CN116200399A - MYB transcription factor gene ZmMYB76, encoding protein and application thereof - Google Patents

MYB transcription factor gene ZmMYB76, encoding protein and application thereof Download PDF

Info

Publication number
CN116200399A
CN116200399A CN202211305980.7A CN202211305980A CN116200399A CN 116200399 A CN116200399 A CN 116200399A CN 202211305980 A CN202211305980 A CN 202211305980A CN 116200399 A CN116200399 A CN 116200399A
Authority
CN
China
Prior art keywords
gene
zmmyb76
corn
transcription factor
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211305980.7A
Other languages
Chinese (zh)
Inventor
李廷春
王怡婷
樊洪泓
邹捷
武文明
张�林
孔凡娜
董庆
刘桂虎
杨华应
周应兵
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
INSTITUTE OF TOBACCO ANHUI ACADEMY OF AGRICULTURAL SCIENCES
Anhui Agricultural University AHAU
Original Assignee
INSTITUTE OF TOBACCO ANHUI ACADEMY OF AGRICULTURAL SCIENCES
Anhui Agricultural University AHAU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INSTITUTE OF TOBACCO ANHUI ACADEMY OF AGRICULTURAL SCIENCES, Anhui Agricultural University AHAU filed Critical INSTITUTE OF TOBACCO ANHUI ACADEMY OF AGRICULTURAL SCIENCES
Priority to CN202211305980.7A priority Critical patent/CN116200399A/en
Publication of CN116200399A publication Critical patent/CN116200399A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Abstract

The invention discloses a MYB transcription factor gene ZmMYB76, a coding protein and application thereof, wherein the full-length nucleotide sequence of the gene ZmMYB76 is shown as SEQ ID NO.1, and the amino acid sequence of the coding protein is shown as SEQ ID NO. 3. The gene ZmMYB76 can be applied to corn pest resistance regulation and control, and the resistance of corn plants to corn borers is improved through over-expression of the gene ZmMYB76. The gene ZmMYB76 provided by the invention is a novel MYB transcription factor gene with a resistance effect on corn borers, the expression of the gene in corn leaves is up-regulated after the corn borers bite, the insect resistance function is not reported, and the gene can provide technical support for green and durable control of the corn borers and creation of new corn insect-resistant germplasm.

