CN116143940A - Carp spring viremia virus resisting oral vaccine, preparation method and application thereof - Google Patents

Abstract

The invention discloses an oral vaccine for resisting spring viremia of carp, a preparation method and application thereof, wherein the oral vaccine is formed by constructing fusion protein by connecting spring viremia of carp antigen protein and yellow river carp defensin protein through a flexible joint, expressing the fusion protein in escherichia coli and enriching through a biological vector, and the encoding gene sequence of the fusion protein comprises 64-1389bp of truncated segment of spring viremia of carp antigen protein gene, 70-201bp of partial gene segment of yellow river carp defensin protein signal peptide removing part and the flexible joint fusion gene connecting two groups of gene segments. Compared with the reported SVCV-resistant vaccine, the carp anti-spring viremia virus oral vaccine prepared by the invention has the advantages of no damage to fish bodies in the whole immune process, simple operation, safety, stability and higher protection rate. Therefore, the oral vaccine provides a broad prospect for preventing and controlling spring viremia of carp.

Description

Carp spring viremia virus resisting oral vaccine, preparation method and application thereof

Technical Field

The invention belongs to the technical field of carp spring viremia virus resisting vaccines, and particularly relates to an oral carp spring viremia virus resisting vaccine, and a preparation method and application thereof.

Background

Spring viremia of carp (Spring viraemia of carp, SVC) is an acute hemorrhage and epidemic septicemia caused by spring viremia of carp virus (Spring viraemia of carpvirus, SVCV), has been popular worldwide, and is one of the most prominent problems in freshwater aquaculture in China. The spring viremia of carp mainly infects carp and its variant, and the mortality rate is up to above 70%. In view of its wide popularity and strong pathogenicity, SVCV is still one of the fish viruses that must be declared according to the latest version of the aquatic animal epidemic disease directory published by the world animal health organization 2021. SVCV is a single-stranded negative-strand RNA virus, the genome size of which is about 11kb, encoding 5 structural proteins, which are respectively nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and RNA polymerase (L). Among them, the G protein on the surface is the most important antigen protein, has stronger immunogenicity and can induce immune response. Thus, the G protein is the main protein for the detection of SVCV viruses, the preparation of antibodies and the development of vaccines at the present stage. Aiming at SVCV, effective prevention and control measures are developed, which is beneficial to the healthy development of aquaculture industry in China and even the world.

Vaccines are the most effective measure for the control of viral diseases. The fish vaccine can be divided into a traditional vaccine and a novel vaccine according to different development technologies. The traditional vaccine is mainly an inactivated vaccine and an attenuated live vaccine; the novel vaccine is developed by modern biotechnology and comprises a gene deletion inactivated vaccine, a recombinant vaccine, a genetic engineering subunit vaccine, a genetic engineering live vector vaccine, a nucleic acid vaccine and the like. The genetic engineering live carrier vaccine, also called as biological carrier vaccine, is a vaccine which expresses exogenous antigen in microorganism or animal and plant carrier by genetic engineering technology, has the advantages of high immune efficacy, low cost, good safety and the like, and is the development direction with the most potential for future vaccine development and development. The fish vaccine can be divided into three types of injection, soaking and oral administration according to the inoculation type. Wherein, oral immunization is a relatively convenient immunization mode, and is not limited by the specification size of an inoculation object, the type of vaccine, the inoculation time, the times and the like; in addition, the oral immunization can avoid the stress reaction and damage of the organism caused by injection, can reduce manpower and material resources, is easy to popularize and has wide application prospect. With the development of modern biological technology, fish vaccines have transitioned from traditional vaccines to new oral vaccines.

Current vaccine development for SVCV is still under investigation. The reported SVCV inactivated vaccine can only provide limited protection, and the attenuated vaccine has the hidden troubles of improper attenuation mode, toxicity reversion and the like. Early DNA vaccines against SVCV exhibited lower protection rates. Researchers performed multiple trials on SVCV G proteins with relative survival rates of 11% -33%; the treatment group injected with the full-length G gene has better effect and the protection rate is 48 percent. In addition, the processing pressure of direct injection of DNA vaccines on fish and the high labor and production costs make mass immunization difficult to achieve. According to the invention, the oral subunit vaccine for fusion expression of SVCV G and koi herpesvirus ORF81 genes through lactobacillus can achieve 71% of immune protection rate on carp, and the relative protection rate of the oral subunit vaccine for fusion expression of SVCV G and koi herpesvirus ORF81 genes only achieves 34% after the oral subunit vaccine for fusion expression of SVCV G and koi herpesvirus ORF81 genes is used for soaking immune carp. Based on current research, the development of efficient vaccine antigen vectors, immunization by oral means, may be an effective route for SVCV vaccination.

In the development of vaccine, the addition of fusion protein has the advantages of improving antigen activity, increasing antigen effective time, producing difunctional and even multifunctional proteins, etc. Defensins are effector molecules of innate immunity and can be used as a natural immune adjuvant. In the invention, SVCV G protein and yellow river carp defensin (beta-descensin 3, BD 3) are subjected to fusion expression through a flexible joint, and the yellow river carp is fed through wheel worm enrichment, so that a simple and effective novel oral vaccine is prepared.

Disclosure of Invention

The invention solves the technical problem of providing the carp anti-spring viremia oral vaccine which is simple in preparation method, safe and stable and has better immune protection effect, and the preparation method thereof.

The invention adopts the following technical proposal to solve the technical problems, and is characterized in that the carp anti-spring viremia virus oral vaccine is prepared by the following steps: the oral vaccine is formed by constructing fusion protein by connecting a carp spring viremia virus antigen protein and a yellow river carp defensin protein through a flexible joint, expressing the fusion protein in escherichia coli and enriching the fusion protein through a biological vector, wherein the encoding gene sequence of the fusion protein comprises 64-1389bp of a carp spring viremia virus antigen protein truncated fragment and 70-201bp of a yellow river carp defensin protein signal peptide-removing part gene fragment, and a flexible joint fusion gene connecting two groups of gene fragments;

wherein the nucleotide sequence of the carp spring viremia virus antigen protein coding gene is shown as SEQ ID NO. 1;

the nucleotide sequence of the yellow river carp defensin protein coding gene is shown as SEQ ID NO. 2;

the nucleotide sequence of the flexible joint fusion gene is shown as SEQ ID NO. 3.

Further defined, the prokaryotic expression plasmid pET-28a used for expression of the fusion protein in E.coli contains a green fluorescent protein GFP tag.

Further defined, the biological carrier is a freshwater calyx armyworm favored by carp.

Further limited, the end of 64-1389bp of the truncated segment of the carp spring viremia virus antigen protein gene is connected with the head end of 70-201bp of the partial gene segment of the yellow river carp defensin protein signal peptide removing part through a flexible joint fusion gene to form a fusion protein coding gene.

The invention relates to a preparation method of an oral vaccine for resisting spring viremia of carp virus, which is characterized by comprising the following specific processes of;

step S1, respectively amplifying to obtain a carp spring viremia virus antigen protein coding gene sequence and a yellow river carp defensin protein coding gene sequence, carrying out sequence analysis on the carp spring viremia virus antigen protein coding gene sequence, removing N-terminal signal peptide, combining amino acid hydrophobicity and antigenic determinants corresponding to the encoded carp spring viremia virus antigen protein, selecting an amino acid fragment which has good antigenicity and is easy to express, wherein the corresponding gene sequence is 64-1389bp of the truncated segment of the carp spring viremia virus antigen protein, carrying out sequence analysis on the yellow river carp defensin protein coding gene sequence, removing N-terminal signal peptide, selecting other amino acid sequences, and selecting the corresponding gene sequence as 70-201bp of the yellow river carp defensin protein signal peptide removing partial gene fragment;

s2, connecting 64-1389bp of a truncated segment of a carp spring viremia virus antigen protein gene and 70-201bp of a partial gene segment of a yellow river carp defensin protein signal peptide removal part through a flexible joint fusion gene and inserting the partial gene segment into an MCS region of a pET-28a-GFP plasmid to construct a recombinant plasmid;

step S3, transforming the recombinant plasmid into Rosetta (DE 3) competent cells, and performing induced expression on positive clones after bacterial liquid PCR screening and sequencing verification: shaking bacteria until OD600 is 0.5-0.6, adding IPTG with different concentrations, placing the bacteria at 28 ℃ for overnight culture, taking 1mL of bacterial liquid, centrifugally collecting bacterial bodies, washing the bacterial bodies with PBS, adding 40 mu L of protein lysate, adding protein loading buffer solution for boiling denaturation, cooling, performing SDS-PAGE electrophoresis separation, and identifying protein expression after coomassie brilliant blue staining and decoloration;

step S4, centrifugally collecting bacterial liquid for inducing expression, washing for 3 times by using PBS, finally preparing the bacterial liquid into the same concentration by using PBS, observing the expression condition of fluorescent protein under a fluorescent microscope, inactivating the rest of the bacterial liquid by formalin, centrifuging, washing for 3 times by using PBS to remove the formalin, and preserving for later use;

and S5, feeding the fusion protein prokaryotic expression bacteria expressing fluorescence to rotifers, detecting fluorescence intensity under a fluorescence microscope after 1h, photographing, feeding the prokaryotic expression bacteria to the rotifers respectively, judging the protein enrichment degree according to the fluorescence intensity, and then collecting the rotifers by using a 300-mesh screen, and storing at the current use or at the temperature of minus 80 ℃ for later use.

The invention relates to application of an oral vaccine for resisting spring viremia of carp, which is used for preventing or treating spring viremia of carp.

Compared with the prior art, the invention has the following advantages and beneficial effects: the invention develops a novel carp anti-spring viremia virus oral vaccine, which is prepared by utilizing a carp spring viremia virus antigen protein and a yellow river carp defensin protein to be fused and expressed in escherichia coli through a flexible joint, enriching the fusion protein by taking a carp favorite wheel as a biological carrier to obtain the oral vaccine, and then feeding the yellow river carp with a feed in an oral mode. The oral vaccine has high immunoprotection effect (77.28%). Compared with the reported SVCV-resistant vaccine, the carp anti-spring viremia virus oral vaccine prepared by the invention has the advantages of no damage to fish bodies in the whole immune process, simple operation, safety, stability and higher protection rate. Therefore, the oral vaccine provides a broad prospect for preventing and controlling spring viremia of carp.

Drawings

FIG. 1 is a diagram of the expression of different recombinant plasmid proteins.

FIG. 2 is a diagram showing fluorescence analysis of various expressed cells under a fluorescence microscope.

FIG. 3 is a fluorescence microscope to observe the enrichment of each histone in rotifers.

FIG. 4 is a graph of clinical symptoms of different experimental fish.

FIG. 5 is a graph showing survival curves of different experimental fish.

Detailed Description

The above-described matters of the present invention will be described in further detail by way of examples, but it should not be construed that the scope of the above-described subject matter of the present invention is limited to the following examples, and all techniques realized based on the above-described matters of the present invention are within the scope of the present invention.

Examples

Materials and methods:

1. experimental animal

Yellow river carp specification used in experiment: the body length is 8.0+/-1.0 cm, the body weight is 19.0+/-1.5 g, and the culture is carried out on aquatic product bases of Henan master university. Continuously aerating and oxygen increasing in the cultivation process, and keeping the water temperature at 15-20 ℃. The feed is fed to the yellow river carps once in the morning and evening every day, and water and pollution are changed every other day.

The armyworm used in the experiment is purchased from a living bait store in the Shanghai, and the fed chlorella is cultivated at 25-30 ℃.

2. Carrier and recipient bacterium

In order to visualize the results of E.coli feeding rotifers, GFP tags were inserted in the prokaryotic expression vector pET-28a MCS region in this experiment; coli DH 5. Alpha. And Rosetta (DE 3) are both products of the company Norwegian.

3. Reagent(s)

LA Taq DNA polymerase, endonuclease, T4 ligase, etc. are purchased from Takara corporation; IPTG was purchased from soribao biology corporation; SDS-PAGE gel kit was purchased from Yase Biocompany.

4. Cells, viruses

Cyprinus carpioepithelial tumor cells (EPC) were cultured in L15 medium containing 10wt% Fetal Bovine Serum (FBS), serum, medium and pancreatin were all Gibco products, and spring viremia virus (SVCV) of Cyprinus carpiocarpiod was prepared and stored by our laboratory.

5. Construction of fusion proteins

Amplifying to obtain SVCV G and yellow river carp defensin (BD 3) gene sequences, carrying out sequence analysis, removing N-terminal signal peptide, combining amino acid hydrophobicity and antigenic determinant corresponding to the encoded G protein, selecting proper gene fragments, connecting the proper gene fragments with the selected yellow river carp defensin gene fragments through a flexible joint fusion gene Linker, and synthesizing the fusion gene sequences by Jin Kairui company (Chinese Wuhan). Three recombinant plasmids, namely G, G-BD3 and BD3-G, were constructed by sequentially synthesizing BD3 with G preceding and BD3 following, and inserting them into the MCS region of pET-28a-GFP plasmid, respectively.

6. Inducible expression and identification of fusion proteins

The 3 recombinant plasmids described above, and the control plasmid pET-28a-GFP, were transformed into Rosetta (DE 3) competent cells, respectively. The positive clone is subjected to induced expression after bacterial liquid PCR screening and sequencing verification: shaking until OD600 is 0.5-0.6, adding IPTG with different concentrations, and culturing at 28deg.C overnight. And (3) taking 1mL of bacterial liquid, centrifuging to collect bacterial cells, washing with PBS, adding 40 mu L of protein lysate, adding protein loading buffer solution, boiling for denaturation, cooling, performing SDS-PAGE electrophoresis separation, and identifying protein expression after coomassie brilliant blue staining and decolorizing.

7. Fusion protein prokaryotic expression bacterium feeding rotifer

Inducing a large amount of fusion proteins of each group according to the conditions, centrifugally collecting bacterial liquid, washing for 3 times by using PBS, preparing the bacterial liquid into the same concentration by using PBS, taking a small amount of the bacterial liquid, observing the expression condition of fluorescent proteins under a fluorescent microscope, inactivating the rest of the bacterial liquid by formalin, centrifuging, washing for 3 times by using PBS, removing the formalin, and sub-packaging and preserving for standby.

8. Wheel worm enrichment fusion protein

Feeding the fusion protein prokaryotic expression bacteria expressing fluorescence to rotifer, detecting fluorescence intensity under a fluorescence microscope after 1h, and photographing. Feeding 4 groups of prokaryotic expression bacteria with 4 groups of rotifers respectively, judging the protein enrichment degree according to the fluorescence intensity, and then collecting the rotifers by using a 300-mesh screen, and storing at the current use or at the temperature of minus 80 ℃ for standby.

9. Feeding of oral vaccine

Dividing the yellow river carps into 4 groups, wherein each group has 100 tails, and feeding the groups of experimental fishes with the rotifers from the group 1 to the group 4 respectively mixed with feed (Tongwei fish double health); each group is fed once in the morning and evening, and the feeding period is 30 days.

10. Immunoprotection test of vaccine

After oral vaccine feeding, each group of yellow river carps is intraperitoneally injected with SVCV at a half-lethal dose (LD 50) of SVCV to the yellow river carps, each group is injected with 100 mu L of virus liquid, each group is provided with 3 repeats, 45 total groups are treated in the same way, the virus is treated in the same way, the continuous observation is carried out for 28 days, the morbidity and mortality of experimental fishes are observed and recorded, and the relative immune protection rate (relative percent survival, RPS) of the vaccine is counted and calculated: rps= [1- (immune group mortality/control group mortality) ]x100%.

Results and analysis:

1. gene amplification and fusion protein construction

The invention firstly amplifies SVCV G and yellow river carp defensin (BD 3) gene sequence. Wherein the full length of the G gene ORF 1530bp, which codes 509 amino acids, and the sequence information is shown as SEQ ID NO. 1; the full length of the ORF of the D gene is 201bp, and 66 amino acids are encoded, as shown in SEQ ID NO. 2. Analysis by SignP6.0 shows that both proteins contain signal peptides, which need to be removed for prokaryotic expression. In addition, combining protein to analyze the hydrophobicity and antigenic determinant of G protein, we finally select the gene truncated segment (64-1389 bp) of G protein coding gene and the partial gene segment (70-201 bp) of the designal peptide of yellow river carp defensin to be connected through a flexible joint fusion gene Linker to become two fusion protein coding sequences of G-BD3 and BD 3-G. Three recombinant plasmids were successfully constructed by introducing the G, G-BD3 and BD3-G gene sequences into the pre-engineered empty plasmid pET-28a-GFP, respectively.

2. Fusion protein induced expression

The control group, pET-28a-GFP and E.coli containing recombinant plasmids for the G, G-BD3 and BD3-G proteins, were induced to express, respectively. The induction conditions were 28℃for 12h. The results are shown in FIG. 1, where each histone was expressed successfully. A good induction effect was obtained at an IPTG concentration of 0.5mM, so that a large amount of induction was carried out. The collected thalli can observe green fluorescence under a fluorescence microscope, and can play a good role in indication (figure 2).

3. Wheel worm enrichment fusion protein

E, inactivating the E.coli obtained by the 4 groups of large-scale induced expression, feeding each group of rotifers, collecting, and observing the enrichment condition of each group of proteins in the rotifers by a fluorescence microscope. As a result, as shown in FIG. 3, uptake of fluorescent E.coli into each group of rotifers was clearly observed. Meaning that by means of the biological carrier, such as the rotifer, a better enrichment effect can be obtained. Collecting the rotifers of each group, and feeding the rotifers as oral vaccine mixed feed or preserving the rotifers at the temperature of minus 80 ℃ for standby.

4. Vaccine immunoprotection effect

TABLE 1 SVCV half-lethal measurement of yellow river carp

Antidote agentMeasuring amount	Death number/total number (tail)	Mortality (%)
			L15	0/30	0%
1.0×10 7.875 TCID 50	30/30	100%
			1.0×10 7.375 TCID 50	15/30	50%
1.0×10 6.875 TCID 50	3/30	10%
			1.0×10 6.375 TCID 50	0/30	0%

Note that: each tail was intraperitoneally injected with 0.1 mL SVCV

To determine the LD50 of SVCV against yellow river carp, a virus infection experiment was performed on fish bodies. As shown in Table 1, each group was injected with 100. Mu.L of virus solution or L15 medium. One week after infection, the experimental fish started to die, and the diseased fish showed clinical symptoms such as abdominal distension, eyeball protrusion, body surface and basal bleeding of the fin (fig. 4). The death conditions of the yellow river carps in each group were counted (Table 1), and the half lethal dose of SVCV to the yellow river carps was calculated by SPSS to be 2.03X10 ⁷ TCID ₅₀ . After the 4 groups of yellow river carps respectively ingest the rotifer oral vaccine containing empty vector (Control), G, G-BD3 and BD3-G for 30 days, the groups of experimental fishes are injected with LD50, the symptoms are observed, the death rate is counted, and an experimental fish survival curve is drawn through R language. As a result, as shown in FIG. 5, experimental fish fed empty vector (Control), G, G-BD3, and BD3-G oral vaccine had survival rates of 51.11%, 77.78%, 88.89%, and 60.00% after SVCV infection, respectively, where there was a significant difference between G and Contol, a very significant difference between G-BD3 and Contol, and no significant difference between BD3-G and Contol. The results show that: after feeding the oral vaccine, two groups of yellow river carps G and G-BD3 generate certain immunityEpidemic force and relative immune protection rate reach 54.56% and 77.28%, respectively, and the G-BD3 group has the best immune protection effect.

The invention develops an oral vaccine for resisting spring viremia virus of carp. The research utilizes the fusion expression of virus proteins and host proteins, enriches the fusion proteins by taking rotifers which are favored by carps as biological carriers, and feeds the cyprinus carpio in an oral mode. The oral vaccine has high immunoprotection effect (77.28%). Compared with the reported SVCV-resistant vaccine, the whole immune process does not hurt fish bodies, and has simple operation, safety and stability and higher protection rate. Therefore, the oral vaccine provides a broad prospect for preventing and controlling spring viremia of carp.

While the basic principles, principal features and advantages of the present invention have been described in the foregoing examples, it will be appreciated by those skilled in the art that the present invention is not limited by the foregoing examples, but is merely illustrative of the principles of the invention, and various changes and modifications can be made without departing from the scope of the invention, which is defined by the appended claims.

SEQUENCE LISTING

<110> university of Henan teachers and students

<120> carp spring viremia virus resistant oral vaccine, preparation method and application thereof

<130> 2022

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 1530

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

atgtctatca tcagctacat cgcattcctt ttgctaattg actccacatt gggaatcccc 60

atatttgttc catccgggca gaatatatca tggcaacctg taattcagcc atttgattat 120

caatgtccaa tacacggaaa tctacctaac acaatgggat tgagtgccac caaattgaca 180

ataaaatctc catctgtctt cagtacagat aaagtttctg gatggatctg ccatgcagct 240

gaatggaaaa caacttgtga ttacagatgg tacggacccc aatatataac ccacagtatt 300

catccaatca gtcctaccat agatgaatgc aagagaatca tttcaaggat tgcatcagga 360

actgatgaag atctggggtt tccccctcaa agttgcggat gggcatctgt cacaacagtg 420

tcaaatacta attacaaggt agtaccccat tctgttcatt tggagccgta cggaggacac 480

tggatcgatc atgaattcaa tgggggcgaa tgcagagaaa aagtgtgtga aatgaaaggg 540

aaccactcta tttggatcac agatgagact gtgcagcatg aatgtgaaaa gcacatagag 600

gaagttgaag gaattatgta cgggaatgct ccgagagggg atgcaatata tattaacaac 660

tttattatag ataaacatca tagagtatac agattcgggg ggtcttgtcg aatgaaattc 720

tgtaataaag atggtataaa attcacaaga ggagactggg tagaaaaaac agctggaaca 780

ttgacgaata tttatgcaaa tatacctgaa tgtgctgatg gaacgttggt atctggtcac 840

cgacctggat tagacttgat tgacacagtc ttcaatttgg aaaatgtggt agaatatact 900

ttgtgtgagg ggactaaaag aaaaatcaat aaccaagaaa agttgacgtc agtggatttg 960

agttatttgg ccccaagaat tggagggttc ggatcagtat tcagagtgag aaacggaaca 1020

ttagagagag ggagcactac ttatatcaag atagaagtag agggacctat tgtcgactcg 1080

ttgaatggaa cagatccgag aaccaacgcc tcaagagtat tttgggacga ctgggagtta 1140

gatggcaata tatatcaggg ctttaatggt gtatataaag ggaaagatgg gaagatccat 1200

attcccttga atatgataga atcaggaatc atagatgatg aacttcaaca tgctttccaa 1260

gccgatatta tccctcatcc tcattatgac gacgatgaaa tccgagagga cgatatattc 1320

ttcgataata ctggagaaaa tggaaatccc gtggatgcag tggtagaatg ggtcagtggg 1380

tggggaacta gtctaaaatt ctttggcacg actctggtcg ccctgatttt gatctttctg 1440

ctcatcaggt gctgtgttgc ttgcacttat ttgatgaaga agagtaaacg gcctgcaaca 1500

gaatcacacg aaatgcggtc cttcgtttga 1530

<210> 2

<211> 201

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

atgagctaca acatgagggc actgggactg attcttataa ctctgctgct gctgacagtg 60

ggtgaagctg atgacacgga tgtacagggc tggacttgcg gatatcgagg gctgtgcaga 120

aagcactgct atgcgcagga gtacatgatt ggctaccatg gttgccctcg aagatacagg 180

tgctgtgctt tgcgatttta a 201

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

ggtggaggcggttcaggcggaggtggctct 30。

Claims (6)

1. An oral vaccine for resisting spring viremia of carp virus, which is characterized in that: the oral vaccine is formed by constructing fusion protein by connecting a carp spring viremia virus antigen protein and a yellow river carp defensin protein through a flexible joint, expressing the fusion protein in escherichia coli and enriching the fusion protein through a biological vector, wherein the encoding gene sequence of the fusion protein comprises 64-1389bp of a carp spring viremia virus antigen protein truncated fragment and 70-201bp of a yellow river carp defensin protein signal peptide-removing part gene fragment, and a flexible joint fusion gene connecting two groups of gene fragments;

wherein the nucleotide sequence of the carp spring viremia virus antigen protein coding gene is shown as SEQ ID NO. 1;

the nucleotide sequence of the yellow river carp defensin protein coding gene is shown as SEQ ID NO. 2;

the nucleotide sequence of the flexible joint fusion gene is shown as SEQ ID NO. 3.

2. An oral vaccine against spring viremia of carp virus according to claim 1, characterized in that: the prokaryotic expression plasmid pET-28a used for expressing the fusion protein in escherichia coli contains a green fluorescent protein GFP tag.

3. An oral vaccine against spring viremia of carp virus according to claim 1, characterized in that: the biological carrier is a freshwater calyx flower armyworm which is favored by carp.

4. An oral vaccine against spring viremia of carp virus according to claim 1, characterized in that: the end of 64-1389bp of the truncated segment of the carp spring viremia virus antigen protein gene is connected with the head end of 70-201bp of the partial gene segment of the yellow river carp defensin protein de-signal peptide through a flexible joint fusion gene to form a fusion protein coding gene.

5. A method for preparing an oral vaccine against spring viremia of carp virus according to any one of claims 1-4, characterized by comprising the following steps;

step S1, respectively amplifying to obtain a carp spring viremia virus antigen protein coding gene sequence and a yellow river carp defensin protein coding gene sequence, carrying out sequence analysis on the carp spring viremia virus antigen protein coding gene sequence, removing N-terminal signal peptide, combining amino acid hydrophobicity and antigenic determinants corresponding to the encoded carp spring viremia virus antigen protein, selecting an amino acid fragment which has good antigenicity and is easy to express, wherein the corresponding gene sequence is 64-1389bp of the truncated segment of the carp spring viremia virus antigen protein, carrying out sequence analysis on the yellow river carp defensin protein coding gene sequence, removing N-terminal signal peptide, selecting other amino acid sequences, and selecting the corresponding gene sequence as 70-201bp of the yellow river carp defensin protein signal peptide removing partial gene fragment;

s2, connecting 64-1389bp of a truncated segment of a carp spring viremia virus antigen protein gene and 70-201bp of a partial gene segment of a yellow river carp defensin protein signal peptide removal part through a flexible joint fusion gene and inserting the partial gene segment into an MCS region of a pET-28a-GFP plasmid to construct a recombinant plasmid;

step S3, transforming the recombinant plasmid into Rosetta (DE 3) competent cells, and performing induced expression on positive clones after bacterial liquid PCR screening and sequencing verification: shaking bacteria until OD600 is 0.5-0.6, adding IPTG with different concentrations, placing the bacteria at 28 ℃ for overnight culture, taking 1mL of bacterial liquid, centrifugally collecting bacterial bodies, washing the bacterial bodies with PBS, adding 40 mu L of protein lysate, adding protein loading buffer solution for boiling denaturation, cooling, performing SDS-PAGE electrophoresis separation, and identifying protein expression after coomassie brilliant blue staining and decoloration;

step S4, centrifugally collecting bacterial liquid for inducing expression, washing for 3 times by using PBS, finally preparing the bacterial liquid into the same concentration by using PBS, observing the expression condition of fluorescent protein under a fluorescent microscope, inactivating the rest of the bacterial liquid by formalin, centrifuging, washing for 3 times by using PBS to remove the formalin, and preserving for later use;

and S5, feeding the fusion protein prokaryotic expression bacteria expressing fluorescence to rotifers, detecting fluorescence intensity under a fluorescence microscope after 1h, photographing, feeding the prokaryotic expression bacteria to the rotifers respectively, judging the protein enrichment degree according to the fluorescence intensity, and then collecting the rotifers by using a 300-mesh screen, and storing at the current use or at the temperature of minus 80 ℃ for later use.

6. Use of an oral vaccine against spring viremia of carp according to any one of claims 1-4 as an oral vaccine for preventing or treating spring viremia of carp.

Images