CN116200350A

CN116200350A - Alcohol dehydrogenase mutant and application thereof in biological inorganic amination

Info

Publication number: CN116200350A
Application number: CN202211109656.8A
Authority: CN
Inventors: 薛亚平; 程峰; 王成娇; 邹树平; 徐建妙; 郑裕国
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2022-09-13
Filing date: 2022-09-13
Publication date: 2023-06-02

Abstract

The invention discloses an alcohol dehydrogenase mutant and application thereof in biological inorganic amination, wherein the alcohol dehydrogenase mutant is obtained by carrying out single mutation or multiple mutation on the 73 rd, 107 th, 175 th, 96 th or 286 th position in an alcohol dehydrogenase amino acid sequence shown in SEQ ID No. 2. The alcohol dehydrogenase mutant provided by the invention can be efficiently subjected to oxidation reductionNADH is continuously provided by the system, so that high-efficiency coenzyme supply in the biological inorganic amination process is ensured, and the inorganic amination synthesis cost is reduced; the alcohol dehydrogenase mutant pair NAD of the invention ⁺ The catalytic efficiency of the catalyst is obviously higher than that of a wild type, the enzyme activity is improved by 2 times, the time for coupling the coenzyme regeneration system and the glufosinate dehydrogenase to be applied to the glufosinate production is effectively shortened, and the catalyst has good application prospect.

Description

Alcohol dehydrogenase mutant and application thereof in biological inorganic amination

Field of the art

The invention relates to a biological inorganic amination technology, in particular to an alcohol dehydrogenase mutant and application thereof in biological inorganic amination.

(II) background art

Glufosinate, namely 4- [ hydroxy (methyl) phosphono ] -D, L-homoalanine (4- [ Hydroxy (methyl) phospho ] -D, L-homoalanine, PPT) is a kind of phosphorus-containing amino acid herbicide, and the target of action is glutamine synthetase, and has the characteristics of high activity, good absorption, broad herbicide spectrum, low toxicity, good environmental compatibility and the like. In recent years, as the third most non-biocidal herbicide in the world and the herbicide tolerance of the second most transgenic crop in the world, glufosinate has shown great market potential, and the main promotion is the large-scale popularization of the glufosinate transgenic crop and the atrophy of the main competitive (glyphosate and paraquat) markets.

Of the two configurations of glufosinate, only the L-form has herbicidal activity, whereas the commercial glufosinate is in its racemate (Herbicidal compositions [ P ]. Patent application US4265654A, 1981). The use of the L-type glufosinate-ammonium monomer can obviously reduce the application amount of glufosinate-ammonium, lighten the pressure of the environment, simultaneously slow down the generation of weed resistance and show very obvious environmental protection advantages.

Therefore, the development of the preparation process of the L-glufosinate has very important significance. The preparation method of chiral pure L-glufosinate (L-PPT) mainly comprises three steps: chiral resolution, chemical synthesis and biocatalysis. The biocatalytic method for producing glufosinate has the advantages of strict stereoselectivity, mild reaction condition, high yield and the like, and is an advantageous method for producing L-glufosinate. Mainly comprises the following three types:

1) The L-glufosinate derivative is used as a substrate and is obtained by direct hydrolysis through an enzymatic method, and the method has the main advantages of high conversion rate and higher e.e. value of a product, but expensive and difficult-to-obtain chiral raw materials are needed as precursors, so that the cost is higher, and the method is not beneficial to industrial production. For example, the simplest method for preparing L-glufosinate by biological methods is to hydrolyze bialaphos directly using proteases. Bialaphos is a natural tripeptide compound, and under the catalysis of protease, 2 molecules of L-alanine are removed from the bialaphos to generate L-glufosinate.

2) The method takes a precursor of racemic glufosinate-ammonium as a substrate and is obtained through selective resolution of enzyme. The main advantages are relatively easy obtaining of raw materials and high activity of catalyst, but its theoretical yield can only reach 50%, which can result in waste of raw materials.

3) The Alpha-keto acid-2-carbonyl-4- (hydroxy methyl phosphono) butyric acid (Alpha-ketoacid-2-carboyl-4- (hydroxy phosphino) PPO) is used as a substrate and is obtained through asymmetric synthesis of enzymes, and the enzymes mainly involved include transaminase and glufosinate dehydrogenase. Bartsch (Bartsch K (2005) Process for the preparation of-phosphinothrcine by enzymatic tr ansamination with aspartate. US Patent No. US6936444B 1) and the like use PPO as a substrate, L-aspartic acid as an amino donor, and transaminases which are screened and separated from soil microorganisms and have specific enzyme activities on PPO and L-aspartic acid are used for catalysis, when the substrate concentration is 552mM, the reaction is carried out for 4 hours at a very high temperature (80 ℃), the conversion rate still reaches 52%, and the space-time yield is only 4.5g L-PPT/g (catalyst)/h. Furthermore, the preparation of L-glufosinate-ammonium by using aminotransferase has two defects, namely that the reaction is a reversible reaction, the raw material PPO cannot be completely converted into L-PPT, and the conversion rate cannot reach 100%; secondly, in order to carry out the reversible reaction in the direction of L-PPT production, at least 2 times of L-aspartic acid needs to be added as an amino donor, and the excess aspartic acid brings great trouble to the separation of L-PPT.

In the enzymatic synthesis routes of various glufosinate-ammonium, the ketocarbonyl of the keto acid intermediate is a latent chiral functional group, a chiral center can be constructed through an enzymatic synthesis route, and the keto acid route is suitable for industrial development and production of L-glufosinate-ammonium because raw materials are low in cost and easy to obtain and toxic cyanide can be avoided.

The amino acid dehydrogenase (EC 1.4.1.X, AADH) is an amino acid dehydrogenase capable of reversibly deaminating an amino acid to form a corresponding keto acid, and the reaction requires the participation of nucleoside coenzyme (NAD (P) +), and uses ammonium ions in a solution to deoxidize and reductive aminate a carbonyl group in a keto acid to form a corresponding amino acid, so that the amino acid dehydrogenase is widely applied to the synthesis of natural and unnatural alpha-amino acids. Substrate specificity is classified into glutamate dehydrogenase, leucine dehydrogenase, alanine dehydrogenase, valine dehydrogenase, and the like. If it exhibits a higher activity on a glufosinate precursor, it may be referred to as "glufosinate dehydrogenase (PPTDH)".

Alcohol dehydrogenase (EC 1.1.1.1, ADH) is an important auxiliary enzyme for biocatalytic oxidation-reduction reaction, is used for regeneration cycle of coenzyme NAD (P) H in oxidation-reduction catalytic reaction, isopropanol can be used as a substrate for coenzyme regeneration, and acetone product has low boiling point, is easy to remove, and is suitable for industrial production. However, the auxiliary enzyme, glucose dehydrogenase, commonly used at present, produces byproducts such as gluconic acid, and when the main product is acid, the byproducts are often difficult to remove.

