CN117247915A - Omega-amine transaminase, recombinant bacterium and application thereof - Google Patents

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to omega-amine transaminase, recombinant bacteria and application thereof. The amino acid sequence of the omega-amine aminotransferase is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO.2 or SEQ ID NO. 3. The recombinant strain is obtained by transferring recombinant expression plasmid containing coding genes for omega-amine transaminase into host escherichia coli and screening. The invention clones and identifies a novel omega-amine transaminase gene from human pallidobacter Ochrobactrum anthropic ZJB-061 for the first time, and proves that the omega-amine transaminase can improve the problem of the unfavorable equilibrium constant of the ammonia transfer reaction, and the enzyme has great potential to convert byproducts such as keto acid and the like to promote the reaction equilibrium in the similar reactions of preparing L-glufosinate by the ammonia transfer reaction with 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid as a substrate.

Description

Omega-amine transaminase, recombinant bacterium and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to omega-amine transaminase, recombinant bacteria and application thereof.

Background

Glufosinate (PPT; chemical name 2-amino-4- [ hydroxy (methyl) phosphono ] butanoic acid), which is the second largest transgenic crop in the world resistant to herbicides, can exert herbicidal effects by inhibiting plant glutamine synthetase. At present, the paraquat is stopped because of extremely toxic substances, the glyphosate is resistant to plants for long-term use, so that the market is gradually shrunken, and the glufosinate has the characteristics of wide sterilization, low toxicity, environmental friendliness and the like, and has good market prospect.

There are two optical isomers of glufosinate, L-glufosinate and D-glufosinate, respectively. However, only L-glufosinate has phytotoxicity, has herbicidal activity which is 2 times that of the common commercial racemic DL-glufosinate, is easy to decompose in soil, has small toxicity to human beings and animals, has wide herbicidal spectrum and has small damage to the environment. If the glufosinate-ammonium product can be used in the form of L-shaped pure optical isomer, the use amount of the glufosinate-ammonium can be reduced by 50%, which has important significance for improving the atom economy, reducing the use cost and relieving the environmental pressure.

The current methods for preparing optically pure L-glufosinate mainly comprise three methods: chemical synthesis, chiral resolution and biocatalysis.

The chemical synthesis method synthesizes the optically pure L-glufosinate-ammonium from chiral raw materials, and the method has the advantages of more process steps, low yield, and high production cost due to the fact that most of used asymmetric synthesis reagents are expensive, and is unfavorable for large-scale preparation of the L-glufosinate-ammonium.

The chiral resolution method is to prepare optically pure L-glufosinate by chemically synthesizing racemic DL-glufosinate or derivatives thereof and separating D-isomer and L-isomer by using chiral resolution reagent. The process has the technical problems of low single resolution yield and complex process.

In contrast, the biocatalysis method has the advantages of strict stereoselectivity, mild reaction conditions, high yield, easy separation and purification of products and the like, and is a potential advantage method for producing L-glufosinate.

When the metabolic pathway of glufosinate-ammonium in soil microorganisms is studied, it has been found that L-glufosinate-ammonium is decomposed into 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butanoic acid (PPO for short) by transaminase. The ammonia transfer reaction is a reversible reaction, and PPO can produce L-glufosinate by the ammonia transfer reaction under the catalysis of transaminase. However, this transamination reaction to form L-glufosinate has the disadvantage of an unfavorable equilibrium constant, and many studies are currently focused on the removal and decomposition of by-products. Alanine is used as a typical amino donor, and a deamination product is pyruvic acid, so that the deamination product has strong inhibition capability on enzymes, and is one of key factors for limiting balance. Currently, enzymes commonly used to remove pyruvate are Lactate Dehydrogenase (LDH), alanine dehydrogenase (AlaDH), pyruvate Decarboxylase (PDC), alcohol Dehydrogenase (ADH), and coupled GDH or FDH, among others.

Disclosure of Invention

In order to solve the technical problems, the invention provides omega-amine transaminase, recombinant bacteria and application thereof.

The invention is realized by the following technical scheme:

the first object of the present invention is to provide a ω -amine transaminase having an amino acid sequence as shown in SEQ ID NO. 1.

The omega-amine transaminase gene is derived from the human pallium Ochrobactrum anthropic ZJB-061 (CN 101063090A patent existing strain, the specific preservation unit is China center for type culture collection, the address is China university of Wuhan, mail code 430072, the preservation date is 14 days of 2006, the preservation number is CCTCC NO: M206039), homologous strain Ochrobactrum anthropic (Genbank: CP 022605.1) which is similar to the strain and has been subjected to genome sequencing is selected as a reference after the strain is compared in NCBI, all omega-amine transaminase genes in the genome are analyzed, a gene sequence with the highest homology is obtained through screening, cloning primer design is carried out, and the similarity between a cloning product and the omega-transaminase protein sequence from Ochrobactrum through (WP_ 011982390.1) is found to be only 69.52%, so that the function and application value of the omega-amine transaminase are verified.

Preferably, the nucleotide sequence of the omega-amine aminotransferase encoding gene is shown in SEQ ID No.2.

Preferably, the nucleotide sequence of the omega-amine aminotransferase encoding gene is shown in SEQ ID No. 3.

Because the omega-amine aminotransferase gene shown in SEQ ID No.2 has lower soluble expression quantity, the invention optimizes the codon of the original sequence of the omega-amine aminotransferase gene according to the preference of an escherichia coli expression system to obtain the sequence shown in SEQ ID No. 3.

The second object of the present invention is to provide a recombinant expression plasmid, which comprises a coding gene for omega-amine aminotransferase, wherein the nucleotide sequence of the coding gene is shown as SEQ ID NO.2 or SEQ ID NO. 3.

Preferably, the recombinant expression plasmid is obtained by inserting a coding gene into a pET-28a vector.

The third object of the present invention is to provide a recombinant genetically engineered bacterium comprising any one of the recombinant expression plasmids described above.

Preferably, the recombinant engineering bacteria are obtained by transferring recombinant expression plasmids into host escherichia coli BL21 (DE 3) or escherichia coli Top 10.

As a further preferred aspect, the recombinant engineering bacterium is obtained by transferring a recombinant expression plasmid into a host E.coli BL21 (DE 3).

A fourth object of the present invention is to provide a method for producing ω -amine transaminase, the production method being: fermenting and culturing any recombinant genetically engineered bacterium, breaking the wall of the cultured recombinant genetically engineered bacterium, and separating and purifying to obtain omega-amine transaminase.

The fifth object of the present invention is to propose the use of the above-mentioned ω -amine transaminase, recombinant expression plasmid or recombinant genetically engineered bacterium in a transamination reaction.

The transfer reaction in the present invention refers to a reaction that catalyzes the transfer of an amino group on an amino donor (amino acid or amine) to a prochiral acceptor aldehyde, ketone or keto acid. The transamination reaction can be used in particular for kinetic resolution preparation or asymmetric synthesis preparation of unnatural amino acids, for preparation of aliphatic and aromatic unnatural amino acids or for preparation of chiral amines and chiral amino acids.

As a further preferred aspect, the invention also provides the use of the ω -amine transaminase, the recombinant expression plasmid or the recombinant genetically engineered bacterium in the synthesis of L-glufosinate-ammonium by a transamination reaction.

The omega-amine transaminase can be used for efficiently converting pyruvic acid, and can be used for catalyzing pyruvic acid to assist in generating L-alanine, wherein the L-alanine is a common amino donor for preparing L-glufosinate by ammonia transfer reaction by taking 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid as a substrate, and pyruvic acid is generated after the reaction, so that the omega-amine transaminase can improve the forward inhibition effect of byproduct pyruvic acid on the ammonia transfer reaction in the process of preparing L-glufosinate by ammonia transfer reaction by taking 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid as the substrate, and relieve the problem of an unbalanced constant of the ammonia transfer reaction.

Compared with the prior art, the invention has the following beneficial effects:

the invention clones and identifies a novel omega-amine transaminase gene from human pallidobacter Ochrobactrum anthropic ZJB-061 for the first time, and proves that the omega-amine transaminase can improve the problem of the unfavorable equilibrium constant of the ammonia transfer reaction, and the enzyme has great potential for converting byproducts such as keto acid and the like to promote the reaction equilibrium in the ammonia transfer reaction of preparing L-glufosinate-ammonium and the like by taking 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid as a substrate.

The remaining advantageous effects will be explained in the examples.

Sequence description

SEQ ID NO.1 is the amino acid sequence of omega-aminotransferase ata-Oc 3;

SEQ ID NO.2 is omega-amine aminotransferase ata-Oc nucleotide sequence;

SEQ ID NO.3 is the nucleotide sequence of omega-aminotransferase ata-Oc3 after optimization of omega-aminotransferase ata-Oc;

SEQ ID NO.4 shows a cloned gene forward primer ata-OcF in Ochrobactrum anthropic ZJB-061;

SEQ ID NO.5 shows a cloned gene reverse primer ata-OcR in Ochrobactrum anthropic ZJB-061.

Drawings

The following will briefly be described with reference to the accompanying drawings:

FIG. 1 is a schematic illustration of a catalytic reaction of ω -amine transaminase;

FIG. 2 is a gel electrophoresis diagram of ω -amine transaminase: lane M is the molecular weight Marker of the nucleic acid, lane 1 is the ω -amine transaminase pET28a-ata-Oc, and lane 2 is the ω -amine transaminase ata-Oc;

FIG. 3 is a SDS-PAGE diagram of ω -amine transaminase: lane M is protein molecular weight Marker, lane 1 ω -amine transaminase disrupted cell supernatant, lane 2 is ω -amine transaminase disrupted cell pellet;

FIG. 4 is a schematic illustration of the catalytic synthesis of L-alanine by ω -amine transaminase;

FIG. 5 is a schematic illustration of the catalytic synthesis of L-glufosinate by ω -amine transaminase.

Detailed Description

The invention is further described below with reference to the drawings and specific examples. Those of ordinary skill in the art will be able to implement the invention based on these descriptions. In addition, the embodiments of the present invention referred to in the following description are typically only some, but not all, embodiments of the present invention. Therefore, all other embodiments, which can be made by one of ordinary skill in the art without undue burden, are intended to be within the scope of the present invention, based on the embodiments of the present invention.

Example 1: acquisition of ω -amine transaminase Gene ata-Oc

The omega-amine transaminase gene is derived from the human pallidum Ochrobactrum anthropic ZJB-061, and after 16S rDNA sequencing, the homology comparison is carried out based on blastn in NCBI, so that the sequence identity with Ochrobactrum anthropic is the highest. All aminotransferases in the Ochrobactrum thpic (Genbank: CP 022605.1) which has been subjected to genome-wide sequencing are analyzed, a ω -aminotransferase gene sequence with the highest homology is obtained by screening, cloning primer design is carried out, the similarity of a cloning product and a ω -aminotransferase protein sequence (5 GHF) from the Flavobacterium Ochrobactrum anthropi (WP_ 011982390.1) is found to be 69.52%, and the ω -aminotransferase function and the application value are verified.

First, ochrobactrum anthropic ZJB-061 genomic DNA was extracted using a DNA rapid extraction kit (FastDNA ™ SPIN, MP) and specific primers were designed based on the ω -transaminase gene sequence.

PCR was performed using genomic DNA of Ochrobactrum anthropic ZJB-061 as a template and ata-OcF and ata-OcR as primers to obtain a product fragment of 1374 bp, which was sequenced and aligned in NCBI library to find a similarity of 69.52% with the 5GHF omega-aminotransferase protein sequence from Xanthium Ochrobactrum anthropi.

The primers ata-OcF (the sequence is shown as SEQ ID NO. 4) and ata-OcR (the sequence is shown as SEQ ID NO. 5) are designed, ncoI and XhoI restriction enzyme cutting sites are respectively introduced into the 5 'side and the 3' side of the DNA coding frame of Ochrobactrum anthropic ZJB-061 omega-aminotransferase by utilizing PCR, the protective base is arranged in front of the enzyme cutting sites, and the effective sequence is arranged behind the enzyme cutting sites;

ata-OcF:5'ATCCATGGATGACGAGACAGCCCAATTC3'

ata-OcR:5'TACTCGAGTTAAGAGCGACCGATTGCGGTC3'

and (3) taking the separated Ochrobactrum anthropic ZJB-061 genome DNA as a template, and adopting the primers designed above to carry out PCR amplification to obtain the omega-amine transaminase gene ata-Oc.

Wherein 50 mu L of PCR reaction system structureThe method comprises the following steps: 25 μL10× DNA Polymerase Buffer,2 μL10 mM dNTP mix (dATP, dCTP, dGTP and dTTP each 2.5 mM), 1 μLDNA Polymerase,1 μL10 μM ata-OcF,1 μL10 μM ata-OcR,1 μL template DNA,19 μLdd H ₂ O. The reaction conditions for PCR were: 95. pre-denaturation at 5 min; 95. denaturation at 30, s; 60. 30, s, annealing; 72. the temperature is 1 min, the extension is carried out, and 30 cycles are carried out from the second step to the fourth step; 72. at 5 min,16℃and extensive extension.

The PCR amplified product was detected by gel electrophoresis to obtain a DNA fragment of 1374 and bp (see FIG. 2 for details), and the PCR product was purified and recovered by using a DNA recovery and purification kit (AxyPrep PCR Cleanup Kit), the specific procedure of which is described in the specification of the purification kit. The PCR products were sized by agarose gel electrophoresis and gel recovery and purification were performed. The specific steps are to recover the target gene fragment according to the instructions of Trelief DNA Gel Extraction Kit gel recovery kit.

Example 2: construction of recombinant plasmid containing ω -amine transaminase Gene ata-Oc

The recombinant plasmid containing the omega-amine aminotransferase gene ata-Oc is constructed by connecting the omega-amine aminotransferase gene ata-Oc with an optional plasmid pET-28a (expression vector). The recovered target gene fragment and pET-28a plasmid are subjected to double enzyme digestion treatment at 37 ℃ by using NcoI and XhoI restriction enzymes (TaKaRa); the digested fragments were recovered and ligated overnight at 16℃using T4DNA ligase (TaKaRa) to obtain the ligation product. 10. Mu.L of the ligation product was added to competent cells DH 5. Alpha. And placed on ice for 30 min, immediately after heat shock 60 s at 42℃on ice, after 5 min, 600. Mu.L of LB medium without antibiotics was added, shaking culture was performed at 37℃for 1 h, and the transformed bacterial solution was spread on LB (Amp) blue-white plate and incubated overnight at 37 ℃. Multiple colonies were picked on plates for PCR identification.

Plasmid extraction: extracting clone Plasmid which is positive by colony PCR identification by using Trelief cube Plasmid Kit, and obtaining the nucleic acid sequence of human pallidum omega-amine transaminase protein coding gene by nucleic acid sequencing. The amino acid sequence and the nucleotide sequence of the protein are shown in SEQ ID NO.1 and SEQ ID NO.2.

According to the preference of colibacillus protein expression, the obtained gene sequence is selectively modified, the omega-amine transaminase gene ata-Oc after codon optimization is named as ata-Oc3, the gene sequence is shown as SEQ ID NO.3, and the optimized sequence is synthesized by biological company.

Example 3: construction and culture of recombinant genetic engineering strain containing omega-amine transaminase gene ata-Oc3

The recombinant plasmid pET28a-ata-Oc3 obtained in accordance with the method of example 2 was transferred into competent cells of E.coli BL21 (DE 3) (Beijing engine family organism Co., ltd.) and spread uniformly on kanamycin resistance plates, cultured in an inverted manner at 37℃for 16 h, and the recombinant genetic engineering strain E.coli BL21 (DE 3)/pET 28a-ata-Oc3, which was confirmed as positive by single colony selection, was selected. Positive single colonies were picked and inoculated into 10 mL of LB liquid medium containing 50. Mu.g/mL kanamycin, and shake-cultured at 37℃and 200 rpm for 12 h to obtain seed liquid. Transferring the seed solution into 100 mL fresh culture medium according to 1% inoculum size, shake culturing at 37deg.C and 180 rpm until OD ₆₀₀ =0.4 to 0.6, induction was performed by adding IPTG at a concentration of 100 mM at 0.1%, induction was performed by culturing at 28 ℃,180 rpm, and cells were collected after 12 h induction.

Example 4: expression and purification of omega-amine aminotransferase proteins

The collected cells were washed once with 0.85% by mass of physiological saline (NaCl), centrifuged at 8000 rpm for 10min at 4℃and collected again. The collected cells were resuspended in 20 mM PB phosphate buffer (pH 8.0) containing 0.1mM PLP, sonicated (40W, 2 s, 4 s intervals, 40 min continuous disruption) in a low-temperature ice bath, and the disrupted cell sap was centrifuged at 12000 rpm for 10min, followed by obtaining a supernatant as an engineering bacterium crude enzyme solution. Purification was performed using an affinity nickel column (40X 12.6 mm, bio-Rad, USA) and after dialysis desalting, the target protein, ω -amine transaminase, was obtained. The amino acid sequence of the omega-amine aminotransferase is shown as SEQ ID NO.1, and has 457 amino acids total and a theoretical molecular weight of 49.7 kDa. SDS-PAGE electrophoresis is shown in FIG. 3.

Example 5: determination of omega-amine aminotransferase ata-Oc3 enzyme Activity, optimum temperature and optimum pH

The specific activity of omega-amine aminotransferase is measured, and the specific measurement method is as follows:

standard enzyme activity detection system (1 mL): 1.1 mL in 50mM Tris-HCl 9.0 containing 20 mM pyruvic acid, 30 mM isopropylamine, 0.1mM pyridoxal phosphate (PLP for short), incubating at 35℃for 10min, then adding an appropriate amount of pure enzyme solution, and reacting at 600 rpm for 10min at 50 ℃. Immediately after the completion of the reaction, the reaction mixture was taken out and placed on ice, 10. Mu.L of HCl having a concentration of 6M was added to terminate the reaction, and the reaction mixture was centrifuged (12000 rpm,1 min) to obtain a supernatant, and the concentration of the L-alanine product was measured.

Definition of enzyme activity unit (U): under the conditions of enzyme activity measurement, the amount of enzyme required for producing 1. Mu. Mol L-alanine per minute was measured.

Definition of specific activity: the number of units of enzyme activity per mg of protein was recorded as U/mg.

Alanine detection method: adopting a Siemens Fei U3000 liquid chromatograph equipped with a fluorescence detector, and a chromatographic column Unitary C18 column (4.6X250 mm, acchrom, china); the mobile phase is methanol: 50mM ammonium acetate (pH 5.7), volume ratio 30:70; the flow rate is 1.0 mL/min; detection wavelength ex=350 nm, em=460 nm; the sample injection amount is 10 mu L; column temperature was 35 ℃. The retention times of L-alanine and D-alanine were respectively: 13.5 minutes, 14.6 minutes.

Optimal reaction pH analysis of omega-amine aminotransferase ata-Oc3

The optimum reaction pH of the omega-amine aminotransferase ata-Oc3 of the present invention was determined in the range of 6.0 to 10. The reaction system (1 mL) was examined as follows: 50 The mM reaction buffer contained 20 mM pyruvic acid, 30 mM isopropylamine, 0.1mM PLP, incubated at 35℃for 10min, then added with an appropriate amount of pure enzyme solution, and reacted at 600 rpm for 10min at 35 ℃. Immediately after the completion of the reaction, the reaction mixture was taken out and placed on ice, 10. Mu.L of HCl having a concentration of 6M was added to terminate the reaction, and after the reaction mixture was centrifuged (12000 rpm,1 min), the supernatant was collected and the concentration of the product L-alanine was measured. The reaction buffers used for the assay were: sodium phosphate buffer (pH 6.0-8.0), tris-HCl buffer (pH 8.0-9.0), glycine-NaOH buffer (pH 9.0-10.0), wherein the pH is 8.0, and the pH is 9.0. The measurement results are shown in Table 1.

TABLE 1 determination of optimal reaction pH for omega-amine aminotransferase ata-Oc3

As can be seen from the above table, the ω -amine transaminases have higher activities in the pH range of 8.5-9.0, wherein the relative enzyme activities of ω -amine transaminases are highest in Tris-HCl buffer solution with pH9.

Optimal reaction temperature analysis of ω -amine transaminase ata-Oc3

The optimum reaction temperature of the ω -amine transaminase of the invention is determined in the range of 30-60 ℃. The reaction system (1 mL) was examined as follows: 50 The mM phosphate reaction buffer solution contains 20 mM pyruvic acid, 30 mM isopropylamine and 0.1mM PLP, is kept at constant temperature for 10min, and then is added with a proper amount of pure enzyme solution to react for 10min at different temperatures. Immediately after the completion of the reaction, the reaction mixture was taken out and placed on ice, 10. Mu.L of HCl having a concentration of 6M was added to terminate the reaction, and after the reaction mixture was centrifuged (12000 rpm,1 min), the supernatant was collected and the concentration of the product L-alanine was measured. The water bath reaction temperature was 30 ℃,35 ℃, 40 ℃, 45 ℃,50 ℃, 55 ℃, 60 ℃ respectively. The measurement results are shown in Table 2.

TABLE 2 determination of optimal reaction temperature for omega-amine aminotransferase ata-Oc3

As can be seen from the above table, the ω -amine transaminase has a higher activity in the range of 40-55deg.C, wherein the relative enzyme activity of ω -amine transaminase is highest at 50deg.C.

Under the standard enzyme activity condition, the specific activity of omega-amine aminotransferase ata-Oc3 is measured to be 9.74U/mg,e.e.the value is greater than 99%.

Example 6: thermal stability analysis of omega-amine aminotransferase ata-Oc3

The pure enzyme solution of omega-amine aminotransferase was diluted with 50mM Tris-HCl (pH 9.0) and split into 2 mLep tubes, which were then incubated at different temperatures. The temperature is set as follows: 35. preserving heat at the temperature of 4 h, 6 h, 10 h and 12 h respectively; 45. the temperature is kept at 2 h, 4 h, 6 h and 8 h respectively. Immediately after the incubation time is reached, the solution is taken out and placed on ice for use. And (3) carrying out a reaction under standard enzyme activity detection conditions, and calculating the relative enzyme activity by taking a pure enzyme solution which is not incubated as a control. The results are shown in tables 3 and 4.

TABLE 3 thermal stability of omega-amine aminotransferase ata-Oc3 at 35℃

TABLE 4 thermal stability of omega-amine aminotransferase ata-Oc3 at 45℃

From the above table, it was found that the heat stability of ω -amine transaminase ata-Oc3 was good.

Example 7: substrate tolerance analysis of omega-amine aminotransferase ata-Oc3

The tolerance of ω -amine transaminases to isopropylamine was determined. In the standard reaction system of 1 mL: the final concentration of pyruvic acid is controlled to be 20 mM, other conditions are unchanged, and the concentration of isopropylamine is changed as follows: 5 mM, 10 mM, 20 mM, 50mM, 100 mM, 150 mM, 200 mM, 300 mM, incubating at 35deg.C for 10min, adding appropriate amount of pure enzyme solution, and reacting at 35deg.C and 600 rpm for 10min. Immediately after the completion of the reaction, the reaction mixture was taken out and placed on ice, and 10. Mu.L of HCl having a concentration of 6M was added to terminate the reaction, and the reaction mixture was centrifuged (12000 rpm,1 min), and the supernatant was collected to measure the concentration of L-alanine, and the relative enzyme activity was calculated, and the results were shown in Table 5.

TABLE 5 tolerance of omega-amine aminotransferase at various concentrations of isopropylamine

From the above table, it is clear that the omega-amine aminotransferase ata-Oc3 of the present invention is highly tolerant under different concentrations of isopropylamine.

Example 8: conversion analysis of pyruvic acid by ω -amine transaminase ata-Oc3

Reaction one: 10 The reaction system of the mL contained 100 mM pyruvic acid, 100 mM isopropylamine, 0.1mM PLP and 50mM phosphate buffer, the pH of the reaction system was adjusted to 8.0 with NaOH, and 10 g/L of recombinant E.coli BL21 (DE 3)/pET 28a-ata-Oc3 wet cell was added. The reaction conditions are as follows: the temperature of the constant-temperature water bath kettle is set to be 35 ℃ and the rotating speed is set to be 600 rpm/min. The reaction was stopped by sampling every 2. 2 h samples (200. Mu.L), adding 5. Mu.L of 6. 6M hydrochloric acid, mixing, and centrifuging at 4℃and 12000 rpm/min for 1 min, and collecting the supernatant for later use. The conversion of L-alanine was detected by HPLC.

Reaction II: 10 The reaction system of the mL contained 500 mM pyruvic acid, 500 mM isopropylamine, 0.1mM PLP and 50mM phosphate buffer, the pH of the reaction system was adjusted to 8.0 with NaOH, and 50 g/L of recombinant E.coli BL21 (DE 3)/pET 28a-ata-Oc3 wet cell was added. The reaction conditions are as follows: the temperature of the constant-temperature water bath kettle is set to be 35 ℃ and the rotating speed is set to be 600 rpm/min. The reaction was stopped by sampling every 2. 2 h samples (200. Mu.L), adding 5. Mu.L of 6. 6M hydrochloric acid, mixing, and centrifuging at 4℃and 12000 rpm/min for 1 min, and collecting the supernatant for later use. The conversion of L-alanine was detected by HPLC. The results showed that the L-alanine yields in reaction one and reaction two were 29.07% and 81.13%, respectively.

Example 9: application of omega-amine aminotransferase ata-Oc3 in synthesis of L-glufosinate

10 The reaction system of the mL contained 15 mM PPO,50 mM pyruvic acid, 50mM isopropylamine, 0.1mM PLP and 50mM phosphate buffer, the pH of the reaction system was adjusted to 8.0 with NaOH, and 10 g/L of wet cells of recombinant E.coli BL21 (DE 3)/pET 28a-ata-Oc3 and E.coli BL21 (DE 3)/pET 28b-setA (patent CN 114921432A) were added, respectively. The water bath is at 35 ℃, the rotating speed of a magnetic stirrer is 600 rpm/min, the reaction time is 24 h, and the sampling time is 2 h, 4 h, 6 h, 8 h, 10 h, 12 h and 24 h; the reaction was terminated by adding 5. Mu.L of 6M hydrochloric acid to 200. Mu.L of each sample, and the supernatant was refrigerated at 4℃for 1 min after centrifugation at 12000 rpm. The target detection object is L-alanine or L-glufosinate. The detection method of the L-glufosinate comprises the following steps: adopting a Siemens Fei U3000 liquid chromatograph equipped with a fluorescence detector, and a chromatographic column Unitary C18 column (4.6X250 mm, acchrom, china); the mobile phase is methanol: 50mM ammonium acetate (pH 5.7), volume ratio 10:90; the flow rate is 1.0 mL/min; detection wavelength ex=350 nm, em=460 nm; the sample injection amount is 10 mu L; column temperature was 35 ℃. The retention time of the L-glufosinate and the D-glufosinate are respectively as follows: 10.6 minutes, 12.6 minutes.

The L-alanine and the L-glufosinate can be detected simultaneously in the reaction, which means that the L-alanine generated by the pyruvic acid and the isopropylamine under the catalysis of omega-amine transaminase can catalyze PPO to synthesize the L-glufosinate, and the reaction can remove the by-product pyruvic acid in the synthesis of the L-glufosinate. The reaction results are shown in Table 6.

TABLE 6 reaction progress of omega-amine transaminase to catalyze PPO to L-glufosinate with isopropylamine as indirect donor

Claims (9)

1. The omega-amine aminotransferase is characterized in that the amino acid sequence of the omega-amine aminotransferase is shown in SEQ ID No. 1.

2. The ω -amine transaminase according to claim 1, wherein the nucleotide sequence of the gene encoding ω -amine transaminase is set forth in SEQ ID No.2.

3. The ω -amine transaminase according to claim 1, wherein the nucleotide sequence of the gene encoding ω -amine transaminase is set forth in SEQ ID No. 3.

4. The recombinant expression plasmid is characterized by comprising a coding gene for omega-amine aminotransferase, and the nucleotide sequence of the coding gene is shown as SEQ ID NO.2 or SEQ ID NO. 3.

5. The recombinant expression plasmid according to claim 4, wherein the recombinant expression plasmid is obtained by inserting a coding gene into a pET-28a vector.

6. A recombinant genetically engineered bacterium comprising the recombinant expression plasmid of claim 4 or 5.

7. The recombinant genetically engineered bacterium of claim 6, wherein the recombinant engineered bacterium is obtained by transferring a recombinant expression plasmid into a host escherichia coli BL21 (DE 3) or escherichia coli Top 10.

8. A method for producing ω -amine transaminase, which is characterized in that the recombinant genetically engineered bacterium of claim 6 or 7 is fermented and cultured, and the cultured recombinant genetically engineered bacterium is separated and purified after breaking the wall, so as to obtain ω -amine transaminase.

9. Use of the ω -amine transaminase according to any one of claims 1 to 3 or the recombinant expression plasmid according to claim 4 or 5 or the recombinant genetically engineered bacterium according to claim 6 or 7 in an ammonia-transfer reaction.