CN116103314A

CN116103314A - Nitrogen regulatory gene GDS1 from arabidopsis and wheat and application thereof

Info

Publication number: CN116103314A
Application number: CN202310063106.5A
Authority: CN
Inventors: 王勇; 樊红梅; 权姝璇; 叶晴; 刘玮; 朱宁; 张晓琪; 齐盛东
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2023-01-17
Filing date: 2023-01-17
Publication date: 2023-05-12

Abstract

The invention discloses nitrogen regulatory gene GDS1 from arabidopsis and wheat and application thereof, belonging to the technical field of plant genetic engineering. The invention discovers a new nitrogen regulatory gene AtGDS1 in Arabidopsis for the first time, which can delay leaf senescence under low-nitrogen and high-nitrogen conditions; the AtGDS1 gene can also improve plant height, pod length, grain size, thousand grain weight, single plant yield and nitrogen utilization rate of plants under low nitrogen and high nitrogen conditions. Based on the AtGDS1 gene, the invention further discovers the TaGDS1 gene in wheat, which can improve the particle size, hundred-grain weight and single plant yield of wheat under low nitrogen and high nitrogen. The invention provides a new thought and direction for cultivating high-nitrogen-efficiency crop varieties with higher nitrogen utilization efficiency under low-nitrogen and high-nitrogen conditions.

Description

Nitrogen regulatory gene GDS1 from arabidopsis and wheat and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a nitrogen regulatory gene GDS1 from Arabidopsis and wheat and application thereof.

Background

Nitrogen is one of the major elements necessary for plant growth and development, and can regulate various processes of plant metabolism and growth and development, such as absorption and assimilation of nitrogen (Xu et al, 2016), secondary metabolism (e.g., anthocyanin synthesis) (Fritz et al, 2006), root system configuration (Gan et al, 2012), seed germination (alborei et al, 2005), and leaf senescence (Aguera et al, 2010; zhao et al, 2011; meng et al, 2016; liu et al, 2017; park et al, 2014,2018,2019), and the like. Leaf senescence is the final stage of leaf development, a developmental process caused by chlorophyll and chloroplast degradation, macromolecular substance breakdown, and nutrient redistribution (Sakuraba et al, 2014).

Several families of genes that regulate senescence have been identified so far, such as NAC, WRKY, bHLH, MYB, C H2 zinc finger, AP2-EREBP and bZIP families, etc. (Miao et al, 2004; buchanan-Wollaston et al, 2005; guo et al, 2006;Smykowski et al, 2010; song et al, 2014; guo et al, 2017; wang et al, 2021; yu et al, 2021; zhang et al, 2022). Various biotic and abiotic stresses in nature can cause senescence of plant leaves, such as drought, high temperature, high salt, darkness, hormones, pathogenic bacterial infections, and nutrient deficiencies, etc. (Lim et al, 2007;Aguera et al, 2010;Balazadeh et al, 2010; song et al, 2014;Liebsch et al, 2016; zhang et al, 2018; yu et al, 2021; li et al, 2021).

Previous studies have shown that low nitrogen induces leaf senescence to meet the nitrogen demand of young and developing tissues (Aguera et al, 2010). In agricultural production, nitrogen deficiency often causes premature senility of crops, resulting in yield reduction; the application of the nitrogenous fertilizer can inhibit aging caused by low nitrogen and ensure the high and stable yield of crops. On the other hand, the high nitrogen application results in reduced nitrogen utilization efficiency of crops, causing a series of environmental problems such as soil acidification and water eutrophication (Guo et al, 2010; zhang et al, 2015; shin et al, 2020; wu et al, 2020; liu et al, 2021). Therefore, the cultivation of new varieties with low nitrogen late senescence and high yield is important to improve the yield of crops and the utilization efficiency of nitrogen under the condition of lower nitrogen supply and promote the green and high-quality development of modern agriculture.

Disclosure of Invention

In view of the above prior art, an object of the present invention is to provide nitrogen regulatory gene GDS1 derived from Arabidopsis thaliana and wheat and uses thereof.