Description

MYB transcription factor gene ZmMYB76, encoding protein and application thereof
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a MYB transcription factor gene ZmMYB76, and a coding protein and application thereof.
Background
Corn borer is a main pest of corn, and can harm all parts of corn plant leaves, filaments, stems, seeds and the like, and the corn borer directly bites to cause the plant to lose functions, seriously influence the development of the plant and the later-stage seeds, and lead to the yield reduction of corn and the invasion of germs. At present, the control means of corn borers mainly adopt chemical control and are easy to pollute the ecological environment.
Terpenes are the most abundant compounds in secondary metabolites of plants, and many components have important physiological functions, play an important role in the interaction of plants and plant diseases and insect pests, and participate in direct and indirect defense reactions to the plant diseases and insect pests. The transcription factor has regulation and control effect on terpene synthase gene, and through combining with the specific DNA element upstream of target gene, the expression of target gene is strengthened or inhibited, so that the transcription factor plays an important role in plant pest resistance reaction.
The corn genetic foundation is relatively narrow and the gene resources are limited, the functional genes for regulating and controlling the corn insect resistance are required to be further explored, the application of the functional genes in the aspect of improving the corn borer resistance is expanded by adopting effective means, and a new technical idea is provided for enriching the corn insect resistance gene resources and molecular auxiliary breeding and creating the corn borer resistance material.
Disclosure of Invention
The invention mainly aims at providing a MYB transcription factor ZmMYB76 gene with a good insect resistance function, and a coding protein and application thereof.
In order to achieve the aim, the invention provides a MYB transcription factor gene ZmMYB76, and the full-length nucleotide sequence of the gene is shown as SEQ ID NO. 1.
Further, the nucleotide sequence of the coding region is shown as SEQ ID NO. 2.
The invention also provides a coding protein of the gene ZmMYB76, and the amino acid sequence of the coding protein is shown as SEQ ID NO. 3.
The invention also provides an expression vector containing the gene ZmMYB76.
The invention also provides a host bacterium containing the expression vector.
The invention also provides application of the gene ZmMYB76 in corn pest resistance regulation.
Further, the application improves the resistance of corn plants to corn borers by over-expressing the gene ZmMYB76.
Furthermore, in the application, the gene ZmMYB76 promotes the synthesis of terpenoids to realize the insect-resistant regulation of corn by up-regulating the expression of the ZmDLS gene, and the nucleotide sequence of the ZmDLS gene is shown as SEQ ID NO. 4.
The invention develops a corn insect-resistant related key MYB transcription factor gene ZmMYB76, not only enriches corn insect-resistant gene resources, but also lays a foundation for breeding and creating corn insect-resistant germplasm materials, and the gene ZmMYB76 provided for the first time is a novel MYB transcription factor gene with a resistance effect on corn borers, the gene is up-regulated in the expression of corn leaves after the corn borers bite, the insect-resistant function is not reported, and the invention provides technical support for green and durable control of corn borers and creation of new corn insect-resistant germplasm. The transient over-expression test shows that the gene ZmMYB76 has a good insect resistance function and can be developed as a potential molecular marker.
Based on the function of the gene ZmMYB76, the person skilled in the art can obtain insect-resistant corn plants or germplasm materials on the basis of combining the prior art. Therefore, the invention claims the application of the gene ZmMYB76 in breeding and creating insect-resistant corn germplasm resource materials. The gene ZmMYB76 can be used for molecular assisted breeding to select and breed insect-resistant materials and create new insect-resistant germplasm, thereby achieving the purpose of green ecological lasting prevention and control of corn borers. In addition, the invention also claims a breeding and creating method of corn borer resistant germplasm materials, and the gene ZmMYB76 is overexpressed to realize the genetic improvement of corn varieties.
The beneficial effects of the invention are as follows:
