CN117247915A - An ω-amine transaminase, recombinant bacteria and their applications - Google Patents

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to omega-amine transaminase, recombinant bacteria and application thereof. The amino acid sequence of the omega-amine aminotransferase is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO.2 or SEQ ID NO. 3. The recombinant strain is obtained by transferring recombinant expression plasmid containing coding genes for omega-amine transaminase into host escherichia coli and screening. The invention clones and identifies a novel omega-amine transaminase gene from human pallidobacter Ochrobactrum anthropic ZJB-061 for the first time, and proves that the omega-amine transaminase can improve the problem of the unfavorable equilibrium constant of the ammonia transfer reaction, and the enzyme has great potential to convert byproducts such as keto acid and the like to promote the reaction equilibrium in the similar reactions of preparing L-glufosinate by the ammonia transfer reaction with 2-carbonyl-4- [ hydroxy (methyl) phosphono ] butyric acid as a substrate.

Description

An omega-amine transaminase, recombinant bacteria and their applications

Technical field

The invention belongs to the field of bioengineering technology, and specifically relates to an ω-amine transaminase, recombinant bacteria and their applications.

Background technique

Glufosinate (PPT; chemical name: 2-amino-4-[hydroxy(methyl)phosphono]butyric acid) is the world's second most tolerant herbicide in genetically modified crops and can inhibit plant glutamine synthesis. enzymes to exert herbicidal effect. Glufosinate-ammonium, glyphosate and paraquat are also known as the world's three major herbicides. Paraquat has been discontinued due to its high toxicity. Glyphosate has also caused plant resistance due to long-term use, resulting in a gradual shrinking of the market. Glufosinate-ammonium is one of the three major herbicides in the world. It has the characteristics of broad biocidal properties, low toxicity and environmental friendliness, and has good market prospects.

Glufosinate-ammonium has two optical isomers, namely L-glufosinate-ammonium and D-glufosinate-ammonium. However, only L-glufosinate is phytotoxic. Its herbicidal activity is twice that of ordinary commercially available racemic DL-glufosinate. It is easily decomposed in the soil, is less toxic to humans and animals, and has a broad herbicidal spectrum. Less damaging to the environment. If glufosinate-ammonium products can be used in the form of L-type pure optical isomers, the usage of glufosinate-ammonium can be reduced by 50%, which is of great significance for improving atom economy, reducing use costs, and reducing environmental pressure.

There are currently three main methods for preparing optically pure L-glufosinate: chemical synthesis, chiral resolution, and biocatalysis.

The chemical synthesis method starts from chiral raw materials to synthesize optically pure L-glufosinate. This method has many process steps and low yield. Most of the asymmetric synthesis reagents used are expensive, resulting in high production costs and is not conducive to the large-scale preparation of L-glufosinate. Ammonium phosphine.

The chiral resolution method is to chemically synthesize racemic DL-glufosinate or its derivatives, and then use chiral resolution reagents to separate the D- and L-isomers to obtain optically pure L- Glufosinate ammonium. This process has technical problems such as low single-split yield and complex process.

In contrast, the biocatalytic method has the advantages of strict stereoselectivity, mild reaction conditions, high yield, and easy separation and purification of the product. It is a potentially advantageous method for producing L-glufosinate.

When studying the metabolic pathway of glufosinate in soil microorganisms, it has been found that L-glufosinate undergoes a transamination reaction and is decomposed into a 2-carbonyl-4-[hydroxy(methyl)phosphonoyl group under the action of transaminase ]Butyric acid (referred to as PPO). The transamination reaction is a reversible reaction, and PPO can generate L-glufosinate through the transamination reaction under the catalysis of transaminase. However, the shortcoming of the transamination reaction to generate L-glufosinate is the unfavorable equilibrium constant. Current research focuses on the removal and decomposition of by-products. Alanine is a typical amino donor, and the deamination product is pyruvate. It not only has strong inhibitory ability to enzymes, but is also one of the key factors limiting balance. Currently, enzymes commonly used to remove pyruvate include lactate dehydrogenase (LDH), alanine dehydrogenase (AlaDH), pyruvate decarboxylase (PDC), alcohol dehydrogenase (ADH), and coupled GDH or FDH et al.

Contents of the invention

In order to solve the above technical problems, the present invention provides an ω-amine transaminase, recombinant bacteria and their applications.

The present invention is realized through the following technical solutions:

The first object of the present invention is to provide an ω-amine transaminase, the amino acid sequence of which is shown in SEQ ID NO. 1.

The ω-amine transaminase gene of the present invention is derived from the existing strain of Ochrobactrum anthropic ZJB-061 (CN101063090A) patented. The specific depository unit is the China Typical Culture Collection Center, the address is Wuhan University, Wuhan, China, Postal Code 430072; the deposit date on April 14, 2006; the deposit number is CCTCC NO:M206039). After comparing the bacteria in NCBI, we selected the homologous strain Ochrobactrumanthropic (Genbank: CP022605.1) that is close to it and has been sequenced in its entire genome. As a reference, we analyzed all ω-amine transaminase genes in its genome, screened out the gene sequence with the highest homology to it, and designed cloning primers. We found that the cloned product was identical to the ω-aminase protein sequence derived from Ochrobactrumanthropi (WP_011982390.1). The similarity is only 69.52%, which verifies the function and application value of its ω-amine transaminase.

Preferably, the nucleotide sequence of the ω-amine transaminase encoding gene is shown in SEQ ID NO. 2.

Preferably, the nucleotide sequence of the ω-amine transaminase encoding gene is shown in SEQ ID NO. 3.

Since the soluble expression level of the ω-amine transaminase gene shown in SEQ ID NO. 2 is low, in order to improve the soluble expression efficiency, the present invention codon-coded the original sequence of the ω-amine transaminase gene according to the preference of the E. coli expression system. After optimization, the sequence shown in SEQ ID NO.3 was obtained.

The second object of the present invention is to provide a recombinant expression plasmid that contains a coding gene encoding ω-amine transaminase, and the nucleotide sequence of the coding gene is such as SEQ ID NO. 2 or SEQ ID NO. .3 shown.

Preferably, the recombinant expression plasmid is obtained by inserting the coding gene into the pET-28a vector.

The third object of the present invention is to provide a recombinant genetically engineered bacterium containing any of the above recombinant expression plasmids.

Preferably, the recombinant engineering bacterium is obtained by transforming the recombinant expression plasmid into the host E. coli BL21 (DE3) or E. coli Top10.

As a further preference, the recombinant engineering bacterium is obtained by transforming the recombinant expression plasmid into the host E. coli BL21 (DE3).

The fourth object of the present invention is to provide a method for producing ω-amine transaminase. The production method is as follows: fermenting and culturing any of the above recombinant genetically engineered bacteria, and breaking the cultured recombinant genetically engineered bacteria. Separate and purify to obtain ω-amine transaminase.

The fifth object of the present invention is to propose the use of the above-mentioned ω-amine transaminase, recombinant expression plasmid or recombinant genetically engineered bacteria in transamination reactions.

The transamination reaction in the present invention refers to a reaction that catalyzes the transfer of the amino group on the amino donor (amino acid or amine) to the prochiral acceptor aldehyde, ketone or keto acid. The transamination reaction can be specifically used for kinetic resolution preparation or asymmetric synthesis to prepare unnatural amino acids, for preparing aliphatic and aromatic unnatural amino acids, or for preparing chiral amines and chiral amino acids.

As a further preference, the present invention also proposes the application of the above-mentioned ω-amine transaminase, recombinant expression plasmid or recombinant genetically engineered bacteria in the synthesis of L-glufosinate through a transamination reaction.

ω-Amine transaminase can efficiently convert pyruvate and can be used to catalyze pyruvate to assist in the production of L-alanine, and L-alanine is based on 2-carbonyl-4-[hydroxy(methyl)phosphono]butanol Acid is a commonly used amino donor for preparing L-glufosinate in the substrate transamination reaction, and pyruvate is generated after the reaction. Therefore, the ω-amine transaminase of the present invention can improve the conversion of 2-carbonyl-4-[hydroxy(methyl)phosphine In the process of preparing L-glufosinate through a transamination reaction using acyl]butyric acid as a substrate, the by-product pyruvate has a positive inhibitory effect on the transamination reaction and alleviates the problem of unfavorable equilibrium constants in the transamination reaction.

Compared with the prior art, the present invention has the following beneficial effects:

The present invention clones and identifies a new type of ω-amine transaminase gene from Ochrobactrum anthropic ZJB-061 for the first time. After verification, it is found that the ω-amine transaminase can improve the unfavorable equilibrium constant problem of the transamination reaction. -4-[Hydroxy(methyl)phosphono]butyric acid is used as the substrate for transamination to prepare L-glufosinate and other similar reversible ammonia reactions. This enzyme has great potential to convert keto acids and other by-products to promote reaction balance.

The remaining beneficial effects will be explained in the examples.

sequence description

SEQ ID NO.1 is the amino acid sequence of ω-amine transaminase ata-Oc3;

SEQ ID NO.2 is the nucleotide sequence of ω-amine transaminase ata-Oc;

SEQ ID NO.3 is the nucleotide sequence of the optimized ω-amine transaminase ata-Oc3;

SEQ ID NO.4 is the forward primer ata-OcF of the cloned gene in Ochrobactrum anthropic ZJB-061;

SEQ ID NO.5 is the reverse primer ata-OcR of the cloned gene in Ochrobactrum anthropic ZJB-061.

Description of drawings

The following is a brief introduction to the attached drawings:

Figure 1 is a schematic diagram of the ω-amine transaminase catalyzed reaction;

Figure 2 shows the gel electrophoresis pattern of ω-amine transaminase: lane M is the nucleic acid molecular weight marker, lane 1 is ω-amine transaminase pET28a-ata-Oc, and lane 2 is ω-amine transaminase ata-Oc;

Figure 3 is the SDS-PAGE image of ω-amine transaminase: lane M is the protein molecular weight marker, lane 1 is the supernatant of cells disrupted by ω-amine transaminase, and lane 2 is the pellet of cells disrupted by ω-amine transaminase;

Figure 4 is a schematic diagram of the reaction catalyzed by ω-amine transaminase to synthesize L-alanine;

Figure 5 is a schematic diagram of the reaction catalyzed by ω-amine transaminase to synthesize L-glufosinate.

Detailed ways

The present invention will be further described below with reference to the accompanying drawings and specific embodiments. A person of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention mentioned in the following description are generally only some embodiments of the present invention, rather than all the embodiments. Therefore, based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts should fall within the scope of protection of the present invention.

Example 1: Obtainment of ω-amine transaminase gene ata-Oc

The ω-amine transaminase gene of the present invention is derived from Ochrobactrum anthropic ZJB-061. After 16S rDNA sequencing, homology alignment based on blastn in NCBI found that it has the highest sequence consistency with Ochrobactrum anthropic. All transaminase enzymes in Ochrobactrumanthropic (Genbank: CP022605.1), which has been sequenced in its entirety, were analyzed and the ω-aminase gene sequence with the highest homology was screened and cloned primers were designed. The cloned product was found to be closely related to Ochrobactrum anthropi. The similarity of the ω-aminase protein sequence (5GHF) derived from (WP_011982390.1) is 69.52%, and its ω-aminase function and application value are verified.

First, a DNA fast extraction kit (FastDNA™ SPIN, MP) was used to extract the genomic DNA of Ochrobactrumanthropic ZJB-061, and specific primers were designed based on the ω-aminase gene sequence.

After PCR was performed using the genomic DNA of Ochrobactrum anthropic ZJB-061 as the template and ata-OcF and ata-OcR as primers, a 1374 bp product fragment was obtained. The product was sequenced and compared in the NCBI library, and it was found that it was closely related to the genus Ochrobacterium The similarity of the ω-aminase protein sequence 5GHF derived from Ochrobactrum anthropi is 69.52%.

Among them, the primers ata-OcF (sequence shown in SEQ ID NO. 4) and ata-OcR (sequence shown in SEQ ID NO. 5) were designed, and PCR was used to construct the DNA coding frame 5' of Ochrobactrum anthropic ZJB-061 ω-aminase. NcoI and XhoI restriction enzyme sites are introduced on both sides of and 3' respectively. There are protective bases before the restriction site and effective sequences after the restriction site;

ata-OcF:5'ATCCATGGATGACGAGACAGCCCAATTC3'

ata-OcR:5'TACTCGAGTTAAGAGCGACCGATTGCGGTC3'

Using the above isolated Ochrobactrum anthropic ZJB-061 genomic DNA as a template, PCR amplification was performed using the primers designed above to obtain the ω-amine transaminase gene ata-Oc.

The 50 μL PCR reaction system consists of: 25 μL 10×DNA Polymerase Buffer, 2 μL 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP), 1 μL DNA Polymerase, 1 μL 10 μM ata-OcF, 1 μL 10 μM ata-OcR, 1 μL template DNA, 19 μL dd H ₂ O. The reaction conditions of PCR were: 95°C, 5 min pre-denaturation; 95°C, 30 s, denaturation; 60°C, 30 s, annealing; 72°C, 1 min, extension, and 30 cycles from the second to the fourth step; 72°C, 5 min, 16°C, complete extension.

Use gel electrophoresis to detect the PCR amplification product and obtain a DNA fragment with a size of 1374 bp (see Figure 2 for details). Use the DNA recovery and purification kit (AxyPrep PCR Cleanup Kit) to purify and recover the PCR product. For specific steps, refer to the purification kit. manual. PCR products were size verified by agarose gel electrophoresis and purified by gel recovery. For specific steps, follow the instructions of the Trelief® DNA Gel Extraction Kit to recover the target gene fragment.

Example 2: Construction of recombinant plasmid containing ω-amine transaminase gene ata-Oc

The recombinant plasmid containing the ω-amine transaminase gene ata-Oc of the present invention is constructed by connecting the ω-amine transaminase gene ata-Oc with the optional plasmid pET-28a (expression vector). The recovered target gene fragment and pET-28a plasmid were double-digested using NcoI and XhoI restriction endonucleases (TaKaRa) at 37°C; the digested fragments were recovered and digested using T4 DNA ligase (TaKaRa). Ligation was performed overnight at 16°C to obtain the ligation product. Add 10 μL of the ligation product to the competent cells DH5α, place on ice for 30 min, heat shock at 42°C for 60 s and immediately place on ice. After leaving for 5 min, add 600 μL of LB medium without antibiotics, and incubate at 37°C. Incubate on a shaking table for 1 hour, spread the transformed bacterial solution on an LB (Amp) blue and white plate, and culture at 37°C overnight. Pick multiple colonies on the plate for PCR identification.

Plasmid extraction: Use the Trelief® Plasmid Mini Kit plasmid extraction kit to extract the clone plasmids identified as positive by colony PCR, and obtain the nucleic acid sequence of the ω-amine transaminase protein encoding gene of Ochibacterium hominis through nucleic acid sequencing. The amino acid sequence and nucleotide sequence of this protein are shown in SEQ ID NO.1 and SEQ ID NO.2.

According to the preference of E. coli protein expression, the obtained gene sequence was selectively modified. The codon-optimized ω-amine transaminase gene ata-Oc was named ata-Oc3, and its gene sequence is shown in SEQ ID NO.3 , the optimized sequence was synthesized by a biological company.

Example 3: Construction and cultivation of recombinant genetically engineered strains containing ω-amine transaminase gene ata-Oc3

The recombinant plasmid pET28a-ata-Oc3 obtained according to the method of Example 2 was transferred into E. coli BL21 (DE3) competent cells (Beijing Qingke Biotechnology Co., Ltd.), and evenly spread on the kanamycin-resistant plate, 37 Incubate at ℃ for 16 hours upside down, pick a single colony and verify that the positive clone is the recombinant genetically engineered strain E.coli BL21(DE3)/pET28a-ata-Oc3. Pick a positive single colony and inoculate it into 10 mL LB liquid medium containing 50 μg/mL kanamycin, and culture it at 37°C and 200 rpm for 12 h to obtain the seed liquid. Transfer the seed solution into 100 mL of fresh culture medium according to the inoculum amount of 1%, and culture with shaking at 37°C and 180 rpm until OD ₆₀₀ = 0.4-0.6. Add 0.1% IPTG with a concentration of 100 mM for induction, and incubate at 28°C. , cultured at 180 rpm to induce expression for 12 h and then collected the cells.

Example 4: Expression and purification of omega-amine transaminase protein

The collected bacterial cells were washed once with physiological saline (NaCl) with a mass fraction of 0.85%, centrifuged at 4°C and 8000 rpm/min for 10 min, and the bacterial cells were collected again. The collected bacterial cells were resuspended in 20 mM PB phosphate buffer (pH 8.0) containing 0.1 mM PLP, and ultrasonic disrupted in a low-temperature ice bath (40 W, lasting for 2 s, with an interval of 4 s, and continuously disrupted for 40 min. ), centrifuge the broken cell solution at 12,000 rpm for 10 minutes, and the supernatant is the crude enzyme solution of the engineering bacteria. An affinity nickel column (40×12.6 mm, Bio-Rad, USA) was used for purification, and after dialysis and desalting, the target protein, namely ω-amine transaminase, was obtained. The amino acid sequence of the ω-amine transaminase is shown in SEQ ID NO. 1, with a total of 457 amino acids, and its theoretical molecular weight is 49.7 kDa. The SDS-PAGE electrophoresis pattern is shown in Figure 3.

Example 5: Determination of ω-amine transaminase ata-Oc3 enzyme activity, optimal temperature and optimal pH

Determine the enzyme activity and specific activity of ω-amine transaminase. The specific measurement methods are as follows:

Standard enzyme activity detection system (1 mL): 1 mL of 50 mM Tris-HCl 9.0 contains 20 mM pyruvate, 30mM isopropylamine, and 0.1 mM pyridoxal phosphate (PLP), incubated at 35°C for 10 min, and then Add an appropriate amount of pure enzyme solution and react at 50°C and 600 rpm for 10 minutes. Immediately after the reaction, take out the reaction solution and place it on ice. Add 10 μL of HCl with a concentration of 6 M to terminate the reaction. The reaction solution is centrifuged (12000 rpm, 1 min), and the supernatant is taken to detect the concentration of product L-alanine.

Enzyme activity unit (U) definition: The amount of enzyme required to generate 1 μmol L-alanine per minute under enzyme activity measurement conditions.

Specific activity definition: The number of enzyme activity units per milligram of protein, recorded as U/mg.

Alanine detection method: Use a Thermo Fisher U3000 liquid chromatograph equipped with a fluorescence detector, a Unitary® C18 column (4.6×250mm, Acchrom, China); the mobile phase is methanol: 50 mM ammonium acetate (pH 5.7 ), the volume ratio is 30:70; the flow rate is 1.0 mL/min; the detection wavelength Ex=350 nm, Em=460 nm; the injection volume is 10 μL; the column temperature is 35°C. The retention times of L-alanine and D-alanine are: 13.5 minutes and 14.6 minutes respectively.

Analysis of optimal reaction pH value of ω-amine transaminase ata-Oc3

The optimal reaction pH of the ω-amine transaminase ata-Oc3 of the present invention is measured in the range of 6.0-10. The reaction system (1 mL) tested is: 50 mM reaction buffer containing 20 mM pyruvate, 30 mM isopropylamine, and 0.1 mM PLP. Incubate at 35°C for 10 min. Then add an appropriate amount of pure enzyme solution and incubate at 35°C. React at 600 rpm for 10 minutes. Immediately after the reaction, the reaction solution was taken out and placed on ice. 10 μL of HCl with a concentration of 6 M was added to terminate the reaction. After the reaction solution was centrifuged (12000 rpm, 1 min), the supernatant was taken to detect the concentration of the product L-alanine. The reaction buffers used in the measurement are: sodium phosphate buffer (pH6.0-8.0), Tris-HCl buffer (pH 8.0-9.0), glycine-NaOH buffer (pH9.0-10.0), of which the pH is 8.0 When the pH is 9.0, it is sodium phosphate buffer, and when the pH is 9.0, it is Tris-HCl buffer. The measurement results are shown in Table 1.

Table 1. Determination of optimum reaction pH of ω-amine transaminase ata-Oc3

By observing the above table, we can see that ω-amine transaminase has high activity in the pH range of 8.5-9.0. Among them, the relative enzyme activity of ω-amine transaminase in the Tris-HCl buffer solution with pH 9. is the highest.

Analysis of the optimal reaction temperature of ω-amine transaminase ata-Oc3

The optimal reaction temperature of the ω-amine transaminase of the present invention is measured in the range of 30-60°C. The reaction system (1 mL) tested is: 50 mM phosphate reaction buffer, containing 20 mM pyruvate, 30 mM isopropylamine, and 0.1 mM PLP. Incubate at constant temperature for 10 min. Then add an appropriate amount of pure enzyme solution and mix at different times. React at room temperature for 10 minutes. Immediately after the reaction, take out the reaction solution and place it on ice. Add 10 μL of HCl with a concentration of 6 M to terminate the reaction. After the reaction solution is centrifuged (12000 rpm, 1 min), take the supernatant to detect the concentration of the product L-alanine. The water bath reaction temperatures were 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, and 60 ℃ respectively. The measurement results are shown in Table 2.

Table 2. Determination of optimal reaction temperature of ω-amine transaminase ata-Oc3

By observing the above table, we can see that ω-amine transaminase has high activity in the range of 40-55 ℃, and the relative enzyme activity of ω-amine transaminase is the highest at 50 ℃.

Under standard enzyme activity conditions, the specific activity of ω-amine transaminase ata-Oc3 was determined to be 9.74 U/mg, and the ee value was greater than 99%.

Example 6: Thermal stability analysis of ω-amine transaminase ata-Oc3

Dilute the pure enzyme solution of ω-amine transaminase with 50 mM Tris-HCl (pH 9.0), distribute it into 2 mLep tubes, and then incubate it at different temperatures. The temperature settings were: 4 h, 6 h, 10 h, and 12 h at 35 °C; 2 h, 4 h, 6 h, and 8 h at 45 °C. After the holding time is up, take it out immediately and place it on ice until use. Carry out the reaction under standard enzyme activity detection conditions, add pure enzyme solution without incubation as a control, and calculate the relative enzyme activity. The results are shown in Table 3 and Table 4 respectively.

Table 3. Thermal stability of ω-amine transaminase ata-Oc3 at 35 ℃

Table 4. Thermal stability of ω-amine transaminase ata-Oc3 at 45 ℃

From the above table, it can be seen that ω-amine transaminase ata-Oc3 has good thermal stability.

Example 7: Substrate tolerance analysis of omega-amine transaminase ata-Oc3

Determination of the tolerance of omega-amine transaminase to isopropylamine. In the 1 mL standard reaction system: control the final concentration of pyruvate to 20 mM, keep other conditions unchanged, and change the concentration of isopropylamine to: 5 mM, 10 mM, 20 mM, 50 mM, 100 mM, 150mM, 200 mM, 300 mM, incubate at 35°C for 10 minutes, add an appropriate amount of pure enzyme solution, and react at 35°C and 600 rpm for 10 minutes. Immediately after the reaction, take out the reaction solution and place it on ice. Add 10 μL of HCl with a concentration of 6 M to terminate the reaction. The reaction solution is centrifuged (12000 rpm, 1 min). The supernatant is taken to detect the concentration of product L-alanine and calculate the relative concentration. Enzyme activity, the results are shown in Table 5.

Table 5. Tolerance of ω-amine transaminase under different concentrations of isopropylamine

It can be seen from the above table that the ω-amine transaminase ata-Oc3 of the present invention has high tolerance under the reaction conditions of different concentrations of isopropylamine.

Example 8: Analysis of the conversion of pyruvate by ω-amine transaminase ata-Oc3

Reaction 1: The 10 mL reaction system contains 100 mM pyruvate, 100 mM isopropylamine, 0.1mM PLP and 50mM phosphate buffer. Use NaOH to adjust the pH of the reaction system to 8.0, and add 10 g/L recombinant E. coli E. .coliBL21(DE3)/pET28a-ata-Oc3 wet thalli. The reaction conditions are: set the temperature of the constant temperature water bath to 35°C and the rotation speed to 600 rpm/min. Sample (200 μL) of the reaction was taken every 2 h, add 5 μL of 6 M hydrochloric acid and mix well to terminate the reaction, centrifuge at 4°C, 12000 rpm/min for 1 min, and take the supernatant for later use. The conversion of L-alanine was detected by HPLC.

Reaction 2: The 10 mL reaction system contains 500 mM pyruvate, 500 mM isopropylamine, 0.1 mM PLP and 50 mM phosphate buffer. Use NaOH to adjust the pH of the reaction system to 8.0, and add 50 g/L recombinant E. coli E.coliBL21(DE3)/pET28a-ata-Oc3 wet thalli. The reaction conditions are: set the temperature of the constant temperature water bath to 35°C and the rotation speed to 600 rpm/min. A sample (200 μL) of the reaction was taken every 2 hours, and 5 μL of 6 M hydrochloric acid was added and mixed to terminate the reaction. Centrifuge at 4°C, 12000 rpm/min for 1 min, and the supernatant was taken for later use. The conversion of L-alanine was detected by HPLC. The results showed that the yields of L-alanine in reaction one and reaction two were 29.07% and 81.13% respectively.

Example 9: Application of ω-amine transaminase ata-Oc3 in the synthesis of L-glufosinate-ammonium

The 10 mL reaction system contains 15 mM PPO, 50 mM pyruvate, 50 mM isopropylamine, 0.1 mM PLP and 50mM phosphate buffer. Use NaOH to adjust the pH of the reaction system to 8.0, and add 10 g/L recombinant large intestine respectively. Bacillus E.coliBL21(DE3)/pET28a-ata-Oc3 and E.coliBL21(DE3)/pET28b-seTA (Patent CN 114921432 A) wet cells. The water bath is 35 ℃, the magnetic stirrer speed is 600 rpm/min, the reaction time is 24 h, and the sampling time is set to 2 h, 4h, 6 h, 8 h, 10 h, 12 h, and 24 h; each sampling volume is 200 μL. Add 5 μL of 6 M hydrochloric acid to terminate the reaction, centrifuge at 12000 rpm/min for 1 min at 4°C, and then take the supernatant and refrigerate at 4°C for later use. The target detection substances are L-alanine and L-glufosinate. L-glufosinate detection method: Use a Thermo Fisher U3000 liquid chromatograph equipped with a fluorescence detector, a Unitary® C18 column (4.6×250mm, Acchrom, China); the mobile phase is methanol: 50 mM ammonium acetate (pH 5.7), the volume ratio is 10:90; the flow rate is 1.0 mL/min; the detection wavelength Ex=350 nm, Em=460 nm; the injection volume is 10 μL; the column temperature is 35 °C. The retention times of L-glufosinate-ammonium and D-glufosinate-ammonium are: 10.6 minutes and 12.6 minutes respectively.

L-alanine and L-glufosinate can be detected simultaneously in the reaction, which means that L-alanine produced by pyruvate and isopropylamine under the catalysis of omega-amine transaminase can catalyze the synthesis of L-glufosinate from PPO. In addition This reaction can also remove pyruvate, a by-product in the synthesis of L-glufosinate. The reaction results are shown in Table 6.

Table 6. The reaction process of ω-amine transaminase to catalyze the synthesis of L-glufosinate from PPO using isopropylamine as an indirect donor.

Claims (9)

1. An ω-amine transaminase, characterized in that the amino acid sequence of the ω-amine transaminase is shown in SEQ ID NO.1. 2. The ω-amine transaminase according to claim 1, characterized in that the nucleotide sequence of the ω-amine transaminase encoding gene is shown in SEQ ID NO. 2. 3. The ω-amine transaminase according to claim 1, characterized in that the nucleotide sequence of the ω-amine transaminase encoding gene is shown in SEQ ID NO. 3. 4. A recombinant expression plasmid, characterized in that the recombinant expression plasmid contains a coding gene encoding ω-amine transaminase, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO.2 or SEQ ID NO.3 Show. 5. The recombinant expression plasmid according to claim 4, characterized in that the recombinant expression plasmid is obtained by inserting the coding gene into the pET-28a vector. 6. A recombinant genetically engineered bacterium, characterized in that it contains the recombinant expression plasmid according to claim 4 or 5. 7. The recombinant genetically engineered bacterium according to claim 6, characterized in that the recombinantly engineered bacterium is obtained by transferring the recombinant expression plasmid into the host E. coli BL21 (DE3) or E. coli Top10. 8. A method for producing ω-amine transaminase, which is characterized in that the recombinant genetically engineered bacteria according to claim 6 or 7 are fermented and cultured, and the cultured recombinant genetically engineered bacteria are separated and purified after wall breaking to obtain ω. -Amine transaminase. 9. The ω-amine transaminase of any one of claims 1 to 3 or the recombinant expression plasmid of claim 4 or 5 or the recombinant genetically engineered bacterium of claim 6 or 7 is used in a transamination reaction.