In a first aspect of the present invention, there is provided the use of a GDS1 gene as a nitrogen regulatory gene in at least one of the following (1) - (4):

(1) Delaying leaf senescence of plants under low and high nitrogen;

(2) The plant height, the pod length, the grain size and the grain weight of the plants under the low-nitrogen and high-nitrogen conditions are improved;

(3) The single plant yield and the nitrogen utilization rate of plants under low nitrogen and high nitrogen conditions are improved;

(4) Cultivating a crop variety with high nitrogen efficiency;

the nucleotide sequence of the GDS1 gene is shown as any one of SEQ ID No.1 and SEQ ID No.3-SEQ ID No. 8.

In the above application, the plant is preferably Arabidopsis thaliana or wheat.

In the above application, the GDS1 gene is derived from Arabidopsis thaliana or wheat; preferably, the GDS1 gene is an AtGDS1 gene, and the nucleotide sequence of the gene is shown as SEQ ID No. 1; or the GDS1 gene is a TaGDS1 gene, and the nucleotide sequence of the GDS1 gene is shown as SEQ ID No.3-SEQ ID No. 8.

In a second aspect of the present invention, there is provided the use of a protein encoded by a GDS1 gene in at least one of the following (1) - (3):

(1) Delaying leaf senescence of plants under low and high nitrogen;

(3) The single plant yield and the nitrogen utilization rate of plants under the low-nitrogen and high-nitrogen conditions are improved.

In the application, the amino acid sequence of the protein encoded by the GDS1 gene is shown as any one of SEQ ID No.2 and SEQ ID No.9-SEQ ID No. 14.

In a third aspect of the present invention, there is provided the use of a recombinant expression vector or recombinant bacterium comprising a GDS1 gene in at least one of the following (1) - (4):

(1) Delaying leaf senescence of plants under low and high nitrogen;

(4) Cultivating the crop variety with high nitrogen efficiency.

In the application, the recombinant expression vector is constructed by adopting the existing plant expression vector. Such as pPZP211-GFP, pCambia3301, pc186 or other derived plant expression vectors.

The host cell of the recombinant bacterium can be escherichia coli, agrobacterium and the like.

In a fourth aspect of the present invention, there is provided a method for increasing nitrogen utilization in a plant, comprising: and a step of overexpressing the GDS1 gene in the plant.

In the method, the GDS1 gene in the plant is over-expressed by an exogenous transfer GDS1 gene method; or up-regulating the expression of the GDS1 gene or a homologous gene thereof in the plant genome.

In a fifth aspect of the present invention, there is provided a cultivation method of a crop variety with high nitrogen efficiency, comprising the steps of:

and transferring the GDS1 gene into a wild plant and over-expressing the GDS1 gene, and screening to obtain a plant with improved nitrogen utilization rate, thereby obtaining the high-nitrogen-efficiency crop.

In the above method, the GDS1 gene is also derived from Arabidopsis thaliana or wheat; preferably, the GDS1 gene is an AtGDS1 gene, and the nucleotide sequence of the gene is shown as SEQ ID No. 1; or the GDS1 gene is a TaGDS1 gene, and the nucleotide sequence of the GDS1 gene is shown as SEQ ID No.3-SEQ ID No. 8.

The invention has the beneficial effects that:

the invention discovers a new nitrogen regulatory gene AtGDS1 in Arabidopsis for the first time, which can delay leaf senescence under low-nitrogen and high-nitrogen conditions; the AtGDS1 gene can improve plant height, pod length, seed size, thousand seed weight, single plant yield and nitrogen utilization rate of plants under low nitrogen and high nitrogen conditions. Based on the AtGDS1 gene, the invention further discovers the TaGDS1 gene in wheat, which can improve the particle size, hundred-grain weight and single plant yield of wheat under low nitrogen and high nitrogen. The invention provides a new thought and direction for cultivating high-nitrogen-efficiency crop varieties with higher nitrogen utilization efficiency under low-nitrogen and high-nitrogen conditions.

Drawings

Fig. 1: vector map of pPZP211-GFP overexpression vector.

Fig. 2: research on improving nitrogen utilization rate of AtGDS1 over-expression strain. WT, atGDS1-OE-1, atGDS1-OE-2 in a solution containing 0.5mM, 1mM and 5mM KNO, respectively ₃ The medium was incubated in a medium, leaf senescence phenotype was observed at maturity (FIG. 2A), plant height was counted (FIG. 2B, D), pod length (FIG. 2C, E), grain size (FIG. 2F), thousand kernel weight (FIG. 2G), individual plant yield (FIG. 2H) and nitrogen utilization (FIG. 2I).

AtGDS1-OE-1 and AtGDS1-OE-2 are all over-expressed strains of AtGDS1, except for different strains formed by different transformation events, wherein there is a difference in the over-expression fold of AtGDS 1. Two different strains were used mainly to exclude that the changes in nitrogen utilization index we see were not due to the insertion site.

Fig. 3: phylogenetic tree analysis of wheat TaGDS 1.

Fig. 4: wheat CRISPR/Cas9 vector pBUE413 vector map.

Fig. 5: wheat pc186 overexpression vector profile.

Fig. 6: research on nitrogen utilization rate improvement of TaGDS1 over-expression strain. Wild wheat Fielder, taGDS1-3-9, taGDS1-11-9, taGDS1-OE-1, taGDS1-OE-2 were grown on high nitrogen (5 mM KNO) ₃ ) Seed size (FIG. 6A) and hundred grain weight (FIG. 6B) and individual yield (FIG. 6C) were counted after maturation in the medium.

the tagds1-3-9 and the tagds1-11-9 are knockout mutants obtained by using the CRISPR/Cas9 technology, and are only different mutants formed by different knockout forms; taGDS1-OE-1 and TaGDS1-OE-2 were both overexpressed strains of TraesCS5D02G503700, except for the different strains resulting from different transformation events, where there was a difference in the fold over-expression of TaGDS 1. Two different strains were used mainly to exclude that the changes in nitrogen utilization index we see were not due to the insertion site.

Detailed Description

It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As previously mentioned, in agricultural production, nitrogen deficiency tends to cause premature senescence of crops, resulting in reduced yield; the application of the nitrogen fertilizer can inhibit aging caused by low nitrogen and ensure high and stable yield of crops, but the excessive application amount of the nitrogen fertilizer can also cause the reduction of the nitrogen utilization efficiency of crops and cause a series of environmental problems. Therefore, how to ensure the high and stable yield of crops under the conditions of low nitrogen and high nitrogen is a problem to be solved urgently.

Based on the above, the invention carries out intensive research on the gene for regulating and controlling the nitrogen utilization of plants, and discovers that the overexpression of the AtGDS1 gene in arabidopsis thaliana can delay the leaf senescence of plants under the conditions of low nitrogen and high nitrogen, thereby improving the yield and the nitrogen utilization rate of the plants. The nucleotide sequence of the AtGDS1 gene is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 2.

Furthermore, the invention finds out the TaGDS1 family in wheat by utilizing a bioinformatics method, and performs evolutionary analysis on the wheat TaGDS1 family to find out 2 genes with higher homology, comprising 6 subgenomic groups, which are respectively: traesCS2A02G143700, traesCS2B02G168700, traesCS2D02G147300, traesCS5A02G488700, traesCS5B02G502600, and TraesCS5D02G503700; the nucleotide sequences are shown as SEQ ID No.3-SEQ ID No.8, and the amino acid sequences of the encoded proteins are shown as SEQ ID No.9-SEQ ID No. 14. The invention constructs an over-expression system and a knockout mutant of the TaGDS1 gene respectively, and discovers that the over-expression of the TaGDS1 gene in wheat can improve the grain size, the hundred grain weight and the single plant yield of the wheat under the conditions of low nitrogen and high nitrogen.

Therefore, the GDS1 gene from Arabidopsis and wheat can be used as a nitrogen regulating gene, and the overexpression of the GDS1 gene can delay premature senility of leaves of plants under low nitrogen and high nitrogen, and improve the yield and the nitrogen utilization efficiency.

In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples of the present invention are all conventional in the art and are commercially available. The experimental procedure, without specifying the detailed conditions, was carried out according to the conventional experimental procedure or according to the operating instructions recommended by the suppliers.

Example 1: construction of arabidopsis AtGDS1 gene overexpression strain and performance investigation thereof

1. Construction of an Arabidopsis AtGDS1 Gene overexpression line:

the coding region of the arabidopsis AtGDS1 gene is cloned by a PCR method, and a plant over-expression vector of the gene is constructed.

The coding region of the AtGDS1 gene was PCR amplified using the normally growing seedling stage Arabidopsis leaf cDNA as a template, with an upstream primer 5'-atggtaccATGAATCCAT TGAC-3' (SEQ ID No. 15) and a downstream primer 5'-atgtcgacACGACGGCGATCTT-3' (SEQ ID No. 16).

The amplified product was excised and recovered, cut into sections with KpnI and SalI enzymes, and then ligated with the modified vector pPZP 211-GFP. The ORF fragment of AtGDS1 was ligated between the KpnI and SalI sites of the vector to construct an overexpressed Arabidopsis vector. The pPZP211-GFP vector has a plant transformation selection marker kanamycin gene (see FIG. 1). The AtGDS1 ORF fragment on the vector was sequenced correctly and transferred into Agrobacterium GV3101, and the wild type Arabidopsis (Col) was infected by inflorescence infection. T0 seeds were subjected to 2.5% sodium hypochlorite for 10min at room temperature, washed with sterile water for 5 times, and then uniformly coated on MS plates (containing 50mg/L kanamycin). After 3 days of treatment at 4 ℃, the cells were transferred to a 22 ℃ incubator for growth. Germinating for about 7-10 days, the leaves of the transgenic plants are dark green, and the roots are longer; non-transformed plants She Jianlu, short in roots, do not survive for long periods. The transformant was transferred into nutrient soil for growth until T1 generation seeds were harvested. The T1 generation seeds are screened according to the method, and the T2 generation seeds (a plurality of single plants are collected for each strain) are collected. Each T2 generation single plant seed is respectively screened, planted, the T3 generation seed of each single plant is collected, the T3 generation seed of each single plant is screened, the offspring are not separated (both are resistant to kanamycin) and are homozygous over-expression lines, after the over-expression multiples are identified, 2 homozygous over-expression lines AtGDS1-OE-1 and AtGDS1-OE-2 are selected for performance investigation.

2. Performance investigation of arabidopsis AtGDS1 gene overexpression lines:

sowing Arabidopsis seeds of Wild Type (WT) and overexpressing lines (AtGDS 1-OE-1, atGDS 1-OE-2) on a substrate containing low nitrogen (0.5 mM, 1mM KNO) ₃ ) And high nitrogen (5 mM KNO) ₃ ) Culturing in a matrix of the nutrient solution to a mature period, observing senescence phenotype (number and area of green leaves), and counting plant height, pod length, seed size, thousand seed weight, single plant yield and nitrogen utilization rate (NUE, calculation mode: yield/nitrogen application).

The results are shown in fig. 2, which shows that: in arabidopsis, the AtGDS1 over-expression system can delay leaf senescence of plants under low nitrogen and high nitrogen, and the plant height, pod length, grain size and thousand grain weight of the over-expression system are improved, so that the yield and nitrogen utilization rate are improved.

Example 2: construction of wheat TaGDS1 over-expression line and knockout mutant and performance investigation

The invention finds out the TaGDS1 family in wheat by using a bioinformatics method, and names the wheat according to the positioning of the wheat on a chromosome; the wheat TaGDS1 family was analyzed by evolution and found that 2 genes with higher homology contained 6 subgenomic groups (see fig. 3). At present, the function of the wheat TaGDS1 is not clear, and whether the wheat TaGDS plays a role in regulating the yield and the nitrogen utilization rate is not reported yet. In order to deeply study the functions of the wheat TaGDS1 gene, CRISPR knockout targets are designed at the conserved sites of 6 subgenomic groups and are used for constructing TaGDS1 knockout mutants; and the TraesCS5D02G503700 with the highest expression level is selected for cloning, and the wild wheat variety Fielder is transformed to construct an overexpression system of TraesCS5D02G 503700.

1. Construction of wheat tagds1 CRISPR knockout mutants:

the double target sequences are as follows:

target 1: GCAGGTGATAAACCAGAAGGAGG (SEQ ID No. 17)

Target 2: CCATGTGGAGAAGTACAAGAAGA (SEQ ID No. 18)

Target 1 and target 2 are conserved sites for 6 subgenomic groups (identical sequences contained on the ABD subgenomic group)

Designed as follows. By designing targets, all 6 subgenomic groups were knocked out.

The primer containing the double targets is as follows:

TaGDS1-MT1T2-F:AATAATGGTCTCAAGCGCAGGTGATAAACCAGAAGG(SEQ ID No.19)

TaGDS1-MT1T2-F0:GCAGGTGATAAACCAGAAGGGTTTTAGAGCTAGAAATAGC(SEQ ID No.20)

TaGDS1-MT1T2-R0:CTTCTTGTACTTCTCCACACGCTTCTTGGTGCC(SEQ IDNo.21)

TaGDS1-MT1T2-R:ATTATTGGTCTCTAAACCTTCTTGTACTTCTCCACA(SEQ IDNo.22)

using the above 4 pairs of primers, a double target was ligated into the pBUE413 vector (Xing et al, 2014) to construct a wheat CRISPR knockout vector. The pBUE413 vector has a plant transformation selection marker bar gene (see FIG. 4). And (3) transferring the double targets on the carrier into agrobacterium GV3101 after sequencing correctly, infecting young embryo of wheat wild variety Fielder, and obtaining the T0 generation resistant seedling by a tissue culture method. And taking leaves of the T0 generation resistant seedlings to extract genomes, carrying out PCR amplification by using specific primers of 6 subgenomic groups, sequencing a PCR stock solution company, comparing sequences at target points to obtain mutants with all knockouts of the 6 subgenomic groups, and selecting 2 knockouts of tagds1-3-9 and tagds1-11-9 to carry out subsequent experiments.

Specific primers for the 6 subgenomic groups were as follows:

TraesCS2A02G143700: upstream primer 5'-GAATCCAAGTGCTGATAGTCGTC-3' (SEQ ID No. 23), downstream primer 5'-TTCTATAGGTAGAGACGTGCGTTG-3' (SEQ ID No. 24)

TraesCS2B02G168700: upstream primer 5'-TTCGGCCTCGCTGGTTTCCTTTCTTG-3' (SEQ ID No. 25), downstream primer 5'-GTGTGTATTCCTAGCAAAAAAAATTG-3' (SEQ ID No. 26)

TraesCS2D021G147300: upstream primer 5'-GCGCTGCCGGCGTGTCGGACGTTC-3' (SEQ ID No. 27), downstream primer 5'-TTAGTCCAAATCACTACGAGCATG-3' (SEQ ID No. 28)

TraesCS5A02G488700: upstream primer 5'-GCCGGTTAGGCCGCAGTTCAAAAA-3' (SEQ ID No. 29), downstream primer 5'-TTGTGTGTATTGCTAGCAAAAAAAAA-3' (SEQ ID No. 30)

TraesCS5B02G502600: upstream primer 5'-CCTTCAGTAGCTGTAGAGCTAGCC-3' (SEQ ID No. 31), downstream primer 5'-ATATCAGACGCCACAGCCCTGGGC-3' (SEQ ID No. 32)

TraesCS5D02G503700: upstream primer 5'-ATATTATTCAGTACAGTACTCCTAT-3' (SEQ ID No. 33), downstream primer 5'-TACGAGCACAATGGTGAATAGGTTG-3' (SEQ ID No. 34)

2. Construction of a wheat TaGDS1 overexpression line:

the coding region of the TraesCS5D02G503700 gene and the EGFP sequence of the pCambia3301-EGFP plasmid were PCR amplified using the normally grown wheat leaf cDNA and pCambia3301-EGFP plasmid as templates, and the upstream primer 5'-AGATCACAAGTTtgtacaATGAATCCCCTGACGCAGG-3' (SEQ ID No. 35) and the downstream primer 5'-TCTCCGGGATTTCCTGTACC-3' (SEQ ID No. 36) of TraesCS5D02G503700 and the upstream primer 5'-ACAGGAAATCCCGGAGAATGGTGAGCAAGGGCGAG-3' (SEQ ID No. 37) and the downstream primer 5'-GATCACCACTTtgtacaTTACTTGTACAGCTCGTCCATGC-3' (SEQ ID No. 38) of EGFP, respectively.

The amplified product was recovered by cutting with BsrGI enzyme, and after cutting with vector pc186, traesCS5D02G503700-EGFP was ligated between BsrGI sites on pc186 vector by one-step cloning (multi-fragment DNA seamless cloning kit, vazyme) to construct an overexpressed wheat vector. The pc186 vector has a plant transformation selection marker bar gene (see FIG. 5). The TraesCS5D02G503700ORF fragment on the vector is transferred into agrobacterium GV3101 after being sequenced correctly, infects young embryo of wheat wild variety Fielder, and obtains T0 generation resistant seedling by tissue culture method; leaves of T0 generation resistant seedlings are taken, and the overexpression multiple of the TraesCS5D02G503700 gene is detected. The leaves of the T1 generation are smeared with a small amount of herbicide, resistant seedlings are screened, and T2 generation seeds (a plurality of single plants are harvested for each strain) are harvested. Each T2 generation single plant seed is respectively screened, planted, the T3 generation seed of each single plant is collected, the T3 generation seed of each single plant is screened, the offspring are not separated (both have resistance to herbicide) and are the homozygous overexpression lines, after the overexpression multiples are identified, 2 homozygous overexpression lines TaGDS1-OE-1 and TaGDS1-OE-2 are selected for performance investigation.

3. Performance investigation:

seeds of wheat wild-type, taGDS1 CRISPR knockout mutants and TaGDS1 overexpressing lines were planted in plants containing low nitrogen (0.5 mM KNO ₃ ) And high nitrogen (5 mM KNO) ₃ ) Culturing in the matrix of nutrient solution to maturity, and counting seed size, hundred weight and single plant yield.

The present inventors found that TaGDS1 was able to increase wheat grain size, hundred grain weight and individual yield under high nitrogen conditions (FIG. 6).

The foregoing description is only of the preferred embodiments of the present application and is not intended to limit the same, but rather, various modifications and variations may be made by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

Use of a gds1 gene as a nitrogen regulatory gene in at least one of the following (1) - (4):

(1) Delaying leaf senescence of plants under low and high nitrogen;

(2) The plant height, the pod length, the grain size and the grain weight of the plants under the low-nitrogen and high-nitrogen conditions are improved;

(3) The single plant yield and the nitrogen utilization rate of plants under low nitrogen and high nitrogen conditions are improved;

(4) Cultivating a crop variety with high nitrogen efficiency;

the nucleotide sequence of the GDS1 gene is shown as any one of SEQ ID No.1 and SEQ ID No.3-SEQ ID No. 8.
2. The use according to claim 1, wherein the plant is arabidopsis thaliana or wheat.
3. The use according to claim 1, wherein the GDS1 gene is derived from arabidopsis thaliana or wheat; the GDS1 gene is an AtGDS1 gene, and the nucleotide sequence of the GDS1 gene is shown as SEQ ID No. 1; or the GDS1 gene is a TaGDS1 gene, and the nucleotide sequence of the GDS1 gene is shown as SEQ ID No.3-SEQ ID No. 8.
Use of a protein encoded by a gds1 gene in at least one of the following (1) - (3):

(1) Delaying leaf senescence of plants under low and high nitrogen;

(2) The plant height, the pod length, the grain size and the grain weight of the plants under the low-nitrogen and high-nitrogen conditions are improved;

(3) The single plant yield and the nitrogen utilization rate of plants under the low-nitrogen and high-nitrogen conditions are improved.
5. The use according to claim 4, wherein the amino acid sequence of the protein encoded by the GDS1 gene is set forth in any one of SEQ ID No.2, SEQ ID No.9-SEQ ID No. 14.
6. Use of a recombinant expression vector or recombinant bacterium comprising a GDS1 gene in at least one of the following (1) - (4):

(1) Delaying leaf senescence of plants under low and high nitrogen;

(2) The plant height, the pod length, the grain size and the grain weight of the plants under the low-nitrogen and high-nitrogen conditions are improved;

(3) The single plant yield and the nitrogen utilization rate of plants under low nitrogen and high nitrogen conditions are improved;

(4) Cultivating the crop variety with high nitrogen efficiency.
7. A method for increasing nitrogen utilization in a plant, comprising: and a step of overexpressing the GDS1 gene in the plant.
8. The method of claim 7, wherein the method of overexpressing the GDS1 gene in a plant comprises: exogenous transfer into GDS1 gene; or up-regulating the expression of the GDS1 gene or a homologous gene thereof in the plant genome.
9. The cultivation method of the high-nitrogen-efficiency crop variety is characterized by comprising the following steps of:

and transferring the GDS1 gene into a wild plant and over-expressing the GDS1 gene, and screening to obtain a plant with improved nitrogen utilization rate, thereby obtaining the high-nitrogen-efficiency crop.