Although alcohol dehydrogenases show great potential in the coenzyme regeneration circulatory system, wild-type alcohol dehydrogenases have poor cofactor affinity and still lower enzyme activity, and have limitations in application and are insufficient for universal tool enzymes for cofactor regeneration, so that molecular modification is required to improve substrate affinity and enzyme activity.

(III) summary of the invention

The invention aims to provide an alcohol dehydrogenase mutant and application thereof in biological inorganic amination, wherein the biological inorganic amination method utilizes the alcohol dehydrogenase mutant to improve the efficiency of producing NADH, optimizes a coenzyme regeneration system and provides more energy for biological inorganic amination. The invention provides a plurality of alcohol dehydrogenase mutants with obviously improved enzyme activity through site-directed mutagenesis on the alcohol dehydrogenase, thereby not only realizing the heterologous expression of the alcohol dehydrogenase in escherichia coli, but also improving the efficiency of producing NADH by the alcohol dehydrogenase and optimizing a coenzyme regeneration system, and the mutants can ensure higher coenzyme supply in the biological inorganic amination reaction, such as improving the yield of L-glufosinate, L-glutamic acid and L-aspartic acid, and have stronger industrial application value.

The technical scheme adopted by the invention is as follows:

the invention provides an alcohol dehydrogenase mutant, which is obtained by single mutation or multiple mutation of 73 rd, 107 th, 175 th, 96 th or 286 th in an alcohol dehydrogenase amino acid sequence shown in SEQ ID No. 2.

Preferably, the alcohol dehydrogenase mutant is one in which the amino acid sequence shown in SEQ ID No.2 is mutated to one of the following: (1) glycine 73 to alanine (G73A); (2) Glycine 73 to alanine and glutamic acid 107 to serine (G73A-E107S); (3) Glycine 73 to alanine, glutamic acid 107 to serine, glycine 175 to aspartic acid (G73A-E107S-G175D); (4) Mutation of glycine 73 to alanine, mutation of glutamic acid 107 to serine, mutation of glycine 175 to aspartic acid, mutation of aspartic acid 96 to glycine (G73A-E107S-G175D-D96G); (5) Glycine 73 to alanine, glutamic acid 107 to serine, glycine 175 to aspartic acid, aspartic acid 96 to glycine, valine 286 to alanine (G73A-E107S-G175D-D96G-V286A).

The invention also relates to a coding gene of the alcohol dehydrogenase mutant, a recombinant vector and engineering bacteria. Preferably, the recombinant expression vector uses a plasmid pET Duet as a vector; the host cell is preferably E.coli BL21 (DE 3), crude enzyme liquid is obtained through protein induced expression and cell disruption, and the catalytic property is superior to that of maternal alcohol dehydrogenase.

The invention provides an application of the alcohol dehydrogenase mutant in biological inorganic amination reaction, which comprises the following steps: wet thalli obtained by fermenting and culturing co-expression recombinant bacteria containing alcohol dehydrogenase mutant genes and glufosinate dehydrogenase genes are used as catalysts, keto acid compounds are used as substrates, and isopropanol and/or NAD are added ⁺ The buffer solution with pH value of 7-8 is used as reaction medium to form reaction system, and the reaction is completed under the conditions of 35-60 deg.C and 500-600rpm, and the reaction solution is separated and purified to obtain correspondent chiral compound. In the reaction system, the catalyst is used in an amount of 5-30g/L (preferably 10 g/L) based on the total weight of wet bacteria, the initial concentration of the substrate is 10-500 mM (preferably 200 mM), and NAD is addedThe amount is 0-5mM (preferably 0.1 mM), and the isopropanol addition amount is 10-500 mM (preferably 300 mM).

Preferably, the substrate is 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid, alpha-ketoglutarate, oxaloacetic acid, and the corresponding products are L-glufosinate, L-glutamic acid, and L-aspartic acid, respectively.

The invention also provides an application of the alcohol dehydrogenase mutant in catalyzing 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid to prepare L-glufosinate (L-PPT), wherein 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid is taken as a reaction substrate, isopropanol is taken as a substrate of a coenzyme regeneration system, and the alcohol dehydrogenase mutant catalyzes the regeneration of coenzyme NAD (P) H and simultaneously, the glufosinate dehydrogenase catalyzes the 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid to L-PPT.

Preferably, the application is: wet thalli obtained by fermenting and culturing co-expression recombinant bacteria containing alcohol dehydrogenase mutant genes and glufosinate dehydrogenase genes are used as catalysts, and 2-carbonyl-4- [ hydroxy (methyl) phosphono group is used]Butyric acid (PPO) as substrate, isopropanol and NAD are added ⁺ Forming a reaction system by taking buffer solution with the pH value of 7-8 as a reaction medium, reacting at the temperature of 35-60 ℃ and the rpm of 500-600rpm, completely reacting, separating and purifying the reaction solution to obtain L-glufosinate; in the reaction system, the catalyst is used in an amount of 5-30g/L (preferably 10 g/L) based on the total weight of the wet cell, the initial concentration of the substrate is 10-500 mM (preferably 200 mM), the NAD addition amount is 0-5mM (preferably 0.1 mM), and the isopropanol addition amount is 10-500 mM (preferably 300 mM).

Preferably, the co-expression recombinant strain containing the alcohol dehydrogenase mutant gene and the glufosinate dehydrogenase gene is prepared by cloning the alcohol dehydrogenase mutant coding gene to a second multiple cloning site (between NdeI and Avr II cleavage sites) of a pETDuet-PPTDH vector containing the glufosinate dehydrogenase gene by adopting a one-step cloning method, transferring the gene into a host E.coli BL21 (DE 3), and constructing the co-expression recombinant strain, wherein the nucleotide sequence of the glufosinate dehydrogenase gene is shown as SEQ ID No.3, and the amino acid sequence of the coding protein is shown as SEQ ID No. 1.

Preferably, the catalyst is prepared as follows: co-expression recombinant bacteria containing glufosinate dehydrogenase and alcohol dehydrogenase mutant genes are inoculated into LB liquid medium containing 50 mug/mL of ampicillin resistance, cultured for 12 hours at 37 ℃ and 180rpm, inoculated into fresh LB liquid medium containing 50 mug/mL of ampicillin resistance at an inoculum size of 2% of volume concentration, cultured at 37 ℃ and 180rpm until the OD600 of the bacteria reaches 0.6-0.8, IPTG with a final concentration of 12 mug/mL is added, induced and cultured for 12 hours at 28 ℃, the temperature is 4 ℃ and 8000rpm, the supernatant is removed, the precipitate is collected, and washed twice with pH7.5 and 20mM sodium phosphate buffer solution, thus obtaining wet bacteria.

When the substrate is 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid, the method for separating and purifying the reaction liquid comprises the following steps: (1) Adding calcium carbonate into the reaction solution, removing sulfate radical in the reaction solution by a precipitation method, magnetically stirring at 600rpm for 2 hours, centrifuging at 8000rpm for 10 minutes, and collecting supernatant; the addition amount of the calcium carbonate is 0.1g/mL based on the volume of the reaction solution; (2) Concentrating the supernatant in the step (1) by rotary evaporation at 80rpm and 60 ℃ for 6 hours to dryness to obtain a concentrate; (3) Adding methanol into the concentrate in the step (2), and dissolving overnight; regulating pH to 2-5, stirring at 600rpm for 4h, filtering, and drying filter cake to obtain L-glufosinate ammonium powder; the volume ratio of the methanol consumption to the reaction liquid is 2:1.

compared with the prior art, the invention has the beneficial effects that:

the alcohol dehydrogenase mutant body provided by the invention can efficiently and continuously provide NADH for a redox system, so that the high-efficiency coenzyme supply in the biological inorganic amination process is ensured, and the inorganic amination synthesis cost is reduced; in the method for preparing the L-glufosinate-ammonium by constructing the coenzyme circulation system by utilizing the alcohol dehydrogenase mutant, the conversion rate of 200mM substrate is up to 100%, the boiling point of byproduct acetone is low, the byproduct acetone is easy to discharge out of the reaction system, and the product is more convenient to separate and purify; the alcohol dehydrogenase mutant pair NAD of the invention ⁺ The catalytic efficiency of the catalyst is obviously higher than that of a wild type, the enzyme activity is improved by 2 times, the time for coupling the coenzyme regeneration system and the glufosinate dehydrogenase to be applied to the glufosinate production is effectively shortened, and the catalyst has good application prospect.

(IV) description of the drawings

FIG. 1 is an SDS-PAGE electrophoresis of a glufosinate dehydrogenase and alcohol dehydrogenase coupled co-expression strain wherein lane 1: standard protein molecular weight; lanes 2-8: pETDuet-PPTDH-GstADH crude enzyme solution.

FIG. 2 is a diagram showing the reaction progress of a recombinant genetically engineered bacterium of glufosinate-ammonium dehydrogenase and alcohol dehydrogenase to prepare L-glufosinate.

FIG. 3 shows NADH standard curves.

FIG. 4 is a photograph of a finished L-glufosinate powder.

FIG. 5 is a HPLC chart of D, L-glufosinate standard (upper) and L-glufosinate ammonium powder (lower), wherein the peak time of D-glufosinate is about 12.5 minutes and the peak time of L-glufosinate is about 10 minutes.

FIG. 6 is an X-ray diffraction pattern of L-glufosinate ammonium powder.

(fifth) detailed description of the invention

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:

the experimental methods in the invention are all conventional methods unless otherwise specified, and the gene cloning operation can be specifically found in the "molecular cloning Experimental guidelines" by J.Sam Broker et al.

Reagents for upstream genetic engineering operations: the one-step cloning kits used in the examples of the present invention were all purchased from Vazyme, nanjinouzan biotechnology Co., ltd; plasmid extraction kits and DNA recovery purification kits were purchased from Axygen hangzhou limited; e.coli BL21 (DE 3), plasmids, etc. were purchased from Shanghai grower; DNA marker, fastpfu DNA polymerase, low molecular weight standard protein, agarose electrophoresis reagent, primer synthesis and gene sequencing work were performed by catalpa ovata Biotechnology, inc. of Qingzhou family. The above methods of reagent use are referred to in the commercial specifications.

Reagents for downstream catalytic processes: 2-carbonyl-4- (hydroxy methyl phosphono) butyric acid (abbreviated as PPO), D, L-glufosinate (L-PPT) standard commercially available from Sigma-Aldrich; NADH is purchased from Bangtai bioengineering (Shenzhen Co., ltd.; other commonly used reagents are purchased from national pharmaceutical group chemical reagent limited.

Preparation of competent cells: e.coli BL21 (DE 3) strain deposited with glycerol tubes obtained from-80deg.C refrigerator, streaked on antibiotic-free LB plates, and cultivated at 37deg.CCulturing for 10h, and obtaining single bacterial colony; picking single colony of LB plate, inoculating into test tube containing 10mL LB culture medium, culturing at 37deg.C and 180rpm for 9h; taking 2mL of bacterial liquid from a test tube, inoculating the bacterial liquid into 100mL of LB culture medium, and culturing the bacterial liquid at 37 ℃ and 180rpm to OD600 to 0.4-0.6; precooling the bacterial liquid on ice, taking the bacterial liquid into a sterilized centrifuge tube, placing the bacterial liquid on the ice for 10min, and centrifuging the bacterial liquid at 4 ℃ for 10min at 5000 rpm; pouring out the supernatant, and pre-cooling with 0.1mol/L CaCl at 4deg.C ₂ The precipitated cells were resuspended in aqueous solution and placed on ice for 30min; centrifuging at 4deg.C and 5000rpm for 10min, discarding supernatant, and pre-cooling with CaCl 0.1mol/L containing 15% glycerol at 4deg.C ₂ The precipitated cells were resuspended in aqueous solution, 100. Mu.L of the resuspended cells were dispensed into sterilized 1.5mL centrifuge tubes and stored in a-80℃freezer and removed as needed.

The structural formula of the D-glufosinate (D-PPT for short) is shown in the formula (1); the structural formula of the L-glufosinate (L-PPT for short) is shown as a formula (2); the structural formula of the 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid (PPO for short) is shown in a formula (3).

(3) 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid

The High Performance Liquid Chromatography (HPLC) detects the concentration of the product, and the analysis method comprises the following steps:

(1) Chromatographic conditions: chromatographic column model: QS-C18,5 μm, 4.6X1250 mm. Mobile phase: 50mM ammonium acetate solution: methanol=10:1. Fluorescence detection wavelength: λex=340 nm, λem=455 nm. Flow rate: 1mL/min. Column temperature: the peak time of L-PPT is 10min and the peak time of D-PPT is 12.5min at 30 ℃.

(2) Derivatizing agent: 0.1g of phthalic dicarboxaldehyde and 0.12g of N-acetyl-L-cysteine are weighed respectively, dissolved in 10mL of ethanol, 40mL of 0.1 mL/L boric acid buffer solution (pH 9.8) is added, and the mixture is fully dissolved by shaking and stored in a refrigerator at 4 ℃ for standby (not more than 4 days).

(3) Derivatization reactions and HPLC determination: the reaction solution is complemented to 1mL by ultrapure water, namely, the reaction solution is diluted by 10 times, and the diluted sample is subjected to derivatization treatment, specifically: 200 mu L of diluted reaction solution is added with 400 mu L of derivatization reagent for derivatization for 5min at 30 ℃, then added with 400 mu L of ultrapure water to complement 1mL, centrifuged for 1 min at 12000 r/min, the supernatant is taken and subjected to microfiltration membrane of 0.22 mu m to be used as a liquid phase sample, and PPO, L-PPT, D-PPT and e.e. values are detected by HPLC.

The High Performance Liquid Chromatography (HPLC) detects the concentration of the substrate, and the analysis method comprises the following steps:

chromatographic column model: QS-C18,5 μm, 4.6X1250 mm. Mobile phase: 50mM ammonium dihydrogen phosphate and 10mM tetrabutylammonium bromide were dissolved in 800mL of ultrapure water, pH was adjusted to 3.8 with phosphoric acid, and the volume was adjusted to 1000mL, and mixed with acetonitrile at a volume ratio of 88:12. The detection wavelength is 232nm, the flow rate is: 0.8mL/min, column temperature: the peak time at 40 ℃ is: 10.0 minutes.

EXAMPLE 1 construction of glufosinate dehydrogenase Gene engineering bacteria

The glufosinate dehydrogenase (GenBank: RQW 74141.1) from the lysine bacillus composts (Lysinibacillus composti) is synthesized by the Qingzhou department biotechnology limited company through the whole genes (the nucleotide sequence is shown as SEQ ID No.3, the amino acid sequence is shown as SEQ ID No. 1), the obtained glufosinate dehydrogenase gene is cloned between pETDuet plasmid EcoRI and AflII enzyme cutting sites, an expression vector pETDuet-PPTDH is constructed, and E.coli BL21 (DE 3) is transformed to obtain an original strain E.coli BL21 (DE 3)/pETDuet-PPTDH.

SEQ ID No.1

MAENLNLFTSTQEVVKEALNKLGYDEAMYELLKEPLRLLKVRIPVKMDDGTTQVFTGYRAQHSDAVGPTKGGVRFHPMVSEDEVKALSMWMTLKCGIVDLPYGGGKGGIICDPRQMSMGELERLSRGYVRAISQIVGPTKDIPGPDVFTNAQIMAWMMDEYSRMDEFNSPGFITGKPLVLGGSKGRDRATAEGVTIVIQEAAKKRNIDIKGARVVIQGFGNAGSFLAKFMSDLGAKVIGISDAYGALHDPNGLDIDYLLDRRDSFGTVTTLFENTITNQELLELDCDILVPAAIENQITAENAHNIKATIVVEAANGPTTSEATKILTERGILLVPDVLASAGGATVSYFEWVQNNMGYYWEEEEVQEKLYKKMYDSFEAVYTTATTRNIDMRLAAYMVGVRRTAEASRFRGWV

SEQ ID NO.3

ATGGCAGAAAACCTGAACTTATTTACGAGCACCCAGGAGGTTGTGAAAGAAGCGCTGAACAAACTGGGTTATGATGAGGCAATGTACGAACTGCTGAAAGAACCGCTGCGCCTGCTGAAAGTGCGTATTCCTGTGAAGATGGACGATGGCACCACACAGGTGTTTACGGGTTATCGCGCACAACATTCCGATGCAGTAGGTCCCACCAAAGGTGGCGTGCGTTTTCATCCTATGGTTTCTGAAGACGAAGTTAAAGCACTGAGCATGTGGATGACCCTGAAGTGCGGGATTGTAGATCTGCCTTATGGTGGTGGTAAAGGTGGCATTATTTGTGATCCGCGTCAGATGAGCATGGGGGAATTAGAACGTCTGAGCCGTGGATATGTTCGGGCAATTAGTCAGATTGTTGGGCCGACCAAAGATATACCGGgtCCGGATGTTTTTACCAATGCACAAATTATGGCATGGATGATGGATGAGTATAGCCGTATGGATGAATTTAATAGTCCGGGTTTTATAACCGGTAAACCTCTGGTGCTGGGCGGTAGTAAAGGGCGTGATCGGGCGACGGCAGAAGGTGTTACGATTGTTATTCAGGAGGCAGCAAAAAAGAGAAATATCGATATCAAAGGTGCACGCGTTGTTATTCAAGGGTTCGGTAATGCCGGCAGTTTTTTAGCAAAGTTTATGAGTGATCTGGGCGCGAAGGTTATAGGAATAAGTGATGCATACGGGGCCCTGCACGATCCGAATGGTTTAGATATTGATTATCTGCTGGACAGACGTGATAGTTTTGGTACCGTTACCACGCTGTTTGAAAATACAATTACGAATCAGGAGCTGCTGGAACTGGATTGTGATATTCTGGTGCCGGCCGCAATTGAGAATCAGATTACGGCAGAAAATGCACATAATATTAAGGCAACCATAGTTGTGGAAGCAGCGAACGGCCCAACCACCTCTGAAGCAACCAAAATTCTGACCGAACGTGGTATTCTGTTAGTGCCAGACGTTTTAGCAAGCGCAGGTGGGGCAACAGTTAGCTACTTTGAGTGGGTTCAAAATAATATGGGCTATTACTGGGAAGAAGAAGAGGTTCAAGAAAAACTGTACAAAAAAATGTATGATAGCTTTGAAGCAGTATATACAACCGCAACCACGCGCAATATAGATATGCGTCTGGCAGCGTATATGGTGGGAGTGAGAAGAACAGCAGAAGCGAGCCGTTTCCGGGGCTGGGTG

Example 2 construction of alcohol dehydrogenase Gene engineering bacteria

The nucleic acid sequence of alcohol dehydrogenase GstADH from Geobacillus stearothermophilus (Geobacillus stearothermophilus) (NCBI accession number WP_ 001058802.1) was synthesized by Hangzhou's Optimago technology Co., ltd, the obtained GstADH gene (nucleotide sequence shown as SEQ ID No.4, amino acid sequence shown as SEQ ID No. 2) was cloned between the cleavage sites of Nco I and Xho I of plasmid pET-28a, recombinant plasmid pET-28a-GstADH was constructed, and the recombinant plasmid was transformed into E.coli to obtain the starting strain E.coli BL21 (DE 3)/pET 28a-GstADH.

SEQ ID No.2

MKAAVVEQFKEPLKIKEVEKPTISYGEVLVRIKACGVCHTDLHAAHGDWPVKPKLPLIPGHEGVGIVEEVGPGVTHLKVGDRVGIPWLYSACGHCDYCLSGQETLCEHQKNAGYSVDGGYAEYCRAAADYVVKIPDNLSFEEAAPIFCAGVTTYKALKVTGAKPGEWVAIYGIGGLGHVAVQYAKAMGLNVVAVDIGDEKLELAKELGADLVVNPLKEDAAKFMKEKVGGVHAAVVTAVSKPAFQSAYNSIRRGGACVLVGLPPEEMPIPIFDTVLNGIKIIGSIVGTRKDLQEALQFAAEGKVKTIIEVQPLEKINEVFDRMLKGQINGRVVLTLEDK

SEQ ID NO.4

ATGAAGGCGGCTGTCGTAGAACAGTTCAAAGAACCGCTGAAAATCAAAGAAGTCGAGAAACCGACCATCTCTTATGGCGAAGTTCTGGTTCGTATCAAAGCGTGTGGTGTCTGTCACACCGATCTGCATGCAGCCCACGGTGATTGGCCGGTCAAACCGAAACTGCCACTGATCCCGGGTCACGAGGGTGTTGGTATCGTTGAAGAAGTGGGTCCAGGCGTCACCCATCTGAAGGTAGGTGATCGCGTTGGCATCCCTTGGCTGTATAGCGCATGCGGTCATTGCGATTATTGCCTGTCCGGTCAGGAAACTCTGTGCGAACACCAGAAGAATGCGGGTTACTCTGTTGATGGTGGCTACGCAGAATACTGTCGCGCGGCGGCAGACTACGTTGTTAAAATTCCGGACAACCTGTCCTTCGAAGAAGCTGCTCCGATTTTCTGTGCGGGTGTGACCACCTACAAAGCGCTGAAGGTTACTGGTGCCAAACCAGGTGAATGGGTTGCTATCTACGGTATCGGTGGCCTGGGTCACGTTGCTGTTCAGTATGCCAAAGCTATGGGTCTGAACGTGGTTGCGGTAGACATTGGTGATGAGAAACTGGAGCTGGCTAAAGAACTGGGTGCAGACCTGGTAGTGAACCCTCTGAAGGAAGACGCCGCGAAATTTATGAAAGAAAAAGTCGGTGGCGTTCACGCCGCGGTTGTAACTGCTGTTTCCAAACCAGCATTCCAGTCTGCATACAACTCCATCCGTCGTGGTGGTGCTTGTGTTCTGGTTGGTCTGCCGCCGGAGGAAATGCCGATCCCTATTTTCGATACCGTTCTGAACGGTATTAAAATCATCGGTTCCATCGTTGGTACTCGTAAGGATCTGCAGGAAGCTCTGCAATTTGCTGCGGAAGGTAAAGTCAAAACCATTATTGAAGTTCAGCCGCTGGAGAAAATTAACGAAGTTTTCGACCGCATGCTGAAAGGTCAGATCAACGGCCGTGTTGTCCTGACGCTGGAAGACAAA

EXAMPLE 3 construction and screening of alcohol dehydrogenase mutant library

In the first round, the E.coli BL21 (DE 3) was transformed by site-directed mutagenesis PCR using the codon-optimized alcohol dehydrogenase gene obtained by total gene synthesis of example 2 (nucleotide sequence shown in SEQ ID No. 4) as a template and the primers for mutation of G73M and G73A shown in Table 1, respectively, and LB plates were coated to obtain pET28a-GstADH-G73A and pET28a-GstADH-G73M mutants. The enzyme activity of the pET28a-GstADH-G73A mutant was determined to be 8.53U/mg by the method of example 4 and example 5, the enzyme activity of the pET28a-GstADH-G73M mutant was determined to be 7.25U/mg, the dominant strain was selected to be a mutant with G73A mutation, the plasmid of the dominant mutant was named alcohol dehydrogenase mutant GstADH-G73A, and engineering bacteria E.coli BL21 (DE 3)/pET 28a-GstADH-G73A were constructed by the method of example 2 and were designated as strain E1.

The second round was performed using mutant GstADH-G73A as a template, and primers for mutation E107D, E107N, E107S, E K in Table 1 were used to transform E.coli BL21 (DE 3) by site-directed mutagenesis PCR, and LB plates were applied to obtain pET28 a-GstADH-G73A-G107 3728 a-GstADH-G73A-E S, pET a-GstADH-G73A-E107K mutants. The enzyme activities were determined to be 8.56U/mg, 8.55U/mg, 8.79U/mg and 8.62U/mg by the methods of example 4 and example 5, and mutants with double mutation of G73A and E107S were obtained by screening, and the plasmid of the dominant mutant was named alcohol dehydrogenase mutant GstADH-G73A-E107S.

The third round was performed using the mutant GstADH-G73A-E107S as a template, primers for mutation G175A, G175E, G D in Table 1 were used to transform E.coli BL21 (DE 3) by site-directed mutagenesis PCR, and LB plates were used to obtain pET28a-GstADH-G73A-E107D-G175A, pET a-GstADH-G73A-E107D-G175E, pET a-GstADH-G73A-E107D-G175D mutants, which were determined by the methods of example 4 and example 5 and had enzyme activities of 8.81U/mg, 8.86U/mg and 9.24U/mg, respectively, the dominant strains were selected to obtain mutants with three mutations of G73A, E S and G175D, and the dominant mutants were designated as alcohol dehydrogenase mutants GstADH-G73A-E107S-G175D, and engineering bacteria E.coli BL21 (DE 3)/G28 a-G73D-G107D were constructed by the method of example 2.

The fourth round was used to transform E.coli BL21 (DE 3) by site-directed mutagenesis PCR using the primers shown in Table 1 for mutation D96A, D96G, D E, respectively, and LB plates were applied to obtain pET28a-GstADH-G73A-E107D-G175D-D96A, pET28a-GstADH-G73A-E107D-G175D-D96G, pET28a-GstADH-G73A-E107D-G175D-D96E using the mutant GstADH-G73A-E107S-G175D. The enzyme activities were 9.64U/mg, 11.36U/mg and 9.83U/mg, respectively, as determined in example 4 and example 5, the dominant strains were selected to carry four mutations of G73A, E107S, G D and D96G, the plasmids of the dominant mutants were named alcohol dehydrogenase mutants GstADH-G73A-E107S-G175D-D96G, and engineering bacteria E.coli BL21 (DE 3)/pET 28a-GstADH-G73A-E107S-G175D-D96G were constructed as described in example 2 and were designated as strain E3.

The fifth round of transformation of E.coli BL21 (DE 3) by site-directed mutagenesis PCR using the mutant GstADH-G73A-E107S-G175D-D96G as template and the primers for mutagenesis of V286A, V E and V286T in Table 1, respectively, and plating of LB plates to obtain pET28a-GstADH-G73A-E107D-G175D-D96A-V286A, pET a-GstADH-G73A-E107D-G175D-D96A-V E, pET a-GstADH-G73A-E107D-G175D-D96A-V286T. The enzyme activities were determined by the methods of example 4 and example 5 and were 13.76U/mg, 11.63U/mg and 11.54U/mg, respectively, the dominant strain obtained by screening was five mutants with G73A, E107S, G175D, D G and V286A, the plasmid of the dominant mutant was named alcohol dehydrogenase mutant GstADH-G73A-E107S-G175D-D96G-V286A, the engineering bacterium E.coli BL21 (DE 3)/pET 28a-GstADH-G73A-E107S-G175D-D96G-V286A was constructed by the method of example 2 and was named strain E4, and the dominant single mutant in the later experiments was constructed by the same method.

Wherein, the PCR reaction system is as follows: 2 x Phanta Max buffer: 25 μL; dNTPs:1 μl; an upstream primer: 2. Mu.L; a downstream primer: 2. Mu.L; and (3) a template: 1 μl; phanta Super-Fidelity DNA polymerase: 0.5. Mu.L; ddH ₂ O：18.5μL。

PCR reaction conditions: pre-denaturation at 95℃for 5min; denaturation at 95℃for 30s, annealing at 56℃for 30s, extension at 72℃for 3min, and total circulation for 30 times; then extending for 10min at 72 ℃; preserving at 4 ℃.

The PCR results are respectively subjected to DNA agarose gel electrophoresis positive verification, and the results show that the amplified products are single bands with the sizes of about 2200 bp. And (3) carrying out Dpn I enzyme digestion on the PCR product to obtain a template, and purifying and recovering the amplified product by using a DNA recovery and purification kit, wherein the specific steps are described in the specification of the purification kit.

TABLE 1 mutation sites and primer sequences

/>

EXAMPLE 4 Induction of expression of alcohol dehydrogenase female parent and mutant

The starting strain E.coli BL21 (DE 3)/pET 28a-GstADH of example 2 and the mutant strains (E1, E2, E3, E4) constructed in example 3 were inoculated into LB liquid medium containing 50. Mu.g/mL of ampicillin at a final concentration, cultured at 37℃for 8 hours, inoculated into fresh LB liquid medium containing 50. Mu.g/mL of ampicillin at a final concentration of 2% (v/v), cultured at 37℃for 2 hours at 180rpm, and then added with 0.1mM IPTG at a final concentration of 28℃for 14 hours, and centrifuged at 8000rpm for 10 minutes at 4℃to obtain the corresponding wet cell.

Wet cells collected after the end of the culture were washed twice with phosphate buffer (50 mM) at pH 8, and then cells were resuspended in PBS (50 mM) at ph=8, sonicated 30 times, disruption conditions: the power is 400W, the crushing is 2s, and the interval is 5s. Centrifuging the cell disruption solution at 8000rpm at 4deg.C for 10min, removing precipitate to obtain supernatant which is crude enzyme solution, and respectively obtaining crude enzyme solution of original strain with protein content of 2.72mg/mL; mutant E1 crude enzyme solution with protein content of 2.65mg/mL; mutant E2 crude enzyme solution with protein content of 2.83mg/mL; the crude enzyme solution of the mutant E3 has the protein content of 2.78mg/mL; the crude enzyme solution of mutant E4 has a protein content of 2.68mg/mL.

Example 5 determination of alcohol dehydrogenase Activity

Definition of enzyme activity: in 1961, international conference on enzymology stipulated that 1 enzyme activity unit means the amount of enzyme converting 1. Mu. Mole of a substrate in 1 minute under a specific condition (30 ℃), or the amount of enzyme converting 1. Mu. Mole of the relevant group in the substrate.

Enzyme activity assay of alcohol dehydrogenase: 950. Mu.L of isopropanol was taken and 10mM NAD was added ⁺ 25 mu L of aqueous solution is placed in a metal bath oscillator and is kept at 30 ℃ for 10min; adding 25 mu L of corresponding crude enzyme solution, rapidly taking out, shaking by hand, pouring into a cuvette, rapidly placing into a spectrophotometer, detecting the absorbance at 340nm, and calculating the enzyme activity according to an NADH standard curve.

NADH standard curve: the absorbance at 340nm was measured by using ultrapure water to prepare 0.05mM, 0.1mM, 0.2mM, 0.3mM, 0.4mM and 0.8mM ADH solutions, respectively, adding the solutions to a cuvette, rapidly placing the cuvette in a spectrophotometer, and measuring the absorbance at the time (unit min) and the absorbance at the time (unit min) as the ordinate, namely, the NADH standard curve shown in FIG. 3, and the results of enzyme activity measurement are shown in Table 2, and the mutant strain E4 was selected for the subsequent experiment.

TABLE 2 enzyme activity measurement results (mg refers to the protein content in crude enzyme solution)

Numbering device	Mutation type	Enzyme activity (U/mg)
			Starting strain	Unmutated	6.80
E1	G73A；	8.53
			E2	G73A-E107S-G175D	9.24
E3	G73A-E107S-G175D-D96G	11.36
			E4	G73A-E107S-G175D-D96G-V286A	13.76

Example 6 construction of recombinant engineering bacterium co-expressing glufosinate dehydrogenase-alcohol dehydrogenase

Cloning GstADH-G73A-E107S-G175D-D96G-V286A into a second multiple cloning site (between NdeI and Avr II cleavage sites) of the pETDuet-PPTDH vector containing the glufosinate dehydrogenase gene constructed in example 1 by adopting a one-step cloning method, transferring into a host E.coli BL21 (DE 3), and constructing a co-expression recombinant engineering bacterium E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH-G73A-E107S-G175D-D96G-V286A, wherein the specific operation is as follows:

1. primer design

Primer 1, primer 2, primer 3 and primer 4 were designed based on the nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4, and about 20bp containing NdeI and Avr II cleavage sites in the vector pETDuet-PPTDH was added as homology arms to the 5' ends of the alcohol dehydrogenase gene-specific forward/reverse amplification primer sequences (primer 1 and primer 2), respectively.

Primer 1:5'-taacctaggctgctgccaccgctgagcaataa-3';

primer 2:5'-CATatgtatatctccttcttatacttaactaatatact-3';

primer 3:5'-gtataagaaggagatatacatATGAAGGCGGCTGTCGTAGAACAGT-3';

primer 4:5'-tggcagcagcctaggttaTTTGTCTTCCAGCGT-3';

2. fragment amplification

(1) pETDuet-PPTDH vector

Using pETDuet-PPTDH constructed in example 1 as a template, using a primer 1 and a primer 2, amplifying by using high-fidelity Pfu DNA polymerase, adding DPN I to digest, and obtaining a vector of pETDuet-PPTDH.

(2) GstADH fragment

The pET-28a-GstADH-G73A-E107S-G175D-D96G-V286A constructed in example 5 was used as a template, and primer 3 and primer 4 were used for amplification by using high-fidelity Pfu DNA polymerase, and DPN I was added for digestion to obtain an alcohol dehydrogenase GstADH fragment with a homology arm.

(3) Single fragment homologous recombination

The nucleic acid concentration of each of the fragments in the step (1) and the step (2) was measured by using a nanodrolone micro-spectrophotometer (TermoFisher Scientific, USA), and the nucleic acid concentration was determined according to the concentration and the configuration was carried out according to the single-piece homologous recombination reaction system in Table 3.

Optimal cloning vector usage = {0.02 cloning vector base pair number } ng (0.03 pmol)

Optimal insert usage = { 0.04. Insert base pair number } ng (0.06 pmol)

TABLE 3 reaction system

Note that: x represents the amount of added linearization vector, Y represents the amount of inserts, and n is the number of inserts.

And (3) gently sucking and beating the prepared reaction system by using a pipette, uniformly mixing, and collecting the reaction solution to the bottom of the tube after short centrifugation. The reaction system was placed in a water bath at 50℃for 5min, and then immediately cooled on ice. 3 different systems are respectively transformed into escherichia coli BL21 (DE 3) (42 ℃ C., 90S), coated on LB plates containing 100 mug/mL of ampicillin resistance, cultured for 12-16 hours at 37 ℃, randomly picked up clone extraction plasmids for sequencing identification, and recombinant escherichia coli E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH-G73A-E107S-G175D-D96G-V286A containing glufosinate dehydrogenase and alcohol dehydrogenase genes are screened.

In the same way, recombinant E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH was constructed.

Example 7 Induction expression of recombinant engineering bacteria co-expressed with glufosinate dehydrogenase-alcohol dehydrogenase

E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH and E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH-G73A-E107S-G175D-D96G-V286A constructed in example 6 were inoculated into 50. Mu.g/mL of ampicillin-resistant LB liquid medium, respectively, cultured at 37℃and 200rpm for 12 hours, inoculated into fresh 50. Mu.g/mL of ampicillin-resistant LB liquid medium at a concentration of 2% by volume, cultured at 37℃and 180rpm until the cell OD600 reached 0.6-0.8, and after induction culture at a final concentration of 12. Mu.g/mL of IPTG at 28℃for 12 hours, centrifuged at 4℃and 8000rpm for 15 minutes, the supernatant was discarded, and the pellet was collected, washed twice with pH7.5 and 20mM sodium phosphate buffer to obtain wet cells.

The cells were crushed by the crushing method of example 4, FIG. 1 is a corresponding protein gel chart, lane 1 is a Maker;

lanes

2, 3, 4, 5 are pETDuet-PPTDH-GstADH,

lanes

6, 7, 8 are pETDuet-PPTDH-GstADH-G73A-E107S-G175D-D96G-V286A.

EXAMPLE 8 preparation of L-glufosinate by Co-expression of recombinant engineering bacteria by glufosinate dehydrogenase and alcohol dehydrogenase

The method is characterized in that PPO is used as a substrate, and wet thalli obtained by fermenting and culturing recombinant engineering bacteria co-expressed by glufosinate dehydrogenase and alcohol dehydrogenase are used as biocatalysts to react to generate L-glufosinate, and the specific operation is as follows:

10G DCW/L of glufosinate dehydrogenase and alcohol dehydrogenase prepared in the method of example 7 are firstly subjected to co-expression of recombinant engineering bacteria E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH-G73A-E107S-G175D-D96G-V286A wet thalli, 300mM isopropanol and 0.1mM NAD are sequentially dissolved in 1L of 100mM sodium phosphate buffer solution with pH of 7.5, then substrate PPO (36.2G/L) with the final concentration of 200mM is added to form a coenzyme regeneration system 1L, the reaction is carried out for 8 hours at the temperature of 55 ℃ and the stirring rotation speed of 600rpm, and the reaction liquid is sampled and the generation of the product L-glufosinate is detected by adopting high performance liquid chromatography. Under the same conditions, the recombinant engineering bacteria E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH are co-expressed by glufosinate dehydrogenase and alcohol dehydrogenase. The results are shown in FIG. 2.

FIG. 2 shows that the product concentration gradually increases with time during the reaction of strain E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH-G73A-E107S-G175D-D96G-V286A, the reaction is completed within 8h, and the substrate conversion is greater than 99%. The conversion rate of E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH strain in the comparative experiment after 6 hours reaction is only 65%.

EXAMPLE 9 preparation of L-glutamic acid by Co-expression of recombinant engineering bacterium for glufosinate dehydrogenase and alcohol dehydrogenase

The method is characterized in that alpha-ketoglutarate is used as a substrate, wet thalli obtained by fermenting and culturing recombinant engineering bacteria co-expressed by glufosinate dehydrogenase and alcohol dehydrogenase is used as a biocatalyst to react, and L-glutamic acid is generated, and the specific operation is as follows:

10G DCW/L glufosinate dehydrogenase and alcohol dehydrogenase prepared in example 7 are firstly subjected to co-expression recombinant engineering bacteria E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH-G73A-E107S-G175D-D96G-V286A wet thalli, 300mM isopropanol and 0.1mM NAD are sequentially dissolved in 1L of 100mM sodium phosphate buffer solution with pH of 7.5, then substrate alpha-ketoglutarate with the final concentration of 200mM is added to form a coenzyme regeneration system 1L, the reaction is carried out for 8 hours at the temperature of 55 ℃ and the stirring speed of 600rpm, and the reaction liquid is sampled and the high performance liquid chromatography is adopted to detect the generation of the product L-glutamic acid.

Strain E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH-G73A-E107S-G175D-

The concentration of the product gradually rises with the time during the reaction of D96G-V286A, the reaction is completed within 6 hours, and the substrate conversion rate is more than 99 percent. The conversion of E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH strain in the comparative experiment was only 76% in 6 h.

EXAMPLE 10 preparation of L-aspartic acid by Co-expression of recombinant engineering bacterium for glufosinate dehydrogenase and alcohol dehydrogenase

The method is characterized in that oxaloacetic acid is used as a substrate, wet thalli obtained by fermenting and culturing recombinant engineering bacteria co-expressed by glufosinate dehydrogenase and alcohol dehydrogenase are used as biocatalysts to react to generate L-aspartic acid, and the specific operation is as follows:

10G DCW/L glufosinate dehydrogenase and alcohol dehydrogenase prepared in example 7 are firstly subjected to co-expression of recombinant engineering bacteria E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH-G73A-E107S-G175D-D96G-V286A wet thalli, 300mM isopropanol and 0.1mM NAD are sequentially dissolved in 1L of 100mM sodium phosphate buffer solution with pH of 7.5, then substrate oxaloacetic acid with the final concentration of 200mM is added to form a coenzyme regeneration system 1L, the reaction is carried out for 8 hours at the temperature of 55 ℃ and the stirring rotation speed of 600rpm, and the reaction liquid is sampled and the generation of the product L-aspartic acid is detected by adopting high performance liquid chromatography. Under the same conditions, the recombinant engineering bacteria E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH are co-expressed by glufosinate dehydrogenase and alcohol dehydrogenase. The concentration of the product gradually rises with the passage of time when the strain E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH-G73A-E107S-G175D-D96G-V286A reacts, the reaction is completed within 6 hours, and the substrate conversion rate is more than 99%. The conversion of E.coli BL21 (DE 3)/pETDuet-PPTDH-GstADH strain in the comparative experiment was only 61% in 6 h.

EXAMPLE 11 methanol crystallization method to purify and crystallize L-glufosinate-ammonium salt with high concentration in the reaction solution

50g of calcium carbonate to precipitate sulfate ions are added into 50mL of reaction liquid obtained in the reaction of the example 7, the mixture is centrifuged at 8000rpm for 10 minutes after being magnetically stirred at 600rpm for 2 hours, supernatant is concentrated by rotary evaporation at 80rpm and 60 ℃ for 6 hours until the supernatant is dried, 600mL of methanol is used for overnight dissolution, and a methanol solution of L-glufosinate ammonium salt is obtained after the solution is filtered by a vacuum pump; the pH was adjusted to 4.2 with concentrated sulfuric acid, magnetically stirred at 600rpm for 4 hours, and after suction filtration, the filter cake was dried at 65℃for 12 hours to give an off-white crystal of L-glufosinate-ammonium salt, as shown in FIG. 4.