(1) The invention discloses a novel MYB transcription factor gene ZmMYB76 with a resistance effect on corn borers for the first time, and the resistance of corn plants to corn borers is improved by regulating the overexpression of the gene ZmMYB76. The invention provides a new solution for preventing corn borers from molecular level and provides technical support for the creation of new corn insect-resistant germplasm.
(2) According to the invention, the big data analysis and RT-qPCR technology are utilized to find that the gene ZmMYB76 is obviously up-regulated to express after corn borers bite, and the gene ZmDLS is combined with a promoter region of the ZmDLS gene to regulate and control the expression of the ZmDLS gene, so that the synthesis of terpenoid substances is promoted, and the invasion of corn borers is avoided. The invention confirms the function of ZmMYB76 gene in the process of corn borer resistance through transient expression technology, heterologous over-expression technology and the like.
(3) The invention provides a breeding and creating method for corn borer resistant corn germplasm. The core of the method is to over-express the gene ZmMYB76, thereby providing technical support for insect-resistant breeding and molecular marker development of corn.
Drawings
FIG. 1 is a graph of cis-acting element analysis of the ZmDLS gene promoter.
FIG. 2 is a graph showing the gene expression levels of ZmDLS gene and ZmMYBs gene selected after corn borer feeding.
FIG. 3 is a diagram of a single hybridization test of ZmDLS gene and ZmMYB76 gene in yeast.
FIG. 4 is a diagram of a double luciferase assay of ZmDLS gene and ZmMYB76 gene.
Detailed Description
The invention is further described below with reference to examples:
the various materials and equipment used in the examples below, unless otherwise specified, are commercially available products well known in the art.
Example 1: MYB transcription factor screening
Maize B73 inbred transcriptome data was downloaded according to the maize genetics and genomics database (https:// maizegdb. Org /). The candidate ZmMYB genes 157 were identified for CDS (coding region) sequences of Arabidopsis MYB by local library construction using BLAST software. And carrying out correlation analysis on 157 ZmMYBs and ZmDLS genes, and screening out 6 ZmMYBs with higher correlation with the ZmDLS genes. Because the gene expression quantity of ZmDLS gene is obviously increased after corn borer is eaten, the gene expression quantity of 6 ZmMYBs after corn borer is eaten is analyzed and screened, and finally the transcription factor gene ZmMYB76 is screened out according to correlation network analysis and gene coexpression analysis.
ZmDLS gene: the gene is a gene for encoding D-limonene synthase, the D-limonene synthase is a key enzyme formed by terpene compounds D-limonene, the nucleotide sequence of the ZmDLS gene is shown as SEQ ID NO.4, the amino acid sequence of the encoded protein of the ZmDLS gene is shown as SEQ ID NO.5, and an analysis chart of cis-acting elements of a ZmDLS gene promoter is shown as figure 1.
Example 2: zmMYBs gene expression analysis after corn borer bites on corn leaves
Determining the expression level of genes in plants under specific conditions by fluorescent quantitative PCR; primers were designed using Primer 5.0 software and synthesized by Shanghai chemical company; plant RNA extraction kit (chengdou befeit technology limited,cargo number RN 33050) RNA extraction from maize B73 leaves using whole gold
Figure BDA0003906028700000041
cDNA is synthesized by reverse transcription of One-Step gDNA Removal and cDNA Synthesis SuperMix kit. Reagents were added according to the system of Table 1, three biological replicates were set, and reactions were performed according to the reaction conditions of Table 1, and the relative expression levels were calculated using the 2- ΔΔCt method. The results of the expression level measurement are shown in FIG. 2, and it can be seen that the expression level of the transcription factor gene ZmMYB76 is significantly increased.
TABLE 1 fluorescent quantitative PCR reaction System and reaction conditions
Figure BDA0003906028700000042
Example 3: nucleotide sequence of ZmMYB76 gene
Extracting RNA of corn B73 leaves by using a plant RNA extraction kit; using reverse transcription kit (Whole gold
Figure BDA0003906028700000043
One-Step gDNA Removal and cDNA Synthesis SuperMix) was reverse transcribed into cDNA according to the instructions, the complete sequence of the CDS (coding region) of the ZmMYB76 gene of maize was obtained from the maize genome (V4.0), and the full-length Primer was designed using Primer Premier 5.0 software:
ZmMYB76-F1:ATGGTGACTGTGAGAGAGGAGATGC
ZmMYB76-R2:TCACATCATGATTTCTTGATCTCCC
PCR amplification is carried out by taking cDNA as a template, and the reaction system is as follows:
TABLE 2 PCR amplification reaction System and reaction conditions
Figure BDA0003906028700000051
The nucleotide of the ZmMYB76 gene is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the ZmMYB76 gene is shown as SEQ ID NO. 3.
Example 4: gene ZmMYB76 and ZmDLS gene interaction yeast single hybridization test
Firstly, preparing yeast competence (used at present and can not be used after freezing preservation): taking out yeast strain Y1HGold from refrigerator at-80deg.C, sucking 10-20 μl of coated YPDA solid culture medium, wherein the formula of YPDA solid culture medium is shown in Table 3, and culturing in incubator at 28deg.C for 2d-4d until the diameter of bacterial plaque is about 2 mm; 2-3 clones were individually selected from YPDA solid culture plates and cultured overnight at 180rpm at a constant temperature of 28℃to OD with the formulation of YPDA liquid medium shown in Table 4 in 20mL of YPDA liquid medium 600 Greater than 1.5; about 10mL of the bacterial liquid is inoculated in 100mL of fresh YPDA liquid culture medium, the temperature is kept constant at 28 ℃, and the bacterial liquid is cultured at 180rpm until the bacterial liquid reaches OD 600 Centrifugation at 1,000Xg for 5min at room temperature for bacterial recovery = 0.4-0.6; removing the supernatant, re-suspending cells with 10mL of sterile water, centrifuging at 6,000rpm for 5min, and removing the supernatant; the pellet was resuspended in 1.5mL 1 XLiAc to give competent cells. The pAbAi empty vector and recombinant vector to be transformed are transformed into yeast competent cells according to the table, the yeast competent cells are coated on SD/-Ura solid medium for culture after transformation, the formula of the SD/-Ura solid medium is shown in the table 5, positive clones are screened for subsequent experiments, and the restriction endonuclease BstB I is needed to be used for linearization before transformation. Y1H [ pBait-Abai ]]Strain background level expression: Y1H [ pBait-Abai ]]The strain was resuspended with 0.9% NaCl to OD 600 =0.002, 100 μl was plated on SD/-Ura deficient medium containing different concentrations (0 ng/mL,100ng/mL,200ng/mL,400ng/mL,600ng/mL,800 ng/mL) of Aureobasidin (Aureobasidin a, abA) of the formulation shown in table 6 and incubated upside down at 28 ℃ for 2-3d in the dark. If there is a white single colony on the plate, the pBait-Abai strain has self-activation, otherwise, the AbA concentration can be proved to inhibit the self-activation, and the lowest AbA concentration for inhibiting the growth of the pBait-Abai strain is determined. Preparation of competent pBait-Abai yeast was carried out as above, and the transformation product was spread on SD/-Leu solid medium and cultured upside down at 28℃for 3-5d. Positive clones were screened, diluted in gradient, and plated on SD/-Leu solid medium containing 100ng/mLAbA, and yeast transformation system is shown in Table 7.
TABLE 3 YPDA solid Medium formulation
Figure BDA0003906028700000061
TABLE 4 YPDA liquid Medium formulation
Figure BDA0003906028700000062
Table 5 SD/-Ura solid Medium formulation
Figure BDA0003906028700000071
Table 6 SD/-Ura defective media formulations
Figure BDA0003906028700000072
TABLE 7 Yeast competent transformation systems
Figure BDA0003906028700000073
/>
Figure BDA0003906028700000081
As shown in FIG. 3, zmMYB76 can effectively bind to the promoter region of ZmDLS to regulate the expression of ZmDLS.
Example 5: transient transformation gene ZmMYB76
pGreenII 62-SK and pGreenII 0800-LUC vectors are analyzed by Snap Gene software, proper enzyme digestion sites are selected, enzyme digestion systems are shown in tables 8 and 9, and homologous recombinases are utilized to construct recombinant plasmids according to the system of table 10. The promoter ZmDLSpro and the transcription factor gene ZmMYB76 are respectively connected into pGreenII 0800-LUC vector and pGreenII 62-SK vector, and then the two recombinant plasmids are respectively transformed into agrobacterium tumefaciens GV 3101. The recombinant plasmid pGreenII 0800-LUC and the empty pGreenII 62-SK were co-transferred as controls, the recombinant plasmid pGreenII 0800-LUC and the recombinant plasmid pGreenII 62-SK were co-transferred into the leaf of Benshi tobacco, and the firefly luciferase and Renilla luciferase activities after infiltration for 72 hours were analyzed by means of a dual luciferase report analysis system (E710, promega) and a Modulus luminometer (GloMax 96, promega). The experimental results are shown in FIG. 4, where ZmMYB76 and LUC driven by ZmDLS promoter are co-expressed in N.tabacum leaves, zmMYB76 significantly up-regulates expression of ZmDLS.
TABLE 8 pGreenII 0800-LUC vector cleavage reaction System and reaction conditions
Figure BDA0003906028700000091
TABLE 9 pGreenII 62-SK vector cleavage reaction system and reaction conditions
Figure BDA0003906028700000092
TABLE 10 connection of reaction systems and reaction conditions
Figure BDA0003906028700000093
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, alternatives, and improvements that fall within the spirit and scope of the invention.

