CN1161126C - Composition for preparing medicines, beautifying and cosmetics and its application - Google Patents
Composition for preparing medicines, beautifying and cosmetics and its application Download PDFInfo
- Publication number
- CN1161126C CN1161126C CNB991169999A CN99116999A CN1161126C CN 1161126 C CN1161126 C CN 1161126C CN B991169999 A CNB991169999 A CN B991169999A CN 99116999 A CN99116999 A CN 99116999A CN 1161126 C CN1161126 C CN 1161126C
- Authority
- CN
- China
- Prior art keywords
- medical science
- mrna
- beauty treatment
- polynucleotide
- cosmetic composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Landscapes
- Cosmetics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention discloses a composition for medicine, cosmetology and cosmetics. The composition comprises at least one kind of polynucleotide and acceptable base materials in medicine, cosmetology and cosmetics, wherein the polynucleotide is selected from the antisense polynucleotide fragments of tyrosinase coding genes or mRNA thereof, endothelin-1 coding genes or mRNA thereof, DHI-CA oxidase coding genes or mRNA thereof, or dopachrome transferase coding genes or mRNA thereof. The present invention also relates to the application of the composition for medicine, cosmetology and cosmetics. By the liposome or other gene importation technology, the composition blocks, closes or decreases the synthesis of skin melanin, suppresses skin pigmentation and prevents pigment from deepening after skin damage and concrescence by the principle of antisense nucleic acid gene therapy after entering skin cells or being absorbed by skin cells.
Description
The present invention relates to the medical cosmetology cosmetic field, relate more specifically to a kind of antisense polynucleotides that utilizes and suppress medical science, beauty treatment and cosmetic composition and the application thereof that melanin generates as active component.
Pigment in the skin mainly is melanin, carotene and oxidized heme.Carotene is a kind of of carotenoid, and it enters human body by food, enters blood by small intestinal, is taken in the skin by blood, under the deposition, catches yellow to skin at an easy rate in the horny layer of skin.Carotene in the general female skin is more than the male; The task of hemoglobin is to transport oxygen everywhere to health, and the hemoglobin of carrying oxygen molecule presents cerise, and they flow, allow skin ruddy, full of vitality in fine and closely woven blood vessel.Melanic content in the colour of skin and the skin, the power of form that melanin exists and melanocyte generation melanin ability is relevant.If melanic content is few, what skin reflected is exactly the color of blood, and this is to be exactly the best colour of skin white touched with red that people dream of.
Melanin be in the skin most important pigment it be that melanosome in the melanocyte produces.Melanocyte is to be derived by neural valley in the embryo and get, and migrates in a lot of tissues of human body, comprises the bottom of epidermis and ball top etc., melanocyte has dendroid prominent, how occurring with the mitosis form, it does not have desmosome, and is confined to the basement membrane near epidermis.Dendroid protrudes into the epidermis angle albuminous cell, and its function is to pass to angle albuminous cell with sophisticated melanin granule.
Tyrosine → DOPA (DOPA) → DOPA quinone → dopachrome → DHICA, DHI → melanin
↑ catalysis ↑ catalysis ↑ catalysis ↑ catalysis
Tryrosinase tryrosinase dopachrome interconvertible enzyme DHICA oxidase
This Zhang Tu has represented in recent years people to the up-to-date understanding of melanin forming process, therefrom as can be seen, tryrosinase, dopachrome interconvertible enzyme, DHICA oxidase play a part to know clearly very big therein, and under their help, tyrosine changes into melanin step by step.After melanin formed, a part can be decomposed, and excreted by kidney, and another part can come off along with coming off of epidermis cell.This process roughly needed for 4 weeks concerning youngster, the old people may need more than 10 weeks.
The forming process of pigment in the tryrosinase control melanocyte.Tyrosinase catalysis melanin forms a step of the most critical that is beginning, and promptly tyrosine is converted into the DOPA quinone.It is generally acknowledged that the level of activity of tryrosinase plays significant feature to the deposition of pigment.
The beginning of the nineties, scientist found that another is present in the material of outside, also added fuel to the flames playing a part, and was the main cause that forms mottle.Owing to be to find in the endothelium of blood vessel the earliest, so be called as Endothelin, it is the horn cell generation of skin in fact, and when skin is subjected to extraneous stimulation, such as intensive ultraviolet radiation, Endothelin just a large amount of real estate masters come out.Melanocyte receives Endothelin, has just obtained quicken making melanic information, and tryrosinase also is activated like this, melanin is bred in a large number, and skin is with regard to blackening.If how many differences of the Endothelin that the skin zones of different produces, skin will produce mottle.
Tryrosinase above-mentioned, dopachrome interconvertible enzyme, DHICA oxidase and Endothelin are called for short " three enzymes, one element ", are the materials that plays an important role in the skin darkening process, also are the breaches that solves the melanin problem.
Suppressing melanic generation, all is important problem from skin physiology and medical science and the angle of improving looks.At present, suppress melanic generation and mainly be to utilize some chemicals to disturb the process of the formation and the transfer of pigment, comprising: (1) selective destruction melanocyte, suppress the formation of melanin granule and change its structure; (2) biosynthesis of inhibition tyrosine suppresses melanic generation; (3) transfer of interference melanin granule; (4) to melanic chemical action and the degraded that increases melanin granule in the angle albuminous cell.Because the inhibitor that these melanin generate is having skin and stimulate and sensitization in various degree all, so must be prudent when using.
Therefore, an object of the present invention is to provide a kind of new medical science, beauty treatment and cosmetic composition, said composition can or reduce the synthetic of dermal melanin from gene level blocking-up, sealing, thereby has avoided stimulation and the sensitization to skin that chemicals produced.
Another object of the present invention provides the application in suppressing the melanin generation of this medical science, beauty treatment and cosmetic composition.
The technical scheme that realizes that these purposes adopted will be described below.
A technical scheme of the present invention provides a kind of medical science, beauty treatment and cosmetic composition, this medical science, beauty treatment and cosmetic composition comprise at least a polynucleotide and the acceptable substrate of medical science, beauty treatment and used for cosmetic, and wherein said polynucleotide are the antisense polynucleotides fragments that are selected from tryrosinase encoding gene or its mRNA, endothelin-1 encoding gene or its mRNA, DHICA oxidase encoding gene or its mRNA or dopachrome transferring enzyme encoding gene or its mRNA.
Another technical scheme of the present invention relates to the application in blocking-up, sealing or minimizing dermal melanin are synthetic of medical science of the present invention, beauty treatment and cosmetic composition.
The appended accompanying drawing of this paper has been described the aminoacid sequence and the coding gene sequence thereof of the tryrosinase that the present invention relates to, endothelin-1, DHICA oxidase, dopachrome transferring enzyme.
Fig. 1 has described the aminoacid sequence and the gene order thereof of tryrosinase.
Fig. 2 has described the aminoacid sequence and the gene order thereof of endothelin-1.
Fig. 3 has described the aminoacid sequence and the gene order thereof of the plain transferring enzyme of DOPA.
Fig. 4 has described oxidasic aminoacid sequence of DHICA and gene order thereof.
Below in conjunction with accompanying drawing technical scheme of the present invention is described in detail.
One aspect of the present invention provides a kind of medical science, beauty treatment and cosmetic composition, said composition contains at least a polynucleotides, and containing acceptable matrix in medical science, beauty treatment or the cosmetics, wherein said polynucleotides are to be selected from the encoding gene of tyrosinase, endothelin-1, DHICA oxidizing ferment or dopachrome transferase or the antisense polynucleotides of its mRNA. The base length of polynucleotides is preferably 10-100 base or longer, and better is 10-50 base, and better is 15-25 base.
Antisense polynucleotides contained in the present composition can make with following methods: according to the sequence of tyrosinase, endothelin-1, DHICA oxidizing ferment and dopachrome transferase gene or mRNA, design length is the antisense polynucleotides of 10-100 base and synthesizes. The synthetic method of polynucleotides is well known to those skilled in the art, for example can be referring to Maniatis, the people's such as T " molecular cloning laboratory manual " (cold spring publishing house 1989 publishes) etc., or can make according to the specification that the manufacturer provides, therefore no further details to be given herein.
In the present invention, optionally described polynucleotides are done chemical modification, these chemical modifications are such as comprising: with sulfydryl replace the phosphoric acid hydroxyl in the DNA skeleton, synthetic mercapto for phosphoric acid, dimercapto for phosphoric acid, phosphoric acid DNA and peptide nucleic acid etc. methylate.
The degree that melanin that user and needs suppress generates is depended in the effectively generation of check melanin of content of contained polynucleotides as active principle in the composition, this consumption. But the common concentration of polynucleotides is preferably 0.1fmol/L-100 μ mol/L, and that better is 1fmol/L-10 μ mol/L.
The best is that contained polynucleotides comprise the antisense polynucleotides that is selected from tyrosinase, endothelin-1, DHICA oxidizing ferment and all these enzyme coding genes of dopachrome transferase or its mRNA in the composition among the present invention.
Medical science, beauty treatment and the cosmetic composition that another aspect of the present invention relates to the encoding gene that contains tryrosinase and/or endothelin-1 and/or DHICA oxidase and/or dopachrome transferring enzyme or mRNA antisense polynucleotides is in sealing, blocking-up or suppress the application of melanin in generating.This medical science, beauty treatment and cosmetic composition can directly be applied on the skin, or use iontophoresis, methods such as particle gun or calcium phosphate precipitation to promote polynucleotide to enter cell and bring into play its effect.
Know that now antisense polynucleotides can and make it inactivation with its complementary target gene (or its product) combination, and has very high sequence-specific.Thereby, suppress the absolute accurate method that specific gene complementary with it or mRNA are a kind of certain protein synthesis of blocking-up (thereby blocking its activity) with antisense DNA or RNA.In general, only need about 15 bases just can suppress from the people's gene group, to transcribe the activity of any specific mRNA that comes specifically.Therefore, antisense therapy is the information of the natural order of applying gene in itself, creates the ideal model of rational drug design.In addition, also can carry out artificial chemical modification, enable to arrive in the target tissue, to increase or to reduce the amount of certain target protein with sufficiently high concentration to these polynucleotide.
Antisense and have phosphorothioate odn to interact and the mechanism that induces biological action is very complicated, and may be diversified, because gene expression may be affected on different levels.Antisense Suppression can be generated to be translated on function each site in active proteinic each stage and work at mRNA.The main position of antisense molecule regulating action is in nucleus, and in complete cell, antisense polynucleotides can combine with their complementary order.This not still and mRNA, and also can with precursor mRNA even and DNA combination.Such combination just may be blocked and transcribe or montage; Or block ripe mRNA and be transported into cytoplasm.Prove that recently gene expression or virus replication can be directly by polynucleotide institute specific blockages.
Most of antisense polynucleotides are when when design or research, no matter in protokaryon or eukaryotic cell, its mechanism is all thought the pause of translating.Space steric effect be can produce by forming bifilar polynucleotide-mRNA structure (at 5 ' untranslated region of AUG start codon or its upstream), thereby ribosomal combination or inswept this mRNA stoped.Another kind of mechanism is that said target mrna may be degraded by RNase H nuclease, or is caused chemical damage by modified polynucleotide, thereby causes translation to pause.
Polynucleotide can wrap in the liposome or by forming complex with liposome, utilize the high affinity of liposome and cell and cell targeted, adsorb with cell, the exchange of fusion, fat, directly brought the polynucleotide of sealing into cell by cell endocytic etc., merge with cell membrane and in the transfered cell and improve therapeutic index or improve bioavailability.In addition also can be with particle gun or calcium phosphate precipitation method with the polynucleotide transfered cell.
In case the encoding gene of the tryrosinase in the compositions, endothelin-1, DHICA oxidase and/or dopachrome transferring enzyme or the antisense polynucleotides of mRNA are absorbed by skin keratin cell and melanocyte, it is with regard to expression capable of blocking or sealing tryrosinase, endothelin-1, DHICA oxidase and/or dopachrome transferring enzyme, thereby the principle by gene therapy is blocked, is sealed or reduces synthesizing of dermal melanin, suppress cutaneous pigmentation, the pigment after the healing of control skin injury is deepened.In addition, polynucleotide also can absorb 200-320nm wavelength band ultraviolet (UVB/C), and protection skin is avoided the ultraviolet injury of this frequency range, and has good moisture preserving and skin absorbs performance.
In the present composition in contained medical science, beauty treatment or the cosmetics acceptable substrate be some substrate commonly used when material is made up in preparation in this area.These substrate for example include but is not limited to phospholipid, lecithin, cholesterol, ether, sodium dihydrogen phosphate, carbomer etc.
In addition, also can mix whitening agent, excipient, spice etc. in the compositions of the present invention, and oils, surfactant, wetting agent, pH regulator agent, thickening agent, antiseptic, antioxidant, UV absorbent, pigment, emulsifying agent, the composition from animals and plants, vitamins, amino acids etc.These additives and consumption thereof should not make the polynucleotide passage fracture in the present composition.Described whitening agent for example comprises ascorbic acid phosphate such as Qu acid, arbutin, Placenta Hominis extract, ascorbic acid, phosphoric acid L-Magnesium ascorbate, ascorbic acid derivates, Cortex Mori extract, Radix Glycyrrhizae extract, lactobacillus bulgaricus factor-S-sulfoacid calcium etc.Described oils for example has liquid paraffin, paraffin, spermol, American Avocado Tree oil, olive oil, Herba Menthae crust oil, Cortex cocois radicis wet goods vegetative grease; Animal raw fats such as Adeps Bovis seu Bubali, leaf fat, horse fat, turtle oil, ermine oil, Lateolabrax japonicus (Cuvier et Va-lenciennes) (Lateolabracis) oil, squalane; Methyl polysiloxane, sorbitol, glycerol three caprinoyl decanoins, tricaprylin, glycerol three different cetylates, silicone wet goods synthetic ester oil etc.Described surfactant for example has cationic surface active agents such as sodium lauryl sulfate, triethanolamine lauryl sulfate, month silicic acid diglycollic amide; Cationic surface active agents such as chlorination stearoyl trimethyl ammonium, chlorination cetyl trimethyl ammonium, benzyl chloride alkanamine; Glyceryl monostearate, is got nonionic surfactant such as polyethylene (20) sorbitan monostearate, polyoxyethylene hardened castor oil, sucrose ester, fatty acid amide etc. at sorbitan monostearate.Described wetting agent for example has glycerol, propylene glycol, 1,3 butylene glycol, 2-pyrrolidone-5-carboxylic acid's soda, lactobacillus bulgaricus factor-synthetic wetting agents such as S-sulfonate; Hyaluronic acid, collagen protein, elastin laminin, Placenta Hominis extract, Lac regis apis, microbial fermentation solution, for example chitin, chitosan, pectin etc. with other from natural moisture preserving liquid such as extract of plant and animal etc.Described pH regulator agent for example has organic acid such as citric acid, sodium citrate and its esters etc.Described thickening agent for example has carboxymethyl cellulose, hydroxy methocel, hydroxyethyl-cellulose, carboxy vinyl polymer, polyvinyl alcohol, tragakanta, sodium alginate, carrageenin etc.Described antiseptic for example has methyl parahydroxybenzoate, ethylparaben, propyl p-hydroxybenzoate, butyl p-hydroxybenzoate, p-Hydroxybenzoate, phenyl phenol, ethanol, dehydroacetic acid etc.Described antioxidant for example has vitamin E, Yoshinox BHT (BHT), butylatedhydroxyanisole (BHA) etc.Described pigment for example has iron oxide red, iron oxide yellow, iron oxide black, titanium oxide, anti-imperial powder, sericite, Muscovitum, Talcum etc.Described emulsifying agent is soybean lecithin etc. for example.Described excipient for example has mannitol, sodium sulfate etc.
The various details specific embodiment.
Embodiment 1:
With ABI series (manufacturing of U.S. PE system company) or other serial dna synthesizers, according to Maniatis, the following polynucleotide of method solid phase synthesis that provide in people's such as T " the molecular cloning laboratory manual " (cold spring port publishing house 1989 publishes):
The anti-GCGGAGGTCTGGAAACTCCACAGCAGG antisense polynucleotides 1 of tryrosinase
Justice polynucleotide: CAGTACAAAACAGCCAGGAG
The anti-AAGCCACAAACAGCAGAGAGAAAATC antisense polynucleotides 2 of endothelin-1
Justice polynucleotide ATGAGCAAATAATC
Dopachrome shifts TGCAGCCCAAGCAACTGAGCAGAAACC antisense polynucleotides 3
Enzyme antisense polynucleotides CCCACCAAAGGGGGCT
DHICA oxidase C AGGACCAGGAACATGTAACCCAGAG antisense polynucleotides 4
Antisense polynucleotides AGAGGAGTGTAGGAGATTT
With above-mentioned synthetic each product at NH
3Environment was handled 12 hours for following 55 ℃, was suspended in again behind the vacuum drying in the ammonium acetate solution of 2.5mol/L, and with cold ethanol (20 ℃) precipitation of 2 times of volumes ,-80 ℃ of cold ethanol suspend, and precipitated, and drying can directly be used after estimating its content with spectrophotometer.
Embodiment 2:
Prescription:
| Composition | Weight portion |
| Tris (Tris) | 6.068 |
| HCl(1mol/L) | 42 |
| EDTA(0.1mol/L) | 0.5 |
| | 0.12 |
| H 2O | Add to 100 |
Method for making:, behind the adding HCl, pH is transferred to 7.5 with the HCl of 1mol/L or the NaOH of 1mol/L earlier with an amount of water dissolution Tris, add antisense polynucleotides 1, add water to the volume of setting at last, make the aqueous solution composition (prescription 1) that contains antisense polynucleotides, embedding is in proper container.
Embodiment 3:
Make the liquid composite (prescription 2) that contains antisense polynucleotides, the just antisense polynucleotides 1 that replaces wherein with 0.05 part of antisense polynucleotides 2 by embodiment 2 described methods.
Embodiment 4:
Make the liquid composite (prescription 3) that contains antisense polynucleotides, the just antisense polynucleotides 1 that replaces wherein with 0.005 part of antisense polynucleotides 3 by embodiment 2 described methods.
Embodiment 5:
Make the liquid composite (prescription 4) that contains antisense polynucleotides by embodiment 2 described methods, just with antisense polynucleotides 1,2,3,4 each compositionss of 0.01 part replacement antisense polynucleotides 1 wherein.
Embodiment 6:
| Composition | Percentage by weight |
| Lecithin | 0.925 |
| Cholesterol | 0.45 |
| Ether | 25 |
| | 2 |
| Water | Add to 100 |
Method for making: (1) gets lecithin, cholesterol, is dissolved in the ether.
(2) will fill a prescription 1 soluble in waterly, be heated to 55 ℃, under magnetic agitation, (1) slowly be splashed in (2), keep 50 ℃, and continue to stir 30 minutes, make the liposome composition (prescription 5) that contains antisense polynucleotides and embedding in proper container.
Embodiment 7:
Make the liposome composition (prescription 6) that contains antisense polynucleotides according to embodiment 6 described methods, just the prescription 4 with 2% (weight) replaces prescription 1.
Embodiment 8:
| Composition | Percentage by |
| Prescription | |
| 3 | 2 |
| Phospholipid | 2 |
| Cholesterol | 0.4 |
| Ether | 60 |
| Sodium dihydrogen phosphate 2H 2O | 0.165 |
| Sodium hydrogen phosphate | 3.37 |
| Water for injection adds to | Add to 100 |
Method for making: negate justice polynucleotide solution (prescription 3), phospholipid, cholesterol are dissolved in the ether, add phosphate buffer 80ml and shake up, sonic oscillation 30 minutes changes the thin film gyroscope over to, the evaporation ether promptly gets the multiphasic liposomes compositions that contains antisense polynucleotides to the greatest extent.Filter, embedding through 100 ℃ of water-baths sterilization in 20 minutes, makes the multiphasic liposomes compositions (prescription 7) that contains antisense polynucleotides in proper container.
Embodiment 9:
Make the multiphasic liposomes compositions (prescription 8) that contains antisense polynucleotides according to embodiment 8 described modes, just replace prescription 3 with same percentage prescription 4.
Embodiment 10:
| Composition | Percentage by weight |
| Carbomer | 0.2 |
| Prescription 4 | 2 |
| Water | Add to 100 |
Method for making: after carbomer being dissolved in fully the water of 10 times of weight, mix, add water to 100%, make the gel combination that contains antisense polynucleotides (prescription 9) embedding in proper container with antisense polynucleotides.
Embodiment 11:
The melanin of the research present composition suppresses level below.According to the assay method of describing in " functional cosmetics assay method " (1998) such as Mao Peikun, use the melanin of the malignant melanoma test cell line present composition to suppress level:
(1) hyclone that adds 10% concentration in the MEM culture fluid is done the cultivation of going down to posterity of B-16 melanoma cell.The occasion that can reduce in proportion with incubation times for the chromogenesis of melanoma cell, not only want the strict batch of selecting serum, and to separate new melanoma cell at the subcutaneous propagation melanoma of the BL57 Mus back of the body often, select the melanoma cell that wherein chromogenesis can be high.
(2) tone according to cell granulations suppresses the algoscopy that melanin produces
When adding 0.1% glycosamine and being cultured to the complete albefaction of B-16 melanoma cell, the flush away glycosamine, the theophylline that adds 2mmol/L again, promote to be returned to the melanin synthetic state, add test specimen simultaneously, the melanin of formulating new life by 5 stages of following standard according to the tone of cell granulations suppresses effect:
The tone of cell granulations
0 ... with to be identical black in the same old way
1 ... with to compare lighter slightly black in the same old way
2 ... with to compare obviously lighter black in the same old way
3 ... nearly gray black
4 ... Lycoperdon polymorphum Vitt
5 ... white
The amount of cell granulations
1 ... with to commensurability in the same old way
2 ... less slightly
3 ... obviously few
The result is presented in the following table 1.
Table 1
The amount of the tone cell granulations of formula number cell granulations
15 grades 3 grades
24 grades 3 grades
34 grades 2 grades
45 grades 3 grades
54 grades 2 grades
65 grades 2 grades
74 grades 3 grades
85 grades 3 grades
As can be seen from the above table, the compositions that contains the antisense polynucleotides of the encoding gene of any enzyme in tryrosinase, dopachrome interconvertible enzyme, DHICA oxidase and the Endothelin or mRNA suppresses 2/3 grade of level of amount that effect all can reach 4/5 grade of tone level and cell granulations to new life's melanin, and the segmental mixture of antisense polynucleotides that contains various enzymes then can reach 2/3 grade of level of amount of 5 grades of levels and cell granulations.
Embodiment 12:
With 10 women as object, with spectral photometric colour measuring meter CM-1000 thereon the wrist medial part measure 2 * MED (Minimum Erythema Dose) postradiation melanin exponential sum of UV erythema index curve over time.Meansigma methods is measured in numeric representation in the table.Use group 1 and group 2: measure the last hour inherent position of measuring and smear prescription 5 and prescription 6, once a day later on; Matched group: only smear other substrate except that antisense polynucleotides component of the present invention among the embodiment 6, usage is identical.
According to (China Light Industry Press such as Mao Peikun " functional evaluation of cosmetics and analytical method ", 1998) method is made following mensuration: the specific reflection beam splitting characteristic of utilizing the pigment that constitutes skin-color, select light source according to hemoglobin in the skin and melanic absorption spectrum, with 568nm and 655nm as two kinds of specific wavelengths, with reference to the JIS Z8722 of Japanese Industrial Standards diffused illumination/vertically be subjected to light mode.With spectral photometric colour measuring meter (CM-1000), make light source with the pulse neon lamp, measure catoptrical intensity.It is 8mm that contact is measured diameter.Calculate erythema and Pigmented degree as erythema exponential sum melanin index with following formula.
Erythema index=lg (1/G)-lg (1/R)
Melanin index=lg (1/R)
In the formula: the catoptrical intensity of G--green light
The catoptrical intensity of R--red light
The result is presented in following table 2 and 3.
Table 2 melanin exponential quantity
| 0 | 1 day | 2 | 3 days | 7 days | 14 days | 21 days | 28 days | 35 days | 56 days | |
| Matched group | ?59.1 | ?58.8 | ?64.5 | ?67.7 | ?71.0 | ?69.8 | ?68.1 | ?68.0 | ?67.6 | ?67.0 |
| | ?59.1 | ?59.0 | ?60.9 | ?61.2 | ?62.1 | ?61.0 | ?58.6 | ?58.5 | ?58.3 | ?58.3 |
| Group 2 | ?59.1 | ?58.9 | ?60.2 | ?60.5 | ?60.9 | ?60.1 | ?59.0 | ?58.6 | ?58.3 | ?58.2 |
Table 3 erythema exponential quantity
| 0 | 1 day | 2 | 3 days | 7 days | 14 days | 21 days | 28 days | 35 days | 56 days | |
| Matched group | ?11.5 | ?25.1 | ?19.5 | ?17.8 | ?17.5 | ?17.0 | ?16.7 | ?16.2 | ?15.9 | ?15.2 |
| | ?11.5 | ?17.9 | ?15.5 | ?15.4 | ?14.3 | ?13.9 | ?13.4 | ?12.9 | ?12.7 | ?12.3 |
| Group 2 | ?11.5 | ?17.1 | ?15.3 | ?15.1 | ?14.3 | ?13.5 | ?13.2 | ?12.7 | ?12.4 | ?12.1 |
The result shows that the compositions that contains " three enzymes, one element " encoding gene or mRNA antisense polynucleotides is not only inhibited to dermal melanin, and can reduce the damage of ultraviolet to skin.
Clearly, based on the top description of doing, can do many-sided change to these methods.Such change can not be regarded as having exceeded spirit of the present invention and purpose, is that conspicuous change all should be included within the interest field of the presently claimed invention for those experts in this area.
Claims (7)
1. a medical science, beauty treatment and cosmetic composition, this medical science, beauty treatment and used for cosmetic comprise at least a polynucleotide and the acceptable substrate of medical science, beauty treatment and used for cosmetic with compositions, and wherein said polynucleotide are the antisense polynucleotides fragments that are selected from tryrosinase encoding gene or its mRNA, endothelin-1 encoding gene or its mRNA, DHICA oxidase encoding gene or its mRNA or dopachrome transferring enzyme encoding gene or its mRNA.
2. medical science according to claim 1, beauty treatment and cosmetic composition, the base length of wherein said antisense polynucleotides fragment sequence are 10-100.
3. medical science according to claim 1, beauty treatment and cosmetic composition, wherein said polynucleotide be through or without the polynucleotide of chemical modification.
4. medical science according to claim 3, beauty treatment and cosmetic composition, wherein said modification be with sulfydryl replace the phosphoric acid hydroxyl in the DNA skeleton, synthetic mercapto for phosphoric acid, dimercapto for phosphoric acid, phosphoric acid DNA and peptide nucleic acid(PNA) etc. methylate.
5. medical science according to claim 1, beauty treatment and cosmetic composition, the concentration of wherein said polynucleotide are 0.1fmol/L-100 μ mol/L.
6. medical science according to claim 1, beauty treatment and cosmetic composition, it further also comprises, and other is sun-proof, skin protection and cytokine quasi drugs, cosmetics and cosmetics.
7. the application of the described medical science of claim 1, beauty treatment and the cosmetic composition non-therapeutic purposes in blocking-up, sealing or minimizing dermal melanin are synthetic.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB991169999A CN1161126C (en) | 1999-10-19 | 1999-10-19 | Composition for preparing medicines, beautifying and cosmetics and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB991169999A CN1161126C (en) | 1999-10-19 | 1999-10-19 | Composition for preparing medicines, beautifying and cosmetics and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1293038A CN1293038A (en) | 2001-05-02 |
| CN1161126C true CN1161126C (en) | 2004-08-11 |
Family
ID=5279648
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB991169999A Expired - Lifetime CN1161126C (en) | 1999-10-19 | 1999-10-19 | Composition for preparing medicines, beautifying and cosmetics and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1161126C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2890859B1 (en) * | 2005-09-21 | 2012-12-21 | Oreal | DOUBLE-STRANDED RNA OLIGONUCLEOTIDE INHIBITING TYROSINASE EXPRESSION |
| CN115624497B (en) * | 2022-09-07 | 2023-06-27 | 完美（广东）日用品有限公司 | Liposome for encapsulating deoxyribonucleic acid or ribonucleic acid, and preparation method and application thereof |
-
1999
- 1999-10-19 CN CNB991169999A patent/CN1161126C/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| CN1293038A (en) | 2001-05-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100336521C (en) | Composition comprising melissa leaf extract for anti-angiogenic and matrix metalloproteinase inhibitory activity | |
| CN1026064C (en) | Preparation process for composite inhibiting activated | |
| CN1136315A (en) | Method for preparing concentrated biologically active silicon compounds | |
| CN108261367A (en) | A kind of anti-aging moisturizing essence and preparation method thereof | |
| CN101134009B (en) | Skin care composition and its uses | |
| Chakraborty et al. | Aqueous extract of human placenta as a therapeutic agent | |
| CN1301666C (en) | Health food capable of raising immunity and its production process | |
| CN105007990B (en) | The purposes of cosmetic composition from fish artemia hatching solution, its production method and its aesthetic appearance for being used to improving skin | |
| CN108721320A (en) | The application of micromolecule hyaluronic acid segment | |
| CN101180034A (en) | Preparation for hair care | |
| KR20070099450A (en) | Compounding ingredients for basic cosmetics and basic cosmetics | |
| CN103347531A (en) | Skin collagen production promoter | |
| CN105213210A (en) | Use of surfactin in cosmetics | |
| CN108653732B (en) | PH-responsive ferroferric oxide nanoparticle and preparation method and application thereof | |
| CN1161126C (en) | Composition for preparing medicines, beautifying and cosmetics and its application | |
| CN103892269A (en) | Black medlar sun-screening and whitening tablet | |
| KR20120130180A (en) | Method for degrading organic material using mother cell lyases formed in association with spore formation of microorganism | |
| CN1660048A (en) | Frost-like powder possessing effects of beautification and nourishing face | |
| CN104152401A (en) | CHMM1 culture medium suitable for in-vitro culture of Chinese epidermal melanocytes | |
| CN1053568C (en) | Herbal medicine health cosmetic series products and its preparing method | |
| CN101299991A (en) | Fibroblast activator, method for activation of fibroblast, collagen synthesis promoter, method for promotion of collagen synthesis, skin aging-preventing agent, and method for prevention of aging of t | |
| CN1289062C (en) | Cosmetic material | |
| TWI354562B (en) | Enzymatic hydrolysate of algae for promoting growt | |
| CN110151677A (en) | Mescenchymal stem cell extract, extracting method and the application in terms of skin-tightening and anti-aging of gene modification | |
| CN104367992A (en) | New application of type I collagen in preparation of medicament for treating and/or preventing psoriasis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CX01 | Expiry of patent term |
Granted publication date: 20040811 |
|
| CX01 | Expiry of patent term |