And then verifying the purity of the prepared L-glufosinate ammonium salt, dissolving 0.01g of off-white crystal of the L-glufosinate ammonium salt in 10mL of ultrapure water to prepare 1g/L of L-glufosinate ammonium salt aqueous solution, and performing high performance liquid chromatography detection on the aqueous solution to obtain the result that the mass fraction of the L-glufosinate ammonium salt is more than 95%.

EXAMPLE 12 characterization of the form of L-glufosinate ammonium salt

1. HPLC characterization

The off-white crystals of the L-glufosinate-ammonium salt prepared in example 11 were measured by a liquid phase detection method, and the results are shown in FIG. 5, confirming that the L-glufosinate-ammonium salt was successfully obtained by the method described in example 11.

2. XRD characterization

Pretreatment of the L-glufosinate ammonium salt crystals obtained in example 11: grinding (ball-point ink) and sieving. The powder was made brittle by liquid nitrogen or dry ice, and was ground by a mortar (ball mill) to a powder of <360 mesh, with no graininess to hand, and the grain size was considered satisfactory. During the milling process, the particles which have been refined are separated off by constant sieving.

The sample powder is spread on a microscope slide with the size of 25X 35X 1mm (the position of the spreading powder is equivalent to the position of a window hole of a sample preparation frame), then a sufficient amount of acetone is added dropwise to enable the powder to be in a thin-layer slurry state, the powder is uniformly spread, the thickness of a single particle layer can be formed, and after the acetone is evaporated, the powder is adhered on the glass sheet.

The prepared L-glufosinate ammonium salt crystals were subjected to an X-ray powder diffraction pattern expressed in terms of 2 theta angle at 25 deg.C using Cu-Ka radiation, as shown in FIG. 6. FIG. 6 demonstrates the success of obtaining L-glufosinate ammonium by the method described in example 11.

Example 13 hygroscopicity test of crystals of L-glufosinate-ammonium

50g of the L-glufosinate-ammonium salt prepared in example 11 was taken and kept at different humidities in Table 4 for 15 days, and the presence or absence of a significant change in mass was examined, and the mass change rate was calculated, and the results are shown in Table 4.

Table 4 hygroscopicity data

As can be seen from Table 4 above, the crystals of L-glufosinate ammonium prepared in example 11 were stored at a relative humidity of 60% for 15 days at room temperature (25 ℃) and had a mass change of 0.1% or less without significant hygroscopicity.

Claims

1. An alcohol dehydrogenase mutant, which is characterized in that the alcohol dehydrogenase mutant is obtained by single mutation or multiple mutation at position 73, position 107, position 175, position 96 or position 286 in the amino acid sequence of the alcohol dehydrogenase shown in SEQ ID No. 2.

2. The alcohol dehydrogenase mutant of claim 1, wherein the alcohol dehydrogenase mutant is characterized by a mutation of the amino acid sequence shown in SEQ ID No.2 to one of the following: (1) glycine 73 to alanine; (2) Glycine 73 to alanine and glutamic acid 107 to serine; (3) Mutation of glycine 73 to alanine, mutation of glutamic acid 107 to serine, mutation of glycine 175 to aspartic acid; (4) Mutation of glycine 73 to alanine, mutation of glutamic acid 107 to serine, mutation of glycine 175 to aspartic acid, mutation of aspartic acid 96 to glycine; (5) Glycine 73 to alanine, glutamic acid 107 to serine, glycine 175 to aspartic acid, aspartic acid 96 to glycine, valine 286 to alanine.

3. A recombinant genetically engineered bacterium comprising a gene encoding the alcohol dehydrogenase mutant of claim 1.

4. Use of the alcohol dehydrogenase mutant of claim 1 in a biological inorganic amination reaction.

5. The application of claim 4, wherein the application is: wet thalli obtained by fermenting and culturing co-expression recombinant bacteria containing alcohol dehydrogenase mutant genes and glufosinate dehydrogenase genes are used as catalysts, keto acid compounds are used as substrates, and isopropanol and/or NAD are added ⁺ The buffer solution with pH value of 7-8 is used as reaction medium to form reaction system, and the reaction is completed under the conditions of 35-60 deg.C and 500-600rpm, and the reaction solution is separated and purified to obtain correspondent chiral compound.

6. The use according to claim 5, wherein the catalyst is used in an amount of 5 to 30g/L based on the total weight of the wet cells, the initial concentration of the substrate is 10 to 500mM, the NAD addition is 0 to 5mM, and the isopropanol addition is 10 to 500mM.

7. The use according to claim 5, wherein the substrate is 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid, α -ketoglutarate, oxaloacetic acid.

8. The use according to claim 5, wherein the co-expression recombinant bacterium containing the alcohol dehydrogenase mutant gene and the glufosinate dehydrogenase gene is constructed by cloning the alcohol dehydrogenase mutant encoding gene to a second multi-cloning site of a pETDuet-PPTDH vector containing the glufosinate dehydrogenase gene by a one-step cloning method, and transferring the gene into a host E.coli BL21 (DE 3), wherein the nucleotide sequence of the glufosinate dehydrogenase gene is shown as SEQ ID No. 3.

9. The use according to claim 5, wherein the catalyst is prepared by the following method: the co-expression recombinant bacteria containing the glufosinate dehydrogenase gene and the alcohol dehydrogenase mutant gene are inoculated to LB liquid medium containing 50 mug/mL ampicillin resistance, cultured for 12 hours at 37 ℃ and 180rpm, then inoculated to fresh LB liquid medium containing 50 mug/mL ampicillin resistance at an inoculum size of 2% of volume concentration, cultured at 37 ℃ and 180rpm until the bacterial OD600 reaches 0.6-0.8, IPTG with a final concentration of 12 mug/mL is added, induced and cultured for 12 hours at 28 ℃, the temperature is 4 ℃ and 8000rpm, the supernatant is discarded, the precipitate is collected, and washed twice with pH7.5 and 20mM sodium phosphate buffer solution, thus obtaining wet bacterial.

10. The use according to claim 5, wherein when the substrate is 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid, the reaction solution is separated and purified by: (1) Adding calcium carbonate into the reaction solution, removing sulfate radical in the reaction solution by a precipitation method, magnetically stirring at 600rpm for 2 hours, centrifuging at 8000rpm for 10 minutes, and collecting supernatant; the addition amount of the calcium carbonate is 0.1g/mL based on the volume of the reaction solution; (2) Concentrating the supernatant in the step (1) by rotary evaporation at 80rpm and 60 ℃ for 6 hours to dryness to obtain a concentrate; (3) Adding methanol into the concentrate in the step (2), and dissolving overnight; regulating pH to 2-5, stirring at 600rpm for 4h, filtering, and drying filter cake to obtain L-glufosinate ammonium powder; the volume ratio of the methanol consumption to the reaction liquid is 2:1.