Claims (8)

1. The MYB transcription factor gene ZmMYB76 is characterized in that the full-length nucleotide sequence is shown in SEQ ID NO. 1.
2. The gene ZmMYB76 of claim 1, wherein: the nucleotide sequence of the coding region is shown as SEQ ID NO. 2.
3. The protein encoded by the gene ZmMYB76 as claimed in claim 1 or 2, wherein the amino acid sequence is shown in SEQ ID NO. 3.
4. An expression vector comprising the gene ZmMYB76 of claim 1 or 2.
5. A host bacterium comprising the expression vector according to claim 4.
6. Use of the gene ZmMYB76 according to claim 1 or 2 in corn pest control.
7. The use of claim 6, wherein the resistance of corn plants to corn borers is increased by overexpressing the gene ZmMYB76.
8. The use according to claim 6, wherein the gene zmdlb 76 promotes the synthesis of terpenoids by up-regulating the expression of ZmDLS gene with nucleotide sequence shown in SEQ ID No.4 to achieve insect-resistant regulation of corn.
CN202211305980.7A 2022-10-24 2022-10-24 MYB transcription factor gene ZmMYB76, encoding protein and application thereof Pending CN116200399A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211305980.7A CN116200399A (en) 2022-10-24 2022-10-24 MYB transcription factor gene ZmMYB76, encoding protein and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211305980.7A CN116200399A (en) 2022-10-24 2022-10-24 MYB transcription factor gene ZmMYB76, encoding protein and application thereof

Publications (1)

Publication Number Publication Date
CN116200399A true CN116200399A (en) 2023-06-02

Family

ID=86511901

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211305980.7A Pending CN116200399A (en) 2022-10-24 2022-10-24 MYB transcription factor gene ZmMYB76, encoding protein and application thereof

Country Status (1)

Country Link
CN (1) CN116200399A (en)

Similar Documents

Publication Publication Date Title
CN111778265A (en) Mutant gene, mutant, expression vector and application of zearalenone oxidase
CN107012147B (en) Drought and/or high-salt induction promoter SlWRKY8P from tomato and application thereof
CN114672511B (en) Application of corn ZmBES1/BZR1-3 gene in increasing plant seed yield
CN113913457B (en) Method for inhibiting or killing carpopodium borer and application thereof
CN113248586B (en) Application of brown planthopper PIB14 protein and coding gene thereof in regulation and control of plant brown planthopper resistance
CN108795943A (en) A kind of plant specific expression promoter POssalt2 and its application
US11905316B2 (en) Applications of ZmROA1 protein in regulating plant density tolerance
CN110564740B (en) A gene AtPIP2 for improving disease resistance of plants; 7 and uses thereof
CN102851297B (en) Myzuspersicae hunchback gene cDNA and application thereof
CN108707614B (en) Peanut stress resistance gene and application thereof
CN114574518B (en) Method for promoting nodulation, especially salt-tolerant nodulation, of leguminous crops
CN107177596B (en) Rice flooding inducible tissue specific expression promoter Possub5 and application thereof
CN116200399A (en) MYB transcription factor gene ZmMYB76, encoding protein and application thereof
CN112852862B (en) Application of arabidopsis small peptide signal molecule RGF7 gene
CN110438151B (en) RNAi vector for plant-mediated silencing of plutella xylostella arginine kinase gene PxAK and application thereof
CN109112117B (en) Separated chilo suppressalis CYP15C1 gene and encoded protein thereof
CN109706170A (en) The expression vector establishment method of arabidopsis FIPV promoter fusion gus gene
CN116063431B (en) Plant insect-resistant protein and application thereof
CN116240209B (en) Enhancer strongly induced by powdery mildew in Chinese spring wheat and application thereof
CN117210490B (en) PCHR gene for regulating and controlling malus plant self-flower fructification and application thereof
CN115927309B (en) China rose root specific expression promoter proRcPRX10 and application thereof
CN116731143B (en) Application of tomato ERF17 gene in regulation and control of plant insect resistance
CN112195178B (en) Tomato late blight-resistant long-chain non-coding RNA-lncRNA40787, cloning method and application method thereof
CN114702563B (en) Application of protein GRMZM2G088112 in regulation and control of plant drought resistance
CN115109783B (en) Peanut NBS-LRR coding gene AhRRS2 and application thereof in plant bacterial wilt resistance

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination