamH I enzyme is cut the sequence terminator codon

The present invention also gropes and has optimized the proteic purification condition of reorganization Src I, by washing, sex change, renaturation and the ion exchange chromatography of inclusion body, can obtain purity and reach reorganization Src I albumen more than 98%.

The reorganization Cnidarian cytotoxin biologically active that the present invention obtains.

The reorganization Src I albumen that the present invention obtains has tangible effect, IC to liver cancer cell BEL-7401, stomach cancer cell BGC-823, the lung carcinoma cell Nsclc of vitro culture ₅₀Be respectively 31.2ug/ml, 3.1ug/ml, 3.1ug/ml.

The reorganization Src I albumen that the present invention obtains carries out abdominal injection to the NIH mouse, liver-cancer solid tumor and the S-180 solid tumor that is inoculated in mouse there is the obvious suppression effect, tumour inhibiting rate is respectively 39.5%, 26.5%, and working concentration is respectively 0.6mg/kg, 1.2mg/kg.

The present invention has made up the expression plasmid pBV220-Src I of Src I Cnidarian cytotoxin mature protein coding sequence, by this expression plasmid carrier through EcoRI I/BamH I double digestion, can obtain the fragment of 534bp, be rose-red green Cnidarian cytotoxin Src I mature polypeptide coding sequence.

The present invention is by designing another to special primer, the maturation protein nucleotide sequence of the rose-red green sea anemone cytolysin of coding is come out from the amplification of pcDNA3.0 carrier with PCR method, be cloned on the shuttle plasmid pshuttle, construction recombination plasmid pshuttle-Src I, this plasmid links to each other with carrier for expression of eukaryon Adeno-X by behind the PI-Sce I/I-Ceu I double digestion, be built into recombinant adenovirus Adeno-Src I plasmid, the DNA of Adeno-Src I cuts the back by Pac I enzyme and is packaged into virus particle at HEKC HEK293.Recombinant adenovirus can be expressed in eukaryotic cell, is used for the treatment of relative disease.

It is synthetic that above-mentioned primer is cut the site according to the multienzyme of maturation protein two terminal sequences of Src I genes encoding and shuttle plasmid pShuttle, upstream primer contains Apa I enzyme and cuts sequence (GGGCCC) and initiator codon (ATG), downstream primer contains Not I enzyme and cuts sequence (GCGGCCGC) and terminator codon (TTA), and sequence is as follows:

Upstream primer, 5 ' GG GGGCCC

ATCTCGGGTGGTACTGTTATTG 3 '

Apa I enzyme is cut ATG code of sequence

Downstream primer, 5 ' GTCAT GCGGCCG C

TGGCCAGACGACTTCAATC 3 '

Not I enzyme is cut the sequence terminator codon

The clone method of expression plasmid carrier of the present invention:, press CaCl with reference to Sambrook (Sambrook, etal.1989, Molecular cloing.Cold Spring Harbor Labroratory Press.USA) method ₂Method transforms plasmid in E.Coli.DH5 α or BL21 (DE3) bacterial strain, with the LB substratum transform bacteria that contains penbritin (100 μ g/mL), alkaline process extracts plasmid.

(4) description of drawings

Fig. 1 is the total RNA electrophoresis result of rose-red green sea anemone tentacle;

Fig. 2 is the double-stranded cDNA electrophoresis result of rose-red green sea anemone tentacle;

Fig. 3 is the total plasmid in rose-red green sea anemone tentacle cDNA library, Sfi I enzyme is cut and PCR detects electrophoresis result;

Fig. 4 is that the PCR of rose-red green sea anemone tentacle cDNA library recon detects electrophoresis result;

Fig. 5 is that the recombinant plasmid pBV220-Src I expression plasmid that contains gene Src I makes up;

Fig. 6 is the PCR product electrophoresis result of rose-red green sea anemone Src I gene;

Fig. 7 is that the pBV220-Src I expression plasmid enzyme that contains gene Src I is cut and PCR evaluation electrophoresis result;

Fig. 8 is the SDS-PAGE of the proteic expression of reorganization Src I, inclusion body sex change, renaturation and ion exchange chromatography;

Fig. 9 is reorganization Src I albumen iso-electric point figure;

Figure 10 is the proteic haemolysis graphic representation of reorganization Src I;

Figure 11 is the light microscopic photo of reorganization Src I albumen effect human liver cancer cell BEL-7402;

Figure 12 is the fluorescence photo of reorganization Src I albumen effect human liver cancer cell BEL-7402;

Figure 13 is the light microscopic photo of reorganization Src I albumen effect gastric carcinoma cells BGC-823;

Figure 14 is the fluorescence photo of reorganization Src I albumen effect gastric carcinoma cells BGC-823;

Figure 15 is the result of reorganization Src I albumen effect human lung carcinoma cell Nsclc;

Figure 16 is the structure of Adeno-Src I expression system;

Figure 17 cuts evaluation for the PI-Sce I/I-Ceu I enzyme of recombinant adenovirus Adeno-Src I;

Figure 18 cuts for the Pac I enzyme of recombinant adenovirus Adeno-Src I.

Among Fig. 1,1:RNA ladder (Promega company); 2: the total RNA of rose-red green sea anemone tentacle.

Among Fig. 2,1:1kb DNA ladder (Promega company); 2: rose-red green sea anemone tentacle dsDNA.

Among Fig. 3,1:1kb DNA ladder (Promega company); 2: the PCR result of the total plasmid in library; 3: the total plasmid in library; 4: the Sfi I enzyme of the total plasmid in library is cut the result.

Among Fig. 4, M:1kb DNA ladder (Promega company); 1-21: the PCR of library recon detects.

Among Fig. 6,1:1kb DNA marker (NEB company); 2: the PCR product of rose-red green sea anemone Src I gene.

Among Fig. 7,1:1kb DNA marker (NEB company); The EcoR I/BamH I double digestion of 2:pBV220-Src I; The PCR of 3:pBV220-Src I identifies.

Among Fig. 8,1:marker; 2: the total thalline of inductive not; The 3:42 ℃ of total thalline of inductive; 4: ultrasonic supernatant; 5: ultrasound precipitation; 6: inclusion body is through the supernatant of washing; 7: the Src I after the renaturation is through the 0.3M of ion exchange chromatography Nacl elution peak; 8: the Src I after the renaturation is through the 0.8M of ion exchange chromatography Nacl elution peak.

Among Fig. 9,1:marker; 2:Src I recombinant protein.

Among Figure 17, the PI-Sce I/I-Ceu I enzyme of 1:Adeno-Src I is cut; 2:1kb DNA marker (NEB company).

Among Figure 18, the Pac I enzyme of 1:Adeno-Src I is cut; 2:1kb DNA marker (NEB company).

(5) embodiment

The invention will be further described below in conjunction with accompanying drawing, will help those of ordinary skill in the art to understand the present invention, but not limit the present invention in any form.

The structure in embodiment one rose-red green sea anemone poison gland cDNA library

The extraction of the total RNA of rose-red green sea anemone poison gland is carried out with reference to a step Rapid Thermal phenol extraction process of " modern molecular biology experimental technique "; The synthetic SMART of Clontech company that presses of cDNA ^TMThe operation of cDNA Library Construction Kit specification sheets.

As seen the total RNA of poison gland that adopts the guanidinium isothiocyanate single stage method to extract detects two rRNA bands of 28S, 18S clearly through 1% denaturing formaldehyde gel electrophoresis, as Fig. 1, shows that total RNA integrity is good.Adopt SMART ^TMCDNA Library Construction Kit synthetic cDNA electrophoresis on 1% sepharose, the result presents uniform smear, as Fig. 2, size is in 200bp arrives the scope of 8kb, mainly be the zone below 3kb, more concentrated near 500bp, show that the integrity of cDNA is good.CDNA inserted be built into the cDNA expression library on the plasmid vector pcDNA3.0, the library clone number is 2.4 * 10 ⁵Extract total library plasmid and carry out that enzyme is cut and pcr analysis, as Fig. 3, the result shows that cDNA inserts clip size and drops in the scope of 300bp-8kb, 172 clones of picking extract plasmid, enzyme is cut with PCR and is identified that the clone who shows above 95% is recon, as Fig. 4, show that this cDNA expression library has preferable quality.

Clone, sequencing and the analysis in embodiment two rose-red green sea anemone tentacle cDNA libraries

Select the clone in rose-red green sea anemone tentacle cDNA library, press the method for Omega Biotek PlasmidMiniprep Kit and extract plasmid DNA.150 cDNA sequences have been measured at random.Use ABI PRISM 377 DNA Analyzer (Applied Biosystems), adopting T7 and SP6 universal primer is sequencing primer, carries out forward and reverse sequencing, the cDNA fragment is surpassed the sequence of 1000bp, according to the sequences Design primer that has recorded, continue to survey logical cDNA.Examining order is finished by centralab of life science institute of Guangzhou Zhongshan University.Institute's calling sequence is through Blast X initial analysis.The result shows that the gene that rose-red green sea anemone poison gland cDNA library comprises is varied, wherein the abundance of toxin gene is higher, the cDNA sequence of three coding Actinia neurotoxins and the cDNA sequence of a coding sea anemone cytolysin are arranged, the cDNA of cytolysin of wherein encoding is numbered Src I, shown in sequence table, its 216 amino acid whose albumen of encoding, signal peptide comprising 19 amino-acid residues, the propart motif of 19 amino-acid residues and the maturation protein of 178 amino-acid residues, the N-terminal of maturation protein have sea anemone cytolysin characteristic α spiral.The molecular weight of maturation protein is 19,500 dalton, and proteic iso-electric point is 4.8, is acid cytolysin.At present, the sea anemone cytolysin of all reports is a strong basicity albumen, and iso-electric point finds that more than 9.0 acid cytolysin still belongs to the first time in sea anemone.

The nucleotide sequence of Src I and the aminoacid sequence of supposition are seen sequence table.Total RNA is the material that sets out with rose-red green sea anemone tentacle, according to acquired cytolysin cDNA sequences Design 3 ' end primer, with SMART ^TMThe library construction primer of cDNA Library Construction Kit is 5 ' end primer, carries out RT-PCR, the specific amplified band of expection occurs at the 800bp place, reclaims this band.The PCR product that reclaims is connected to pGEM-T Easy Vector, transforms DH5 α intestinal bacteria, select the positive colony order-checking.Confirming through sequencing analysis, is our desired goal gene that obtains, and 8 clones of mensuration are same cDNA sequence.

The structure of the rose-red green sea anemone cytolysin expression plasmid of embodiment three reorganization

Cut the site according to maturation protein two terminal sequences of Src I genes encoding and the multienzyme of prokaryotic expression carrier pBV220, synthetic a pair of primer, sequence is as follows:

Upstream primer, 5 ' G GAATTC

ATC TCG GGT GGT ACT GTT ATT 3 '

Single underscore is partly cut sequence for EcoR I enzyme, and double underline is an initiator codon

Downstream primer, 5 ' TA GGATCC TGG CCA GAC GAC TTC AAT C 3 '

Single underscore is partly cut sequence for BamH I enzyme, and double underline is a terminator codon

Pcr amplification, gene clone are carried out all according to a conventional method.The about 600bp of PCR product, 178 amino-acid residues of encoding are as Fig. 6.Goal gene is cloned on the prokaryotic expression carrier pBV220, is built into expression plasmid pBV220-Src I, building process is seen Fig. 5.Cut through enzyme and to identify with sequencing analysis and show that cloned genes is goal gene such as Fig. 7.

Prokaryotic expression carrier pBV220 contains P _RP _LPromotor contains the cI regulatory gene simultaneously, and the foreign gene that has an initiator codon can insert the multienzyme in promotor downstream and cut the site, expresses non-fusion rotein, and product can be for clinical use.

The proteic expression of the rose-red green sea anemone cytolysin of embodiment quadruple group

With expression plasmid pBV220-Src I transformed into escherichia coli DH5 α.The engineering bacteria that contains goal gene grows into OD at 30 ℃ ₆₀₀=0.5 o'clock, induced 4 hours at 42 ℃ immediately.Collect thalline, show through the SDS-PAGE electrophoretic analysis: genetic engineering bacterium has tangible specifically expressing product band after inducing, molecular weight conforms to predictor 20kD, as Fig. 8.The thin layer scanning analysis revealed: the Recombinant Protein Expression amount accounts for more than 17% of bacterial protein with this understanding, is in insoluble inclusion body state basically.

The proteic purifying of the rose-red green sea anemone cytolysin of embodiment quintet

Thalline after inducing is by carrying out ultrasonic bacteria breaking, and centrifuging and taking precipitation, precipitation are passed through different buffered soln washings, remove foreign protein, and the inclusion body purity after the washing is 80%.The solution of using in the inclusion body washing has: ultrasonic buffer (10mM Tris-Hcl, pH7.0,1mM EDTA), buffer1 (0.1M Tris-Hcl, pH8.0,10mM EDTA, 0.5%Triton X 100), buffer 2 (50mMPB, 0.5M Nacl, 3M urea) and buffer 3 (0.1M Tris-Hcl, pH8.5,10mM EDTA, 3M urea).

Inclusion body after the washing is in sex change liquid (8M urea, 10mM Tris-Hcl, pH8.0,10mMDTT) middle dissolving.Metaprotein is passed through the dialysis renaturation in renaturation solution (3M urea, 20mM Tris-Hcl, pH8.0,0.1mM Sleep-promoting factor B, 0.9mM reduced glutathion).

Recombinant protein can obtain purity at the recombinant protein more than 99%, as Fig. 8 by ion exchange chromatography and hydrophobic chromatography.

The mensuration of the rose-red green sea anemone cytolysin albumen iso-electric point of embodiment sixfold group

By the iso-electric point of disk electrophoresis mensuration recombinant protein, the isoelectrofocusing polyacrylamide gel electrophoresis carries out according to a conventional method.The result who measures is: pH 4.81, as Fig. 9.Substantially conform to the iso-electric point of prediction.

The proteic hemolytic activity of embodiment septuple group sea anemone cytolysin is identified

Get human blood 5ml, add 3.8% Trisodium Citrate (Trisodium Citrate: blood is 1: 9), room temperature, 3000rpm, centrifugal 5 minutes.Remove supernatant, use Hank ' s liquid Washed Red Blood Cells, up to supernatant limpid (need use approximately Hank ' s washing 2-3 time), use Hank ' s that red corpuscle is made into the cell suspension of 0.5% or 1% (v/v), sample is joined in the red cell suspension of 2ml, 37 ℃ of incubations 20 minutes, room temperature, 3000rpm, centrifugal 5 minutes, get supernatant, measure OD ₅₄₀With the negative contrast of Hank ' s, make red corpuscle 100% haemolysis with final concentration 0.1mg/ml saponin(e.The sample of each concentration is done three parallel laboratory tests.Result such as Figure 10.

Embodiment eightfold group sea anemone cytolysin albumen is to the effect of the tumour cell of vitro culture

Tumour cell is pressed 1.0 * 10 ⁶Cell/ml is inoculated in 24 orifice plates, adds sample when cell grows into 60%-70% degree of converging, and each sample concentration is done 4 parallel laboratory tests, with Hank ' s as negative control.

Apoptotic fluoroscopic examination (Hoeches 55258 stainings): the Paraformaldehyde 96 with 4% at 4 ℃ with cell fixation 20 minutes, use Hank ' s washing 2 times, add Hoeches 55258 dye liquors, final concentration is 5-10ug/ml, room temperature dyeing 10 minutes, use Hank ' s washing 2 times, under fluorescent microscope, observe.

Recombinant protein (0.31ug/ml with different concns, 3.1ug/ml, 7.8ug/ml, 15.6ug/ml, 31.2ug/ml, 72.1ug/ml) join among the human liver cancer cell BEL-7402, in 0-36 hour, observe, 0.31-15.6ug/ml the sample pair cell of concentration is influence not, when the concentration of 31.2ug/ml, can cause that cellular form significantly changes, as Figure 11, cell obviously elongates, this phenomenon is just apparent in view after 8 hours at adding albumen, be maintained to 36 hours (not observing after 36 hours), om observation does not have downright bad phenomenon, do not observe apoptotic phenomenon by the dyeing of Hoeches 55258 stainings, as Figure 12.Haemolysis from recombinant protein, recombinant protein should be able to the cytolemma effect, phenomenon from recombinant protein effect liver cancer cell BEL-7402, recombinant protein not only with the cytolemma effect, also may with the albumen effect on the film, cause the change of signal, cause the variation of microtubule, microfilament etc., cause the change of cellular form.

The recombinant protein (0.31ug/ml, 3.1ug/ml, 7.8ug/ml, 15.6ug/ml, 31.2ug/ml, 72.1ug/ml) of different concns is joined among the low differentiation of the people stomach cancer cell BGC-823, observe after adding sample, after 6 hours, 3.1ug/ml sample concentration cell rounding is diminished, as Figure 13, through fluorescent dye, visible cell nuclear obviously diminishes, kytoplasm is only surplus to be wrapped in the extranuclear skim, as Figure 14.

The recombinant protein (0.31ug/ml, 3.1ug/ml, 7.8ug/ml, 15.6ug/ml, 31.2ug/ml, 72.1ug/ml) of different concns is joined among people's nonsmall-cell lung cancer Nsclc, observe after adding sample, after 6 hours, 3.1ug/ml sample concentration just can make cell expand, break, as Figure 15, through Hoeches 55258 dyeing as can be known, cell is not an apoptosis, most necrocytosises.

Embodiment nine reorganization sea anemone cytolysin albumen are to the antitumor test of rat liver cancer (Heps) and sarcoma S-180

The inhibition test of recombinant protein carries out according to a conventional method; Animal is the NIH mouse, provides (2000A037) by No.1 Military Medical Univ. experimental animal center; Medication is an abdominal injection; Negative control is a physiological saline, and positive control is an endoxan; Test is finished by occupational health inspection center, Guangdong Province; Test-results sees Table 1,2.

The recombinant protein of purifying carries out abdominal injection to the NIH mouse, and liver-cancer solid tumor and the S-180 solid tumor that is inoculated in mouse all had restraining effect, is 39.1% to the tumour inhibiting rate of liver-cancer solid tumor, and activity is 0.6mg/kg; Tumour inhibiting rate to the S-180 solid tumor is 26.9%, and activity is 1.16mg/kg.

Table 1 reorganization Src I albumen is for the restraining effect of rat liver cancer solid tumor (Heps)

The dosage treated animal is counted the heavy tumour inhibiting rate P of body weight knurl value

(mg/ml) begin to finish to begin to finish (Mean ± sd) (%)

0 9 9 18.2 22.4 1.89±0.65 - -

0.065 9 9 18.0 21.6 1.15±0.56 39.15 ＜0.05

Cp，20 10 10 18.5 19.4 0.72±0.27 61.90 ＜0.01

P value: compare variance analysis with control group.

Table 2 reorganization Src I albumen is to the restraining effect of murine sarcoma (S-180)

The dosage treated animal number heavy tumour inhibiting rate thymus index of the knurl spleen index liver index of putting on weight

(mg/m1) begin to finish (g) (g) (%) (1/1000) (1/1000) (1/100)

0 10 10 2.58±2.24 1.53±0.44 - 3.28±0.85 4.93±1.62 5.35±0.62

Cp，20 10 10 1.23±1.29 0.64±0.25 58.33 ^▲▲ 2.16±0.40 ^▲▲ 4.07±1.02 5.80±0.56

0.116 10 10 3.26±1.07 1.12±0.58 26.87 ^▲ 3.41±0.78 6.54±1.76 ^▲ 5.54±0.55

0.031 10 10 3.49±1.14 1.19±0.47 15.56 3.29±0.60 5.79±0.78 5.26±0.52

P value: compare variance analysis with control group. ^▲P＜0.05， ^▲▲P＜0.01

The structure of embodiment ten recombinant adenovirus Adeno-Src I

Working method is pressed the Adeno-X of Clontech company ^TMExpression System UserManual carries out.Cut the site according to maturation protein two terminal sequences of Src I genes encoding and the multienzyme of shuttle plasmid pShuttle, synthetic a pair of primer, sequence is as follows:

Upstream primer, 5 ' GG GGGCCC

ATCTCGGGTGGTACTGTTATTG 3 '

Single underscore is partly cut sequence for Apa I enzyme, and double underline is an initiator codon

Downstream primer, 5 ' GTCAT GCGGCG C

TGGCCAGACGACTTCAATC 3 '

Single underscore is partly cut sequence for Not I enzyme, and double underline is a terminator codon

Pcr amplification, gene clone, plasmid extraction etc. are carried out according to a conventional method.The PCR product cloning to shuttle plasmid pShuttle, is built into pShuttle-Src I plasmid; PShuttle-Src I is connected with adenovirus carrier by behind the PI-Sce I/I-Ceu I double digestion, is built into recombinant adenovirus Adeno-SrcI; Recombinant adenovirus Adeno-Src I cuts through the PacI enzyme, and as Figure 18, back transfection Human Embryonic Kidney HEK 293 cells are packaged into virus particle in the HEK293 cell, and the recombinant adenovirus of extraction can be used for cell in vitro and in vivo test, and product can be for clinical use.The structure detailed process of recombinant adenovirus is seen Figure 16.Cut through enzyme and to identify with sequencing analysis and show that cloned genes is a goal gene, as Figure 17.

Sequence table

＜110〉Zhongshan University

＜120) a kind of Cnidarian cytotoxin gene, its encoded protein and application

<130>

<140>

<141>

<160>2

<170>PatentIn?Ver.2.1

<210>1

<211>749

<212>DNA

＜213〉rose-red green sea anemone (Sagartia rosea sp)

<220>

<221>CDS

<222>(54)..(701)

<220>

<221>sig_peptide

<222>(54)..(110)

<220>

<221>mat_peptide

<222>(168)..(701)

<220>

<221>precursor_RNA

<222>(110)..(167)

<400>1

agttcaagtc?aaaagatacc?cctttcattg?ctggaaagat?tgaacgtcaa?atc?atg 56

Met

agt?cgc?ctg?atc?gtc?gtt?tgc?att?gtc?att?tcg?atg?ata?tgc?gga?gcc 104

Ser?Arg?Leu?Ile?Val?Val?Cys?Ile?Val?Ile?Ser?Met?Ile?Cys?Gly?Ala

-35 -30 -25

ctt?tcc?ttg?tcg?tca?acc?aag?atg?gct?gat?gaa?aaa?aaa?gaa?aaa?gat 152

Leu?Ser?Leu?Ser?Ser?Thr?Lys?Met?Ala?Asp?Glu?Lys?Lys?Glu?Lys?Asp

-20 -15 -10

gaa?gac?gag?aaa?ccc?aaa?atc?tcg?ggt?ggt?act?gtt?att?gca?gct?ggg 200

Glu?Asp?Glu?Lys?Pro?Lys?Ile?Ser?Gly?Gly?Thr?Val?Ile?Ala?Ala?Gly

-5 -1 1 5 10

aga?ttg?acc?ctg?gat?ctc?ttg?aaa?acg?ttg?ctc?ggt?aca?ctt?ggt?agt 248

Arg?Leu?Thr?Leu?Asp?Leu?Leu?Lys?Thr?Leu?Leu?Gly?Thr?Leu?Gly?Ser

15 20 25

atc?tct?aga?aag?att?gca?att?ggt?gtt?gac?aac?gag?acg?ggt?ggg?cta 296

Ile?Ser?Arg?Lys?Ile?Ala?Ile?Gly?Val?Asp?Asn?Glu?Thr?Gly?Gly?Leu

30 35 40

att?aca?gga?aat?aac?gta?tat?ttc?cgt?tcc?ggg?acc?tct?gat?gac?atc 344

Ile?Thr?Gly?Asn?Asn?Val?Tyr?Phe?Arg?Ser?Gly?Thr?Ser?Asp?Asp?Ile

45 50 55

ctc?cct?cat?cgt?gtg?gaa?act?ggt?gaa?gcg?ctt?ctc?tat?aca?gct?cgc 392

Leu?Pro?His?Arg?Val?Glu?Thr?Gly?Glu?Ala?Leu?Leu?Tyr?Thr?Ala?Arg

60 65 70 75

aaa?act?aaa?ggc?cca?gtc?gca?aca?ggt?gcc?gtt?gga?gta?ttt?act?tat 440

Lys?Thr?Lys?Gly?Pro?Val?Ala?Thr?Gly?Ala?Val?Gly?Val?Phe?Thr?Tyr

80 85 90

tac?ttg?agc?gat?gga?aac?aca?ctg?gca?gtg?tta?ttc?agc?gtc?ccc?ttt 488

Tyr?Leu?Ser?Asp?Gly?Asn?Thr?Leu?Ala?Val?Leu?Phe?Ser?Val?Pro?Phe

95 100 105

gat?tat?aac?ttc?tac?agc?aac?tgg?tgg?aat?gtc?aag?atc?tat?tca?gga 536

Asp?Tyr?Asn?Phe?Tyr?Ser?Asn?Trp?Trp?Asn?Val?Lys?Ile?Tyr?Ser?Gly

110 115 120

aaa?cgg?aat?gcg?gac?tat?gat?atg?tac?cat?gag?ctg?tac?tat?gat?gcg 584

Lys?Arg?Asn?Ala?Asp?Tyr?Asp?Met?Tyr?His?Glu?Leu?Tyr?Tyr?Asp?Ala

125 130 135

aat?cca?ttc?gag?ggg?gac?gat?acc?tgg?gag?tat?aga?tac?ctt?gga?tat 632

Asn?Pro?Phe?Glu?Gly?Asp?Asp?Thr?Trp?Glu?Tyr?Arg?Tyr?Leu?Gly?Tyr

140 145 150 155

gga?atg?agg?atg?gaa?ggt?tac?atg?aac?agc?ccc?gga?gaa?gcg?att?ctt 680

Gly?Met?Arg?Met?Glu?Gly?Tyr?Met?Asn?Ser?Pro?Gly?Glu?Ala?Ile?Leu

160 165 170

aag?atc?acg?gtg?atg?ccc?gat?tgaagtcgtc?tggccaaagc?aaaaaaaaaa 731

Lys?Ile?Thr?Val?Met?Pro?Asp

175

aaaaaaaaaa?aaaaaaaa 749

<210>2

<211>216

<212>PRT

＜213〉rose-red green sea anemone (Sagartia rosea sp)

<400>2

Met?Ser?Arg?Leu?Ile?Val?Val?Cys?Ile?Val?Ile?Ser?Met?Ile?Cys?Gly

-35 -30 -25

Ala?Leu?Ser?Leu?Ser?Ser?Thr?Lys?Met?Ala?Asp?Glu?Lys?Lys?Glu?Lys

-20 -15 -10

Asp?Glu?Asp?Glu?Lys?Pro?Lys?Ile?Ser?Gly?Gly?Thr?Val?Ile?Ala?Ala

-5 -1 1 5 10

Gly?Arg?Leu?Thr?Leu?Asp?Leu?Leu?Lys?Thr?Leu?Leu?Gly?Thr?Leu?Gly

15 20 25

Ser?Ile?Ser?Arg?Lys?Ile?Ala?Ile?Gly?Val?Asp?Asn?Glu?Thr?Gly?Gly

30 35 40

Leu?Ile?Thr?Gly?Asn?Asn?Val?Tyr?Phe?Arg?Ser?Gly?Thr?Ser?Asp?Asp

45 50 55

Ile?Leu?Pro?His?Arg?Val?Glu?Thr?Gly?Glu?Ala?Leu?Leu?Tyr?Thr?Ala

60 65 70

Arg?Lys?Thr?Lys?Gly?Pro?Val?Ala?Thr?Gly?Ala?Val?Gly?Val?Phe?Thr

75 80 85 90

Tyr?Tyr?Leu?Ser?Asp?Gly?Asn?Thr?Leu?Ala?Val?Leu?Phe?Ser?Val?Pro

95 100 105

Phe?Asp?Tyr?Asn?Phe?Tyr?Ser?Asn?Trp?Trp?Asn?Val?Lys?Ile?Tyr?Ser

110 115 120

Gly?Lys?Arg?Asn?Ala?Asp?Tyr?Asp?Met?Tyr?His?Glu?Leu?Tyr?Tyr?Asp

125 130 135

Ala?Asn?Pro?Phe?Glu?Gly?Asp?Asp?Thr?Trp?Glu?Tyr?Arg?Tyr?Leu?Gly

140 145 150

Tyr?Gly?Met?Arg?Met?Glu?Gly?Tyr?Met?Asn?Ser?Pro?Gly?Glu?Ala?Ile

155 160 165 170

Leu?Lys?Ile?Thr?Val?Met?Pro?Asp

175

Claims (7)

1, a kind of Cnidarian cytotoxin gene Src I derives from rose-red green sea anemone poison gland cDNA library, and nucleotide sequence is shown in SEQ ID NO:1 in the sequence table.

2, the coded albumen of a kind of Cnidarian cytotoxin gene Src I, it is characterized in that this albumen is to have 216 amino acid whose toxin precursor proteins, comprise 19 amino acid whose signal peptides, 19 amino acid whose propartmotif and 178 amino acid whose maturation proteins, the iso-electric point of maturation protein is 4.8, molecular weight is 19,500 dalton, it is a kind of acidic protein, the N-terminal of maturation protein has the characteristic feature of sea anemone cytolysin, the α spiral that promptly has parents, aminoacid sequence is shown in SEQ ID NO:2 in the sequence table.

3, a kind of recombinant prokaryotic expression vector is characterized in that containing right and requires 1 described gene Src I, is that it is cloned into the non-fusion expression carrier pBV220-Src I that is built on the prokaryotic expression carrier pBV220.

4, a kind of recombinant eukaryon expression vector, it is characterized in that containing gene Src I as claimed in claim 1, be that it is cloned on the shuttle plasmid pshuttle, construction recombination plasmid pshuttle-Src I, and pass through to link to each other the recombinant eukaryon expression vector Adeno-Src I that is built into carrier for expression of eukaryon Adeno-X behind the PI-SceI/I-CeuI double digestion.

5, a kind of dna fragmentation as primer, it is characterized in that cutting the site by the multienzyme of described gene encoding mature albumen two terminal sequences of claim 1 and prokaryotic expression carrier pBV220 synthesizes, upstream primer contains the EcoRI enzyme and cuts sequence (GAATTC) and initiator codon (ATG), downstream primer contains the BamHI enzyme and cuts sequence (GGATCC) and terminator codon (TTA), sequence is as follows: upstream primer, 5 ' G GAATTC ATC TCG GGT GGT ACT GTT ATT 3 '

The EcoRI enzyme is cut the ATG code of sequence downstream primer, 5 ' TA GGATCC

TGG CCA GAC GAC TTC AATC 3 '

The BamHI enzyme is cut the sequence terminator codon.

6, a kind of dna fragmentation as primer, it is synthetic to it is characterized in that cutting the site by the multienzyme of maturation protein two terminal sequences of the described genes encoding of claim 1 and shuttle plasmid pShuttle, upstream primer contains the ApaI enzyme and cuts sequence (GGGCCC) and initiator codon (ATG), downstream primer contains the NotI enzyme and cuts sequence (GCGGCCGC) and terminator codon (TTA), sequence is as follows: upstream primer, 5 ' GG GGGCCC

ATCTCGGGTGGTACTGTTATTG 3 '

The ApaI enzyme is cut the ATG code of sequence downstream primer, 5 ' GTCAT GCGGCCGC TGGCCAGACGACTTCAATC 3 '

The NotI enzyme is cut the sequence terminator codon.

7, as the application of albumen as described in the claim 2 in the medicine of preparation prevention or treatment tumour.

Images