CN116200340B - Aftetinib-resistant human lung adenocarcinoma cell line PC9-AR and application thereof - Google Patents
Aftetinib-resistant human lung adenocarcinoma cell line PC9-AR and application thereof Download PDFInfo
- Publication number
- CN116200340B CN116200340B CN202211729783.8A CN202211729783A CN116200340B CN 116200340 B CN116200340 B CN 116200340B CN 202211729783 A CN202211729783 A CN 202211729783A CN 116200340 B CN116200340 B CN 116200340B
- Authority
- CN
- China
- Prior art keywords
- resistant
- drug
- cell
- ametinib
- cell line
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0693—Tumour cells; Cancer cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2503/00—Use of cells in diagnostics
- C12N2503/02—Drug screening
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
Abstract
The invention belongs to the technical field of medical biology, and particularly discloses an African-resistant human lung adenocarcinoma cell line PC9-AR with a preservation number of CCTCC NO: C2022220. The PC9-AR resistant cell strain can stably grow and passaged in a culture system with the action concentration of 1umol/L of the amotinib, the drug Resistance Index (RI) of the amotinib is 1094.2, and the PC9-AR cell strain has 19 exon deletion mutation, KRAS amplification and no C797S mutation; therefore, the anti-ametinib human lung adenocarcinoma cell strain PC9-AR constructed by the invention provides a drug-resistant cell model for researching the morphological and biological characteristics of the ametinib drug-resistant human non-small cell lung cancer cells, the research and analysis of the drug-resistant mechanism of the non-small cell lung cancer to the ametinib, the analysis of the drug-resistant related signal path of the non-small cell lung cancer, the sensitivity analysis of anti-tumor drugs, the preparation of anti-tumor drugs, the screening of tumor drug resistance reversal drugs, the research of more effective tumor treatment methods and the like, and has higher scientific research and production application values.
Description
Technical Field
The invention belongs to the technical field of biological medicine. In particular to an ametinib-resistant human lung adenocarcinoma cell line PC9-AR and application thereof.
Background
Lung cancer is one of the most common malignant tumors worldwide and is also the leading cause of cancer-related death. Lung cancer is classified according to its pathological type into non-small cell lung cancer (non-small cell lung cancer, NSCLC) and small cell lung cancer (small cell lung cancer, SCLC). The development of molecular pathology detection technology and the application of targeted therapy obviously improve the life cycle and the life quality of lung cancer patients. Among them, EGFR-TKIs treatment is remarkable in NSCLC patients with EGFR activating mutations, but the generation of unavoidable drug resistance limits its application.
The T790M mutation is the primary drug resistance mechanism for the treatment of both the first and second generation EGFR-TKI, and about 60% of patients develop this mutation. The threonine residue 790 of the EGFR receptor is located at the entrance of the hydrophobic pocket at the rear of the ATP binding cleft and is critical for the specific binding of tyrosine kinase inhibitors (tyrosine kinase inhibitors, TKIs), whereas the T790M mutation results in the substitution of threonine by methionine, causing steric hindrance effects interfering with the binding of TKIs. Meanwhile, the T790M mutation resulted in an increase in the affinity of the mutant for ATP. The third generation EGFR-TKIs are selective and irreversible tyrosine kinase inhibitors developed for EGFR-sensitive mutations and T790M mutations. Ametinib is a novel, irreversible, highly selective, third generation EGFR-TKI with inhibitory effect on EGFR-sensitive mutations and T790M mutations. Meanwhile, ametinib has been approved domestically for first line treatment in locally advanced or metastatic NSCLC adult patients with EGFR 19 exon deletion or 21 exon L858R mutation. However, the drug resistance mechanism of the ametinib for the first-line treatment is not completely known, and no report on the drug resistance mechanism of the ametinib is currently available at home and abroad.
Disclosure of Invention
Aiming at the problems and the defects existing in the prior art, the invention aims to provide an ametinib-resistant human lung adenocarcinoma cell line PC9-AR and application thereof.
In order to achieve the aim of the invention, the technical scheme adopted by the invention is as follows:
the first aspect of the invention provides an ametinib-resistant human lung adenocarcinoma cell line PC9-AR, named ametinib-resistant human lung adenocarcinoma cell line PC9-AR; the African-resistant human lung adenocarcinoma cell line PC9-AR is preserved in China Center for Type Culture Collection (CCTCC), the preservation date is 2022, 9 months and 7 days, the preservation number is CCTCC NO: C2022220, and the preservation address is the university of Wuhan in the eight path 299 of Wuhan district of Wuhan, hubei province.
The anti-ametinib human lung adenocarcinoma cell line PC9-AR is prepared by adopting an in vitro concentration gradient increasing method, namely by gradually increasing the concentration of an ametinib drug, continuously acting on the PC9 cell line with EGFR 19 exon deletion, and inducing to establish the human lung adenocarcinoma drug-resistant cell line. The concrete construction method comprises the following steps:
(1) Human lung adenocarcinoma cell line PC9 (stock of this laboratory) with EGFR 19 exon deletion was placed in RPMI1640 medium containing 10% fetal bovine serum at 37℃and 5% CO 2 Culturing in a saturated humidity incubator, and digesting and passaging by using trypsin digestion liquid (0.25% Trypsin-EDTA);
(2) At 1X 10 6 Cell concentration/mL PC9 was inoculated into a 60mm dish, after 24 hours adherence, complete medium containing 5nmol/L of Ameitinib was added, and the mixture was placed at 37℃with 5% CO 2 Culturing in a saturated humidity incubator; the method comprises the steps of replacing a culture medium containing the amotinib every 2-3 days (the concentration of the amotinib in the culture medium is unchanged), multiplying the concentration of the amotinib in the culture medium on the basis after the cells bear the concentration of the amotinib and can stably grow, and continuously repeating the steps until the PC9-AR can stably grow and passaged in the culture medium containing 1umol/L of the amotinib, so that the amotinib-resistant human lung adenocarcinoma cell strain PC9-AR is obtained.
The anti-ametinib human lung adenocarcinoma cell strain PC9-AR constructed by the invention can stably grow and pass through a culture system with the action concentration of 1umol/L of ametinib, has the drug Resistance Index (RI) of 1094.2 for the ametinib, and provides a drug resistance cell model for researching the morphological and biological characteristics of the ametinib resistant human non-small cell lung cancer cells, the drug resistance mechanism of the non-small cell lung cancer to the ametinib, the research analysis of the drug resistance related signal path of the non-small cell lung cancer, the anti-tumor drug sensitivity analysis, the preparation of the anti-tumor drug, the screening of tumor drug resistance reversal drugs, the research of more effective tumor treatment methods and the like, thereby having higher scientific research and production application values.
The second aspect of the invention provides application of an ametinib-resistant human lung adenocarcinoma cell line PC9-AR in screening medicaments for reversing tumor resistance.
The third aspect of the invention provides application of an ametinib-resistant human lung adenocarcinoma cell line PC9-AR in preparing an antitumor drug.
The fourth aspect of the invention provides application of an ametinib-resistant human lung adenocarcinoma cell line PC9-AR in constructing an in vitro tumor drug-resistant cell model.
According to the above application, preferably, the tumor is lung cancer. More preferably, the lung cancer is non-small cell cancer. Most preferably, the lung cancer is lung adenocarcinoma.
Compared with the prior art, the invention has the following beneficial technical effects:
the anti-ametinib human lung adenocarcinoma cell strain PC9-AR constructed by the invention can stably grow and passaged in a culture system with the action concentration of 1umol/L ametinib, the drug Resistance Index (RI) of the anti-ametinib is 1094.2, and the PC9-AR cell strain has 19 exon deletion mutation, KRAS amplification and no C797S mutation; therefore, the anti-ametinib human lung adenocarcinoma cell strain PC9-AR constructed by the invention provides a drug-resistant cell model for researching the morphological and biological characteristics of the anti-ametinib human non-small cell lung cancer cells, the drug-resistant mechanism of the non-small cell lung cancer to the ametinib, the research and analysis of the non-small cell lung cancer drug-resistant related signal path, the anti-tumor drug sensitivity analysis, the preparation of the anti-tumor drug, the screening of tumor drug resistance reversal drugs, the research of more effective tumor treatment methods and the like, has higher scientific research and production application values, and is expected to generate good scientific research, economic and social benefits.
Drawings
FIG. 1 is a diagram showing the morphological observation result of the PC9-AR and PC9 cell of the parent cell strain of the African drug resistant cell strain of the present invention;
FIG. 2 shows the results of the viability test of the African drug resistant cell line PC9-AR and the parent cell line PC9 of the present invention under the action of different concentrations of African;
FIG. 3 shows the proliferation potency detection result of the Ameitinib-resistant cell strain PC9-AR and the parent cell strain PC9 of the invention; wherein A represents the difference of proliferation capacities of the SRB cell proliferation experiment detection PC9 and the drug-resistant cell strain PC9-AR of the amotinib; b represents a plate cloning experiment to detect the difference of the proliferation capacities of PC9 and an Ameitinib-resistant cell strain PC9-AR;
FIG. 4 shows the results of the detection of invasion and migration capacity of an Ameitinib-resistant cell line PC9-AR and a parent cell line PC9 Transwell of the invention;
FIG. 5 shows Western blot experiment results of EGFR and its downstream protein expression in an African drug-resistant cell line PC9-AR and a parent cell line PC9 of the present invention;
FIG. 6 shows the results of fluorescence quantitative PCR detection of KRAS gene of the African drug-resistant cell strain PC9-AR and the parent cell strain PC9 of the present invention;
FIG. 7 is a graph showing the results of KRAS gene copy number detection in an African drug resistant cell line PC9-AR and a parent cell line PC9 of the present invention.
Detailed Description
The following detailed description is exemplary and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, components, and/or combinations thereof.
The experimental methods in the following examples, in which specific conditions are not specified, are all conventional in the art or according to the conditions suggested by the manufacturer; the reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
In order to enable those skilled in the art to more clearly understand the technical scheme of the present invention, the technical scheme of the present invention will be described in detail with reference to specific embodiments.
Example 1: construction of African-resistant human lung adenocarcinoma cell line PC9-AR
The anti-ametinib human lung adenocarcinoma cell line PC9-AR is prepared by adopting an in vitro concentration gradient increasing method, namely by gradually increasing the concentration of an ametinib drug, continuously acting on the PC9 cell line with EGFR 19 exon deletion, and inducing to establish the human lung adenocarcinoma drug-resistant cell line. The concrete construction method comprises the following steps:
(1) Human lung adenocarcinoma cell line PC9 cell line (stock of the laboratory) with EGFR 19 exon deletion was placed in RPMI1640 medium containing 10% fetal bovine serum at 37℃and 5% CO 2 Culturing in a saturated humidity incubator, and digesting and passaging by using trypsin digestion liquid (0.25% Trypsin-EDTA);
(2) Taking PC9 cells in logarithmic growth phase or when PC9 cells grow to 50-60%, discarding old culture medium, adding complete culture medium containing Acetinib, wherein the concentration of Acetinib is 10nmol/L, and placing cells at 37deg.C and 5% CO 2 Culturing in a saturated humidity incubator; the medium containing almitinib was changed every 2-3 days (the concentration of almitinib in the medium was unchanged). And when the cell density grows to 80-90%, digesting the cells, carrying out passage according to the proportion of 1:3, placing the cells in a newly prepared complete culture medium containing the amotinib with the original concentration for continuous culture after the cells are attached to the wall, and replacing the culture medium once for 2-3 days. Thirdly, when the cell density grows to 80-90%, digesting the cells, carrying out passage according to the ratio of 1:3, and placing the cells in a complete culture medium with the concentration of 20nmol/L for continuous culture after the cells are attached to the wallCulturing; and replacing the culture medium once in 2-3 days, digesting the cells when the cell density grows to 80-90%, carrying out passage according to the ratio of 1:3, and placing the cells in a complete culture medium with the concentration of 20nmol/L of the amotinib for continuous culture. The concentration of amotinib in the medium was increased in this order: 10 nmol/L-20 nmol/L-50 nmol/L-100 nmol/L-200 nmol/L-300
Culturing is carried out under the conditions of nmol/L-400 nmol/L-500 nmol/L-600 nmol/L-800 nmol/L-1000 nmol/L. Each drug concentration is passaged for at least 2 times until cells can stably grow in a culture medium containing 1000nmol/L of the amotinib, and the amotinib-resistant human lung adenocarcinoma cell strain PC9-AR can be obtained. The cell strain is preserved in China Center for Type Culture Collection (CCTCC) in 9 months and 7 days in 2022, the preservation number is CCTCC NO: C2022220, and the preservation address is eight-path 299 university of Wuhan in Wuhan City of Hubei province.
Example 2: cryopreservation and resuscitation of African-resistant human lung adenocarcinoma cell line PC9-AR
Freezing: the drug-resistant cells obtained in example 1 were placed in serum-free frozen stock solution of the frozen stock tube, and the frozen stock tube was stored in liquid nitrogen. Serum-free frozen stock solutions were purchased from new siramese biotechnology limited, new siramese, su. Freezing at-80 deg.C overnight, and storing in liquid nitrogen.
Resuscitating: the frozen tube containing the cells was removed from the liquid nitrogen and immediately placed in a 37℃water bath with gentle shaking to thaw the frozen material within 1 minute. Placing the thawed cell suspension into a 15mL sterile centrifuge tube, adding 5mL of PC9 culture medium, centrifuging at 1000rpm for 5min, discarding supernatant, adding 8mL of complete culture medium, slightly blowing and mixing to obtain a mixed solution, sucking the mixed solution, placing into a 100mm cell culture dish, placing into a carbon dioxide incubator, and adding 5% CO at 37deg.C 2 Culturing under saturated humidity, changing culture medium for 2-3 days, and digesting when cell density reaches 80-90%, and subculturing at 1:3.
Example 3: morphological observation of Acetinib-resistant human lung adenocarcinoma cell line PC9-AR
1. Experimental cell line material: the African drug resistant cell line PC9-AR constructed in example 1 and the parent human lung adenocarcinoma cell line PC9 thereof.
2. The experimental method comprises the following steps: the ametinib resistant cell strain PC9-AR and the parent human lung adenocarcinoma cell strain PC9 are respectively inoculated into a 60mm culture dish, and after the cells grow to the logarithmic growth phase, the living cell morphology is observed under an inverted phase contrast microscope and photographed.
3. Experimental results:
the results of the morphological observation are shown in FIG. 1. As shown in FIG. 1, compared with the parent cell PC9, the cell type of the Africinib drug-resistant cell strain PC9-AR constructed by the invention is obvious, the cells are in a spindle shape, the cells are in a plurality of polynuclear cells, and cavitation bubbles are generated in the polynuclear cells, which is probably caused by drug treatment. As a result, it was demonstrated that the African drug resistant cell line PC9-AR of the present invention was morphologically changed.
Example 4: determination of drug resistance index of anti-ametinib human lung adenocarcinoma cell strain PC9-AR
1. The experimental method comprises the following steps:
the African-resistant human lung adenocarcinoma cell line PC9-AR and the parental cell line PC9 in the logarithmic growth phase were inoculated into 96-well plates at 3000 cells/100. Mu.L/well, respectively. 200 μL LPBS solution was added to the 96-well plate at the edge of each well to reduce medium evaporation during the experiment. After the plating is finished, the edge of the 96-well plate is gently tapped, and the cells are uniformly distributed in the holes in three times up, down, left and right, and then placed in a cell incubator for continuous incubation. About 24 hours after cell plating, 100 mu L of prepared complete culture medium containing the amotinib with different concentrations (the concentration gradient of the amotinib in the complete culture medium is set to be 0.1nM, 1nM, 10nM, 100nM, 1000nM, 10000nM and the like) is added into each hole, and 3-6 compound holes are arranged in each concentration to reduce errors; a blank (with complete medium only, without drug in the medium) was also set. After the dosing is finished, the mixture is placed in a cell incubator for further incubation for 72 hours. Cell culture medium was discarded before detection, and each well was washed 2 times with 100 μlpbs solution. A pre-chilled 10% trichloroacetic acid solution (10 g trichloroacetic acid powder in 100mL ddH) was then added at 100. Mu.L/well 2 O), and after standing for 5 minutes, the 4-degree refrigerator was fixed for 1 hour. The trichloroacetic acid solution was discarded and the 96-well plate was washed four times with running water.The action should be gentle when cleaning the orifice plate, avoiding the flow of water to be fast, leading to the shedding of cells fixed on the bottom surface of the orifice plate. And (5) cleaning and airing at room temperature. 0.4% SRB solution (0.4 g SRB powder was dissolved in 1% acetic acid solution and fixed to 100 mL) was added at 100. Mu.L/well and stained by shaking in the dark for 20min. After staining, 1% acetic acid solution (1 mL 100% acetic acid plus ddH) 2 O and volume to 100 mL) was washed four times to completely remove unbound dye and air dried at room temperature. Finally, 10mM Tris-base alkaline solution (0.1211 g Tris powder in ddH) was added at 100. Mu.L/well 2 O, constant volume to 100 mL), shaking and mixing for 5min to completely dissolve the SRB dye combined with the protein in Tris-base alkali solution. Or dissolving for 30min at room temperature. Absorbance values at 540nm were measured using a microplate reader. After correction for OD values, cell viability per well was calculated according to the formula and drug dose-response plots were drawn using Graphpad Prism 9.0 software and the median inhibitory concentration (IC 50) and drug Resistance Index (RI) of PC9-AR and parental cells NCI-PC9 to ametinib were calculated. Wherein, the calculation formula of the cell viability is: cell viability (%) = experimental OD value/control OD value x 100%; the calculation formula of the drug Resistance Index (RI) is as follows: drug Resistance Index (RI) =drug resistant cell IC 50/parental cell IC50.
2. Experimental results:
the result of the survival rate detection of the Acetinib resistant cell strain PC9-AR under the action of different concentrations of Acetinib is shown in figure 2. As can be seen from FIG. 2, the cell viability of PC9-AR was not significantly altered, while PC9 viability was significantly reduced with the same concentration of ametinib. According to calculation, the drug resistance index of the African-resistant human lung adenocarcinoma cell strain PC9-AR is 1094.2.
Example 5: detection of proliferation capacity of Ameitinib-resistant human lung adenocarcinoma cell strain PC9-AR
1. SRB cell proliferation assay detects the proliferation capacity of an Ameitinib-resistant cell line PC 9-AR:
(1) The experimental method comprises the following steps: the parent cell strain PC9 in logarithmic growth phase and the drug-resistant cell strain PC9-AR were inoculated into a 96-well plate at 2000 cells/100. Mu.l/well, respectively. After overnight attachment of the cells, the medium was discarded at 0h, 24h, 48h, 72h, 96h, respectively, and the cells were fixed using 10% trichloroacetic acid solution. After the 96-well plate is dried at room temperature, adding 100 mu L of SRB dye liquor (prepared by 1% acetic acid) of 0.4% (w/v) into each well, pouring out the dye liquor after dyeing for 30min, washing for 4 times by 1% (v/v) acetic acid, removing unbound dye, and drying at room temperature; the dye bound to the cellular protein was dissolved with 100. Mu.L of unbuffered Tris-base lye (10 mM, pH=10.5), and the absorbance was measured using an microplate reader at 540nm with shaking for 20min. Growth was plotted using Graphpad Prism 9.0 software and the control cell proliferation was observed.
(2) Experimental results:
the detection results are shown in FIG. 3A. As can be seen from FIG. 3A, the drug-resistant cell line PC9-AR has a weaker proliferation capacity than the parent cell line PC9.
2. The proliferation capacity of an Ameitinib-resistant cell line PC9-AR is detected by a plate cloning experiment:
(1) The experimental method comprises the following steps:
the method comprises the steps of selecting an African-resistant human lung adenocarcinoma cell strain PC9-AR in a logarithmic growth phase and a parent cell strain PC9 thereof, inoculating the strain into a 6-hole plate according to the density of 500-1000 cells/hole, slightly shaking and uniformly mixing, putting the mixture into a cell incubator, and incubating for 7-14 days. Cell growth was observed and the culture was stopped by discarding the medium when macroscopic clones appeared in the well plate. After rinsing 2 times with PBS, fixation was performed for 30 minutes using paraformaldehyde. The fixative was discarded, the crystal violet stained, then dried at room temperature and counted.
(2) Experimental results:
the detection results are shown in FIG. 3B. As can be seen from FIG. 3B, the drug-resistant cell line PC9-AR has a weaker proliferation capacity than the parent cell line PC9.
Example 6: detection of invasion and migration capacity of Acetinib-resistant human lung adenocarcinoma cell line PC9-AR
1. The experimental method comprises the following steps:
(1) Migration experiment:
a. transwell cells and 24-well plates with a pore size of 8 μm were prepared for the experiments. Selecting a drug-resistant cell strain PC9-AR in a logarithmic growth phase and a parent cell strain PC9 thereof, and starving the drug-resistant cell strain PC9-AR for 12-24 hours by using a serum-free culture medium before an experiment. Cells were resuspended after pancreatin digestion and harvested by centrifugation at 1000rpm for 5min. The supernatant was discarded and resuspended using serum-free 1640 medium.
b. After the cells were resuspended and thoroughly mixed, the cell concentration was adjusted to (1-10). Times.10 5 Cell suspensions were obtained per cell/mL. 200. Mu.L of the cell suspension was added to the upper chamber of the Tranwell chamber. And 800. Mu.L of medium containing 20% FBS was added to the corresponding wells. The culture medium should cover the lower surface of the Transwell chamber and have no bubbles in front of the lower surface. Placing the cells into a cell culture box for further culture for 24 hours.
c. The medium in the upper chamber and the medium in the corresponding wells was discarded and the culture was terminated. The cells that did not penetrate the upper chamber were gently removed by washing twice with PBS and using a wet cotton swab. After fixation of paraformaldehyde for 30min, crystal violet staining for 30min. Finally, the sample is observed under an inverted microscope, photographed and counted.
(2) Invasion experiments:
placing the Matrigel which is packaged in advance in a 4-degree refrigerator for thawing, using a serum-free 1640 culture medium, and diluting the Matrigel according to a ratio of 1:5. The gel is evenly spread on the upper chamber of a Transwell cell according to 60 mu L/hole, and then is put into a 37-DEG cell incubator for incubation for 2-3 hours so as to make the matrigel gel. The steps of preparation, culture, fixation and staining of the residual cells are the same as those of the Transwell cell migration experiment.
2. Experimental results:
the detection results are shown in FIG. 4. From fig. 4, it can be seen that the invasion and migration capacity of the ametinib-resistant lung adenocarcinoma cells PC9-AR is significantly higher than that of the parent cells PC9.
Example 7: EGFR in Ameitinib-resistant human lung adenocarcinoma cell line PC9-AR and detection of downstream pathway protein thereof
Extracting protein lysate of the African-resistant human lung adenocarcinoma cell strain PC9-AR; and simultaneously, carrying out EGFR, p-EGFR, akt, p-Akt, erk and p-Erk western blotting experiment detection on the extracted protein lysate.
1. The experimental method comprises the following steps:
cell lysate was prepared prior to extraction of protein samples: and adding the protease inhibitor mixed solution and the phosphatase inhibitor mixed solution into the RIPA lysate with the required dosage according to the proportion of 100:1 before using, and uniformly mixing. The whole protein extraction process was performed on ice.
After the cells were treated as required, the medium was discarded, the cells were washed twice with PBS, and the cell lysate was directly added dropwise to the cell surface (six well plates 150-250. Mu.L per well) and the lysate was added. The lysate was evenly distributed on the cell surface by the number of shots (note that cross-contamination between samples was not required). The protein samples were then collected in EP tubes using a spatula after 10min lysis on ice. Centrifuge 12000g for 5min at 4 ℃, take supernatant in new EP tube, add deionized water and 5 x protein loading buffer after subsequent protein concentration determination to configure protein samples to uniform concentration. And then carrying out conventional electrophoresis, membrane transfer and antibody incubation according to a western blotting method, and exposing by a machine.
2. Experimental results:
the western blot results of EGFR and its downstream pathway proteins in the African-resistant human lung adenocarcinoma cell line PC9-AR are shown in FIG. 5.
As shown in FIG. 5, the parent cell strain PC9 EGFR protein has obviously weaker phosphorylation, and 50nmol/L of armetinib can inhibit the expression of proteins such as p-EGFR, p-Akt, p-Erk and the like; however, no expression of p-EGFR protein was detected in the Ametinib resistant cell line PC9-AR, and 50 to 500nmol/L of Ametinib could not significantly reduce the expression levels of p-Akt and p-Erk proteins, suggesting that bypass activation exists in the resistant cell line.
Example 8: KRAS relative expression detection in Ameitinib-resistant human lung adenocarcinoma cell line PC9-AR
1. The experimental method comprises the following steps:
(1) RNA extraction:
a. PC9 and PC9-AR cells in the logarithmic growth phase were taken, the medium was discarded and washed twice with PBS. Trizol was added to lyse cells according to 1mL of Trizol/10cm 2. The cell lysates were completely lysed by repeated pipetting at room temperature and the cell lysates were collected into enzyme-free EP tubes.
b. Chloroform was added to each sample in 200. Mu.L of chloroform/1 mL of Trizol, and the mixture was turned upside down 15 times or mixed by shaking, and then allowed to stand at room temperature for 5 minutes. Centrifuge at 4 degrees, 12000rpm for 15min. After centrifugation, the samples were divided into three layers: the upper aqueous phase (containing RNA and small amounts of DNA), the middle white layer (containing protein and DNA), and the lower organic phase (containing chloroform and protein).
c. The upper aqueous phase was pipetted into another enzyme-free EP tube taking care not to aspirate the middle layer. And added with isopropyl alcohol according to 500. Mu.L isopropyl alcohol/1 mL Trizol, and allowed to stand at room temperature for 10min after being thoroughly mixed. Centrifuge at 12000rpm for 10min at 4 degrees. After centrifugation, the supernatant was discarded and RNA was precipitated at the bottom of the tube.
d. RNA pellet was suspended by adding 75% ethanol at 1mL of 75% ethanol/1 mL Trizol with gentle shaking. And centrifuged at 7500rpm at 4 degrees for 5min. After centrifugation, the supernatant was discarded, dried at room temperature, and an appropriate amount of enzyme-free sterile water was added to dissolve the RNA precipitate, and the RNA concentration was measured using Nanodrop 2000.
(2) Reverse transcription of RNA:
after completion of RNA extraction, the RNA concentration of each sample was measured and adjusted to 200 ng/. Mu.L. a. Genomic DNA was removed. RNA-free ddH was prepared according to the following scheme 2 O12. Mu.L, 4 XgDNA wind Mix 4. Mu. L, RNA 4. Mu.L, and set the PCR apparatus at 42℃for 2min.
b. After the reaction in the previous step is completed, 4 mu L of 5X HiScript III RT SuperMix is directly added into a reaction tube, and the reaction condition is set to be 37 ℃ for 15min; and 5s at 85 ℃. The reaction product was immediately available for qPCR reaction.
(3) Fluorescent quantitative PCR:
this procedure was performed according to the nuezan real-time fluorescent quantitative PCR kit ChamQ Universal SYBR qPCR Master Mix. The reverse transcription reaction products of each group of samples are diluted, 2 mu L of samples are taken as cDNA template amount per each hole after dilution, and three compound holes are arranged for each sample of each group so as to reduce errors.
The primers used in this experiment were synthesized by the biological engineering Co., ltd, and the sequences of the primers were as follows:
ACTIN Forward Primer：TGGCACCCAGCACAATGAA，
ACTIN Reverse Primer：CTAAGTCATAGTCCGCCTAGAAGCA；
KRASForward Primer：ACAGAGAGTGGAGGATGCTTT；
KRASReverse Primer：TTTCACACAGCCAGGAGTCTT。
after the reaction is finished, calculating the average Ct value of three compound holes of each group of samples. With ACTIN as an internal reference, the relative expression amount of the target gene mRNA in each sample is calculated according to the formula (the relative expression amount of the target gene of each sample=2- Δct, ΔΔct= (the target gene Ct value of the experimental group-the Ct value of the internal reference gene) - (the target gene Ct value of the control group-the Ct value of the internal reference gene).
2. Experimental results:
the fluorescence quantitative PCR detection result of KRAS gene of the African-resistant human lung adenocarcinoma cell line PC9-AR is shown in FIG. 6.
As can be seen from FIG. 6, the relative expression level of KRAS gene in the African resistant lung adenocarcinoma cell line PC9-AR was significantly higher than that of the parent cell PC9.
Example 9: KRAS gene copy number detection in Ameitinib-resistant human lung adenocarcinoma cell line PC9-AR
1. The experimental method comprises the following steps:
taking cell sediment of a drug-resistant cell strain PC9-AR in a logarithmic growth phase and a parent cell strain PC9 thereof, sequentially adding 200ul of PBS, 20ul of protease K and 200ul of Buffer BCL, and carrying out vortex mixing uniformly, and carrying out water bath at 56 ℃ for 10min; sequentially adding 150ul of absolute ethyl alcohol, and uniformly mixing by vortex; transferring the mixed solution to an adsorption column, centrifuging at 12000rpm for 1min, and removing impurities such as protein, salt ions, ethanol, etc.; finally, 50-ul Elution buffer is added, the mixture is kept stand at room temperature for 2-5min, and the genome is eluted by centrifugation at 12000rpm for 1 min. And the DNA concentration was determined using Nanodrop 2000, followed by fluorescent quantitative PCR to detect KRAS gene copy number.
2. Experimental results:
the KRAS gene copy number detection results are shown in FIG. 7.
As can be seen from FIG. 7, the KRAS gene copy number in the AMetinib resistant cell line PC9-AR was significantly higher than that of the parent cell PC9, suggesting the presence of KRAS amplification in PC9-AR.
The above-described embodiments are provided to illustrate the gist of the present invention, but are not intended to limit the scope of the present invention. It will be understood by those skilled in the art that various modifications and equivalent substitutions may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.
Claims (4)
1. The anti-ametinib human lung adenocarcinoma cell line PC9-AR is characterized in that the preservation number of the anti-ametinib human lung adenocarcinoma cell line PC9-AR is CCTCC NO: C2022220.
2. Use of an ametinib-resistant cell line according to claim 1 for screening a drug that reverses resistance to lung adenocarcinoma.
3. Use of an ametinib-resistant cell line according to claim 1 for screening and preparing an anti-lung adenocarcinoma drug.
4. Use of an ametinib-resistant cell line according to claim 1 in constructing an extracorporal lung adenocarcinoma drug-resistant cell model.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211729783.8A CN116200340B (en) | 2022-12-30 | 2022-12-30 | Aftetinib-resistant human lung adenocarcinoma cell line PC9-AR and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211729783.8A CN116200340B (en) | 2022-12-30 | 2022-12-30 | Aftetinib-resistant human lung adenocarcinoma cell line PC9-AR and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116200340A CN116200340A (en) | 2023-06-02 |
| CN116200340B true CN116200340B (en) | 2023-08-15 |
Family
ID=86508739
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211729783.8A Active CN116200340B (en) | 2022-12-30 | 2022-12-30 | Aftetinib-resistant human lung adenocarcinoma cell line PC9-AR and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116200340B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107267458A (en) * | 2017-07-06 | 2017-10-20 | 中南大学湘雅二医院 | A kind of Nike azoles is for the non-small cell lung cancer cell strain H3122 CR23 of Buddhist nun people and its application |
| CN111218424A (en) * | 2019-12-12 | 2020-06-02 | 广州医科大学附属第一医院 | Oxitinib drug-resistant cell strain NCI-H1975/AR and application thereof |
| CN111235218A (en) * | 2019-12-12 | 2020-06-05 | 广州医科大学附属第一医院 | Third-generation EGFR-TKI drug-resistant cell strain and application thereof |
| CN111793604A (en) * | 2020-06-05 | 2020-10-20 | 潘慧 | Human non-small cell lung cancer cell strain H1975/OR resistant to oxitinib and application thereof |
| AU2020103247A4 (en) * | 2020-11-05 | 2021-01-14 | The First Affiliated Hospital Of Guangzhou Medical University | Third-generation EGFR-TKI drug-resistant cell strain and application thereof |
| AU2020103364A4 (en) * | 2020-11-10 | 2021-01-21 | The First Affiliated Hospital Of Guangzhou Medical University | Ositinib-resistant cell line NCI-H1975/AR and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018234556A1 (en) * | 2017-06-23 | 2018-12-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for preventing or treating cancer resistance to egfr inhibition |
-
2022
- 2022-12-30 CN CN202211729783.8A patent/CN116200340B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107267458A (en) * | 2017-07-06 | 2017-10-20 | 中南大学湘雅二医院 | A kind of Nike azoles is for the non-small cell lung cancer cell strain H3122 CR23 of Buddhist nun people and its application |
| CN111218424A (en) * | 2019-12-12 | 2020-06-02 | 广州医科大学附属第一医院 | Oxitinib drug-resistant cell strain NCI-H1975/AR and application thereof |
| CN111235218A (en) * | 2019-12-12 | 2020-06-05 | 广州医科大学附属第一医院 | Third-generation EGFR-TKI drug-resistant cell strain and application thereof |
| CN111793604A (en) * | 2020-06-05 | 2020-10-20 | 潘慧 | Human non-small cell lung cancer cell strain H1975/OR resistant to oxitinib and application thereof |
| AU2020103247A4 (en) * | 2020-11-05 | 2021-01-14 | The First Affiliated Hospital Of Guangzhou Medical University | Third-generation EGFR-TKI drug-resistant cell strain and application thereof |
| AU2020103364A4 (en) * | 2020-11-10 | 2021-01-21 | The First Affiliated Hospital Of Guangzhou Medical University | Ositinib-resistant cell line NCI-H1975/AR and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| WDR1在PC9细胞对AZD9291抗性形成中的影响;胡继盛;李紫怡;杨子豪;刘钟颖;黄霞;;生物技术;第30卷(第04期);382-388+351 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116200340A (en) | 2023-06-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107805663B (en) | Application of Lnc03729 gene as biomarker in lung adenocarcinoma pre-diagnosis reagent | |
| CN107663539A (en) | Circular rna circ PTGR1 purposes | |
| CN111718995B (en) | Biomarker for nasopharyngeal carcinoma metastasis diagnosis and/or prognosis evaluation | |
| CN111254146B (en) | Application of LINC01331 gene inhibitor in preparation of medicine for treating lung cancer | |
| CN107142310B (en) | Screening method of specific shRNA for inhibiting lung cancer cells by targeting Ang-2 gene | |
| CN108504737B (en) | Application of long-chain non-coding RNA TRALR | |
| CN116200340B (en) | Aftetinib-resistant human lung adenocarcinoma cell line PC9-AR and application thereof | |
| CN111235275B (en) | Gene marker of lung cancer and application thereof | |
| CN108531544A (en) | A kind of method of miR-181b target genes screening | |
| CN107312855A (en) | A kind of gene related to larynx squamous carcinoma and its application | |
| CN108034719B (en) | Application of GINS4 gene or GINS4 protein as biomarker in preparation of lung adenocarcinoma pre-diagnosis reagent | |
| CN108721316B (en) | Application of marker miR-652-5p in medicines and kits for metastasis, prognosis and treatment of esophageal squamous carcinoma | |
| CN108913695B (en) | Application of ZEB1 in human heart fibroblast | |
| CN113730427A (en) | Application of miRNA-6766-3p in preparation of medicine for preventing and/or treating hepatic fibrosis | |
| CN110577952B (en) | Application of siRNA interfering long non-coding RNA in preparation of medicine for treating breast cancer | |
| CN107881237B (en) | Lung cancer diagnosis marker microRNA-4317 and application thereof in medicines and diagnosis kit | |
| CN107937523B (en) | Lung cancer diagnosis marker microRNA-3607-3p and application thereof in medicines and diagnosis kit | |
| CN115252637B (en) | Gene inhibitor with liver cancer metastasis inhibiting function | |
| CN115927187B (en) | Ameitinib resistant cell strain NCI-H1975-AR and application thereof | |
| CN107625780A (en) | Diagnosis of Non-Small Cell Lung label microRNA 1253 and the application in medicine and diagnostic kit | |
| CN114908172B (en) | Application of APOBEC3B in diagnosis, prognosis prediction and treatment of prostate cancer | |
| CN112941183B (en) | Application of non-coding gene miR-187-5p in primary liver cancer diagnosis and treatment | |
| CN111118007A (en) | Long non-coding RNA and application thereof in diagnosis/treatment of cervical cancer | |
| CN104087682A (en) | Method for detecting astragaloside-induced RMMVECs gene expression profiling by utilizing gene chip | |
| CN114164270B (en) | Application of CRIP2 in detecting resistance of prostate cancer to docetaxel and reversing resistance of prostate cancer to docetaxel |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |