CN116083642A - Primer pair, primer group, kit and method for detecting kiwi fruit chlorosis virus - Google Patents

Primer pair, primer group, kit and method for detecting kiwi fruit chlorosis virus Download PDF

Info

Publication number
CN116083642A
CN116083642A CN202210846901.7A CN202210846901A CN116083642A CN 116083642 A CN116083642 A CN 116083642A CN 202210846901 A CN202210846901 A CN 202210846901A CN 116083642 A CN116083642 A CN 116083642A
Authority
CN
China
Prior art keywords
rpa
accrav
kiwi fruit
primer
probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210846901.7A
Other languages
Chinese (zh)
Inventor
刘占德
张阿玲
史遐
刘艳飞
余枫
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northwest A&F University
Original Assignee
Northwest A&F University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northwest A&F University filed Critical Northwest A&F University
Priority to CN202210846901.7A priority Critical patent/CN116083642A/en
Publication of CN116083642A publication Critical patent/CN116083642A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of virus detection, and particularly relates to a primer pair, a primer group, a kit and a method for detecting kiwi fruit chlorosis virus. The primer pair RPA-AcCRaV-F/RPA-AcCRaV-R provided by the invention can amplify the genome RNA of the kiwi fruit chlorotic plaque virus, has good specificity, and realizes detection of the kiwi fruit chlorotic plaque virus. The primer pair is combined with the probe to obtain a primer group for detecting the kiwi fruit chlorosis virus, the RT-RPA-LFD detection can be directly carried out on the kiwi fruit chlorosis virus, the detection time is short, the result can be judged by naked eyes, the rapid detection of a sample to be detected is more convenient, the sensitivity is high, the specificity is good, and the minimum detection is realizedLimit of measurement of 10 ‑8 ng/μL。

Description

Primer pair, primer group, kit and method for detecting kiwi fruit chlorosis virus
Technical Field
The invention belongs to the technical field of virus detection, and particularly relates to a primer pair, a primer group, a kit and a method for detecting kiwi fruit chlorosis virus.
Background
Kiwi fruit is one of the important gardening products worldwide, and is popular among the public because the pulp of kiwi fruit contains rich vitamin C, mineral substances and dietary fibers. Disease infection can affect the yield and quality of kiwi fruits and even the healthy development of the kiwi fruit industry. The Kiwi fruit chlorosis virus (Actinidia chlorotic ringspot-associated virus, acCRaV) is a virus that specifically infects Kiwi fruits, which is commonly occurring in kiwi fruit producing regions and is commonly complex-infected with other viruses. When the kiwi fruits are infected with AcCRaV, the symptoms such as leaf chlorosis, mottle, ring spots and the like are often shown, and the yield and quality of the kiwi fruits are seriously affected.
The detection of fruit tree viruses is a key link for predicting, forecasting and preventing and controlling viral diseases. The currently reported AcCRaV detection method mainly comprises reverse transcription PCR (Reverse transcription-PCR, RT-PCR), wherein the detection method needs the processes of sample collection, grinding, RNA extraction, reverse transcription, PCR, electrophoresis and the like, and professional equipment such as a PCR instrument, an electrophoresis instrument, a gel imager and the like needs to be configured, so that the process is relatively complicated, and the process is costly, time-consuming and labor-consuming; in addition, due to the limited sensitivity of RT-PCR, false negative results are likely to occur when detecting materials with low viral content.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, and provides a primer pair, a primer group, a kit and a method for detecting the kiwi fruit chlorosis virus, which improve the sensitivity, the specificity and the detection speed of kiwi fruit chlorosis virus detection.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a primer pair for detecting kiwi fruit chlorosis virus by utilizing RPA, which comprises an upstream primer RPA-AcCRaV-F with a sequence shown as SEQ ID NO.1 and a downstream primer RPA-AcCRaV-R with a sequence shown as SEQ ID NO. 2.
The invention also provides a primer group for detecting the kiwi fruit chlorosis virus by utilizing the RPA-LFD, which comprises an upstream primer RPA-AcCRaV-F shown in SEQ ID NO.1, a downstream primer RPA-AcCRaV-R shown in SEQ ID NO.2 and a probe ACCRaV-nfo-probe shown in SEQ ID NO. 3.
Preferably, Y in the probe AcCRaV-nfo-probe is replaced by [ THF ], FITC label is added at the 5 'end of the probe AcCRaV-nfo-probe, and a polymerase amplification blocking group is added at the 3' end of the probe AcCRaV-nfo-probe.
The invention also provides a detection kit for detecting the kiwi fruit chlorosis virus by utilizing the RPA-LFD, which comprises the primer group, the reaction buffer solution and the positive control.
Preferably, reverse transcription reagents, nucleic acid extraction reagents and RNase inhibitors are also included.
The invention also provides a method for detecting the kiwi fruit chlorosis ringspot virus based on RT-RPA-LFD, which comprises the following steps:
extracting total RNA of a sample to be detected containing the kiwi fruit chlorosis virus;
the primer group is utilized to carry out RT-RPA reaction on total RNA, and RPA products are obtained;
and detecting the RPA product by using a flow measurement chromatography test strip, and judging whether the kiwi fruit sample to be detected contains the kiwi fruit chlorosis ringspot virus.
Preferably, the RT-RPA reaction is performed by adding 150 to 600nM of the upstream primer RPA-AcCRaV-F,150 to 600nM of the downstream primer RPA-AcCRaV-R,50 to 150nM of the probe AcCRaV-nfo-probe,29.5 mu L Primer Free Rehydration buffer,1 mu L of total RNA,1 mu L M-MLV reverse transcriptase, 1.4 mu L RNase Inhibitor,2.5 mu L of 280mM magnesium acetate and the balance RNase-free H to a dry powder reaction tube in 50 mu L of total system 2 O；
The dry powder reaction tube contains recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase.
Preferably, the temperature of the RT-RPA reaction is 35-40 ℃, and the reaction time is 10-30 min.
Preferably, the judging method includes: after the RPA product is dripped into a sample application area of the flow-measuring chromatography test strip, the test strip is vertically inserted into an analysis buffer MGBB, incubated for 5-15 min, a test strip reading result is taken out, and if mauve lines appear at a quality control line and a detection line on the test strip, a positive sample is judged; if only the purple red line appears on the test strip at the quality control line, the test strip is judged to be a negative sample.
Preferably, the assay buffer MGCBB comprises a citrate phosphate buffer.
The invention provides a primer pair for detecting kiwi fruit chlorosis virus by utilizing RPA, which comprises an upstream primer RPA-AcCRaV-F with a sequence shown as SEQ ID NO.1 and a downstream primer RPA-AcCRaV-R with a sequence shown as SEQ ID NO. 2. According to the invention, the RPA primer pair and the nfo probe are designed according to the conserved region of the AcCRaV coat protein gene sequence, so that the genome RNA of the kiwi fruit chlorotic plaque virus can be amplified, the specificity is good, and the detection of the kiwi fruit chlorotic plaque virus is realized.
The primer pair for detecting the kiwi fruit chlorosis virus by utilizing the RPA is combined with the nfo probe to obtain the primer group for detecting the kiwi fruit chlorosis virus, the RT-RPA-LFD detection can be directly carried out on the kiwi fruit chlorosis virus, the detection time is short, the result can be judged by naked eyes, the rapid detection of a sample to be detected is realized, the sensitivity is high, the specificity is good, and the minimum detection limit is 10 -8 ng/μL。
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 is a schematic diagram showing the positions of an upstream primer RPA-AcCRaV-F, a downstream primer RPA-AcCRaV-R and a probe AcCRaV-nfo-probe in a coat protein gene of a kiwi fruit chlorosis virus (AcCRaV), wherein a black underlined part is the position of the primer, and a purple square part is the position of the probe;
FIG. 2 is a graph showing the results of example 3 for detecting AcCRaV using RT-RPA technology;
FIG. 3 is a graph showing the results of example 3 using RT-RPA-LFD technique to detect AcCRaV;
FIG. 4 is a graph showing the results of testing AcCRaV at different RT-RPA reaction temperatures and times for examples 3-12;
FIG. 5 shows the size and integrity of RNA transcripts in example 13;
FIG. 6 example 13 is a graph of the results of detection of sensitivity of AcCRaV using RT-PCR technique;
FIG. 7 is a graph showing the results of example 13 using RT-RPA-LFD technique to detect sensitivity of AcCRaV;
FIG. 8 is a graph showing the results of example 13 for detecting sensitivity of AcCRaV using RT-qPCR technique;
FIG. 9 is a graph showing the results of example 14 for detecting AcCRaV in crude plant extracts using RT-RPA-LFD technique;
FIG. 10 is a flow chart of a field rapid assay AcCRaV of example 15;
FIG. 11 is a graph showing the results of the field rapid assay for AcCRaV of example 15.
Detailed Description
The invention provides a primer pair for detecting kiwi fruit chlorosis virus by utilizing RPA, which comprises an upstream primer RPA-AcCRaV-F with a sequence shown as SEQ ID NO.1 and a downstream primer RPA-AcCRaV-R with a sequence shown as SEQ ID NO. 2.
The base sequences of the upstream primer and the downstream primer of the invention are as follows in order from 5 '-3':
RPA-AcCRaV-F：TCATTTGTCCTGCAAGGCGATTTACTATAG；
RPA-AcCRaV-R：TTCTGATGGTTTCTTAGAGCTTCCAATAAG。
in the invention, the sizes of the amplified fragments of the upstream primer RPA-AcCRaV-F and the downstream primer RPA-AcCRaV-R are 248bp.
In the specific implementation process, the RPA primer and the nfo probe are designed according to the conserved regions (accession numbers MK900412.1, MH457054.1, NC_038772.1, MH557850.1, MK900438.1, MK900417.1, MH557851.1, MK900426.1H and MH 457042.1) of the AcCRaV coat protein gene sequence, and the effect of detecting the kiwi fruit chlorosis virus can be achieved through the RPA-AcCRaV-F/R. The primer pair provided by the invention can specifically amplify single and bright amplification bands conforming to the expected size aiming at the kiwi fruit chlorosis virus, and can be used for detecting the kiwi fruit chlorosis virus.
The invention also provides a primer group for detecting the kiwi fruit chlorosis virus by utilizing the RPA-LFD, which comprises an upstream primer RPA-AcCRaV-F shown in SEQ ID NO.1, a downstream primer RPA-AcCRaV-R shown in SEQ ID NO.2 and a probe ACCRaV-nfo-probe shown in SEQ ID NO. 3.
The base sequence of the probe of the invention is as follows from 5 '-3':
AcCRaV-nfo-probe：
CAACTTCAACAGCTTTGAACTGTTCCCAATYATATTTTTCCATGAC where Y is an empty base.
In the synthesis of the probe according to the present invention, it is preferable that FITC label is added to the 5 '-end of the probe, a polymerase amplification blocking group (C3-spacer) is added to the 3' -end of the probe to block the probe, and Y is replaced with [ THF ].
The primer group can be directly used for detecting the RPA-LFD of the kiwi fruit chlorosis virus. The RPA-LFD detection result of the invention shows positive, the result can be judged by naked eyes, and the invention is more convenient, has high sensitivity and good specificity.
The invention also provides a detection kit for detecting the kiwi fruit chlorosis virus by utilizing the RPA-LFD, which comprises the primer group, a reaction buffer solution and positive control, and preferably further comprises a reverse transcription reagent, a nucleic acid extraction reagent and an RNase inhibitor.
In the invention, the primer group contains 3 primers of RPA-AcCRaV-F, RPA-AcCRaV-R and acCRaV-nfo-probe, and the independent concentration of the RPA-AcCRaV-F is preferably 10 mu mol/L; the independent concentration of RPA-AcCRaV-R is preferably 10 mu mol/L; the independent concentration of AcCRaV-nfo-probe is preferably 10. Mu. Mol/L. The primer group disclosed by the invention can specifically identify the kiwi fruit chlorosis virus, has good amplification performance, and can be used for rapidly detecting the kiwi fruit chlorosis virus.
The invention has no strict requirements on the types of positive control, reverse transcription reagent, nucleic acid extraction reagent and RNase inhibitor, and can be used for selecting the reagent used in the conventional kiwi fruit chlorosis virus detection process.
The invention also provides a method for detecting the kiwi fruit chlorosis ringspot virus based on RT-RPA-LFD, which comprises the following steps:
extracting total RNA of a sample to be detected containing the kiwi fruit chlorosis virus;
the primer group is utilized to carry out RT-RPA reaction on total RNA, and RPA products are obtained;
and detecting the RPA product by using a flow measurement chromatography test strip (i.e. LFD), and judging whether the kiwi fruit sample to be detected contains the kiwi fruit chlorosis virus.
The method for extracting the total RNA of the sample to be detected containing the kiwi fruit chlorosis virus is not strictly required, and preferably, the CTAB method is adopted for extraction.
After the total RNA is obtained, the invention uses the total RNA as a template, and uses the primer group in the technical scheme to carry out RT-RPA reaction on the total RNA to obtain an RPA product. In the RT-RPA reaction, 150 to 600nM of upstream primer RPA-AcCRaV-F,150 to 600nM of downstream primer RPA-AcCRaV-R,50 to 150nM of probe AcCRaV-nfo-probe,29.5 mu LPrimer Free Rehydration buffer,1 mu L of total RNA,1 mu L M-MLV reverse transcriptase, 1.4 mu L RNase Inhibitor,2.5 mu L of 280mM magnesium acetate and the balance RNase-free H are preferably added into a dry powder reaction tube based on 50 mu L of total system 2 O. In the practice of the present invention, 2.4. Mu.L of 10. Mu. Mol/L of the upstream primer RPA-AcCRaV-F, 2.4. Mu.L of 10. Mu. Mol/L of the downstream primer RPA-AcCRaV-R, 29.5. Mu. L Primer Free Rehydration buffer, 1. Mu.L of total RNA, 1. Mu. L M-MLV reverse transcriptase, 1.4. Mu. L RNase Inhibitor, 0.6. Mu.L of 10. Mu. Mol/L of the probe AcCRaV-nfo-probe, 2.5. Mu.L of 280mM magnesium acetate and the balance RNase-free H are preferably added to the dry powder reaction tube in a total system of 50. Mu.L 2 O. In the practice of the invention, the total RNA is preferably diluted to 500-1000 ng/. Mu.L.
In the present invention, the dry powder reaction tube includes a recombinase, a single-chain binding protein and a strand displacement polymerase. The specific amounts of the recombinase, the single-stranded DNA binding protein (SSB) and the strand displacement DNA polymerase in the dry powder reaction tube are not limited, and the components with the volumes as above can be added into the freeze-dried enzyme tube in the commercial kit. In the practice of the present invention, dry powder reaction tubes were used commercially available from TwitDx corporation.
In the present invention, the temperature of the RT-RPA reaction is preferably 35 to 40 ℃, and more preferably 40 ℃; the time for the RT-RPA reaction is preferably 10 to 30 minutes, more preferably 20 minutes. The invention can improve the amplification effect and the detection speed by adjusting the temperature and time of the RPA-LFD reaction.
After the RPA product is obtained, the invention utilizes a flow measurement chromatography test strip to detect the RPA product and judges whether the kiwi fruit sample to be detected contains the kiwi fruit chlorosis virus. The judging method of the invention preferably comprises the following steps: after the RPA product is dripped into a sample application area of the flow-measuring chromatographic test strip, the flow-measuring chromatographic test strip is vertically inserted into an analysis buffer MGBB, incubated for 5-15 min, a test strip reading result is taken out, and if mauve lines appear at a quality control line and a detection line on the test strip, a positive sample is judged; if only the purple red line appears on the test strip at the quality control line, the test strip is judged to be a negative sample. The assay buffer MGCBB of the present invention preferably comprises: citrate phosphate buffer. In the specific implementation of the invention, the lateral flow chromatography test strip is purchased from MileniaBiotec company. The invention does not need to carry out purification treatment in the detection process, and can directly detect the obtained RPA product by using a flow measurement chromatography test strip.
The technical solutions provided by the present invention are described in detail below with reference to the drawings and examples for further illustrating the present invention, but they should not be construed as limiting the scope of the present invention.
Example 1
1. Primer design
The conserved regions of AcCRaV coat protein gene sequences of accession numbers MK900412.1, MH457054.1, NC_038772.1, MH557850.1, MK900438.1, MK900417.1, MH557851.1, MK900426.1H and MH457042.1 (see FIG. 1) were compared, and 1 pair of RPA primers, 1 pair of PCR primers, 1 pair of qPCR primers were designed based on the comparison results, and the nucleotide sequences of the specific primers were synthesized by the well-known Yumioga Biotechnology Co., ltd, and the specific sequences of the primers were shown in Table 1 below.
TABLE 1 detection primer pairs
Figure BDA0003753216570000061
RNA extraction
2.1 test materials
The large-seed kiwi fruit tissue culture seedlings infected with AcCRaV are used as test materials, the large-seed kiwi fruit virus-free seedlings are used as negative controls, and water is used as blank controls.
2.2 Total RNA extraction from plants
The method for extracting the total RNA of the plants by adopting the CTAB method comprises the following specific steps:
(1) Rapidly grinding large-seed kiwi fruit tissue culture seedling samples to powder in liquid nitrogen, then taking 0.05-0.1 g and placing the powder into a 1.5mL centrifuge tube without RNase (600 mu LCTAB and 40 mu L beta-mercaptoethanol are added into the centrifuge tube without RNase in advance), and rapidly and uniformly vortex for 30s;
(2) Water bath at 65 ℃ for 10min, shaking up for several times during the period;
(3) Adding 600 mu L of chloroform/isoamyl alcohol (the volume ratio of the chloroform to the isoamyl alcohol is 24:1), mixing uniformly by vortex, and centrifuging for 10min at the temperature of 4 ℃ at the speed of 11000 rpm;
(4) 500. Mu.L of the supernatant was added with an equal volume of chloroform/isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol was 24:1), mixed gently and centrifuged at 11000rpm at 4℃for 10min.
(5) Adding 200 mu L of 6M LiCl into 400 mu L of supernatant, and precipitating for 2-3 h at-20 ℃;
(6) Centrifuging at 12000rpm for 10min at 4deg.C, and discarding supernatant;
(7) Adding 500 mu L of 75% ethanol to wash the precipitate, centrifuging at 11000rpm at 4 ℃ for 30s, and absorbing off the ethanol;
(8) Adding 400 mu L of absolute ethyl alcohol for washing, centrifuging at 11000rpm at 4 ℃ for 30s, absorbing out the ethyl alcohol, and reversely buckling and airing the centrifuge tube on an ultra-clean workbench;
(9) Adding 30 mu L DEPC water for dissolution, measuring the concentration and purity of the solution by a micro ultraviolet spectrophotometer, wherein the concentration is about 500 ng/mu L, and the concentration of A260/280 is between 1.8 and 2.0, thus obtaining total RNA.
cDNA Synthesis
Using cDNA reverse transcription kit (PrimeScript TM RT reagent Kit) for first strand cDNA synthesis, specifically stepsThe method comprises the following steps:
(1) The reaction system was prepared on ice according to the ingredients of Table 2, and genomic DNA (gDNA) was removed.
Table 2 shows the reaction system for removing genomic DNA.
Figure BDA0003753216570000071
After gently mixing the components, the mixture was incubated at 42℃for 2min.
(2) The reverse transcription reaction was performed by preparing the components shown in Table 3 on ice.
TABLE 3 reaction system for reverse transcription reaction
Figure BDA0003753216570000072
The components were gently mixed and immediately subjected to reverse transcription reaction at 25℃for 10min and at 50℃for 10min.
(3) Deactivation of
The reaction solution of step (2) was heated at 85℃for 5 seconds to inactivate 5 XUseript II RT Supermix and gDNA Removal Mix, thereby obtaining cDNA. Storing in a refrigerator at-20deg.C for use.
Example 2
(1) Taking large-seed kiwi fruit tissue culture seedlings infected with AcCRaV as test materials, and extracting according to the step 2 of the example 1 to obtain templates with total RNA as a positive control group; water is used as a template of a blank control group; the non-toxic large-seed kiwi fruit tissue culture seedlings are used as test materials, templates with total RNA as a negative control group are obtained through extraction according to the step 2 of the example 1, RPA primer pairs designed in the table 1 are used as amplification primers, and RT-RPA reaction is carried out, wherein the RT-RPA reaction system is shown in the table 4 below.
TABLE 4 RT-RPA reaction System
Figure BDA0003753216570000081
The components are simply and evenly mixed and then transferred into a dry powder reaction tube, the mixture is blown and evenly mixed until the dry powder is completely dissolved, 2.5 mu L of 280mM magnesium acetate (MgOAc) is added into the cover of the reaction tube, and the mixture is instantaneously centrifuged to the reaction liquid at 40 ℃ for incubation for 30min, thus obtaining the reaction liquid containing RPA products.
(2) After the incubation of step (1), the purified RPA product (specific operation reference, purchased from OMEGA) was recovered using a Cycle-pure Kit, and the purified RPA product was subjected to agarose gel electrophoresis using agarose gel electrophoresis for detection as shown in FIG. 2. Wherein, the figure 2 sequentially shows that the Marker is 100bp from left to right, 1 is positive control (using the total RNA of the large-seed kiwi fruit infected by AcCRaV as a template), 2 is blank control group (using water as a template), and N is negative control group (using the total RNA of the non-toxic large-seed kiwi fruit as a template).
As can be seen from FIG. 2, single, bright bands conforming to the expected sizes can be amplified using the RPA primer pairs (i.e., RPA-AcCRaV-F and RPA-AcCRaV-R). Therefore, the primer pair RPA-AcCRaV-F and RPA-AcCRaV-R can realize specific amplification.
Example 3
(1) Using the primer pairs RPA-AcCRaV-F and RPA-AcCRaV-R of example 1 as the RPA primers of the present invention, a probe ACCRaV-nfo-probe (5 '-CA ACTTCAACAGCTTTGAACTGTTCCCAATYATATTTTTCCATGAC-3') shown by SEQ ID NO.3 was designed, wherein Y was an empty base. When the probe is synthesized, a FITC label is added at the 5 'end, a polymerase amplification blocking group (C3-spacer) is added at the 3' end for blocking, and a middle Y base is replaced by THF; DIG markers were added to the 5' end of RPA-AcCRaV-R1.
(2) Taking the total RNA of the large-seed kiwi fruits infected with AcCRaV extracted in the step 2 of the example 1 as a positive control group template; the total RNA of the non-toxic large-seed kiwi fruits is used as a negative control group template; water was used as a template for a blank group, the primer pairs RPA-AcCRaV-F and RPA-AcCRaV-R of example 1 were used as primers, and AcCRaV-nfo-probe was used as a probe for RT-RPA reaction, and the reaction conditions and steps were the same as those of step (1) of example 2, and the reaction system of the RT-RPA reaction was as shown in Table 5 below.
TABLE 5 RT reaction System for RPA reaction
Figure BDA0003753216570000091
(3) After the reaction, 1. Mu.L of the reaction solution containing the RPA product was aspirated into 24. Mu.L of assay buffer (MGBB) and diluted 25-fold. 10. Mu.L of diluted reaction liquid containing RPA product is sucked up and added to a sample application area of the flow-measuring chromatographic test strip. Then vertically inserting the test strip into a 1.5mL centrifuge tube containing 80 mu LMGCBB, incubating for 5-15 min, and taking out the test strip to read the result, wherein the result judgment standard is as follows: if the sample is not carried with AcCRaV, only one mauve quality control line is presented at the upper part of the test strip. The specific results are shown in fig. 3, wherein 1 in fig. 3 is the detection result of the positive control group (using the total RNA of the large-seed kiwi fruit infected with AcCRaV as a template), 2 is the detection result of the blank control group (using water as a template), and N is the detection result of the negative control group (using the total RNA of the non-toxic large-seed kiwi fruit as a template).
As can be seen from FIG. 3, the positive control group had two mauve lines as a result of amplification, and the negative control group and the blank group had only one mauve line at the quality control line position. When the flow measurement chromatography test strip (LFD) is adopted for detection, the combination of using RPA-AcCRaV-F/RPA-AcCRaV-R as a primer and using AcCRaV-nfo-probe as a probe can realize the specific detection of the kiwi fruit chlorosis virus.
Examples 4 to 12
As in example 3, total RNA of AcCRaV-infected large-seed kiwi fruits was used as a template, except that the RT-PRA reaction was performed at different temperatures and times, as shown in Table 6.
TABLE 6 conditions for RT-PRA reactions in examples 3-12
RT-PRA temperature RT-PRA time
Example 3 40 30
Example 4 40 25
Example 5 40 20
Example 6 40 15
Example 7 40 10
Example 8 35 30
Example 9 35 25
Example 10 35 20
Example 11 35 15
Example 12 35 10
Examples 3 to 12LFD test results are shown in FIG. 4, wherein N in FIG. 4 represents the test result of a negative control group (using total non-toxic kiwi fruit RNA as a template, RT-PRA temperature of 40℃and time of 30 min). As can be seen from FIG. 4, at a reaction temperature of 40 ℃, only 10min of reaction is needed to detect the virus, but the band is weak; at 35 ℃, the virus can be detected only by reacting for 20min, but the band is weaker. The optimal reaction condition of the invention is that the reaction is carried out for 20min at 40 ℃.
Example 13
Sensitivity comparison of three detection methods of RT-PRA, RT-PCR and RT-qPCR
(1) Using the cDNA synthesized in step 2 of example 1 as a template, high-fidelity PCR was performed using a primer AcCRaV-F for cloning the full length of the AcCCRaV coat protein gene and T7-AcCRaV-R (nucleotide sequence of AcCRaV-F is shown as SEQ ID NO.8:5'-GTGGAAGAACCACAATATT-3'; nucleotide sequence of T7-AcCRaV-R is shown as SEQ ID NO.9: 5'-TAATACGACTCACTATAGGGATGCCAAAGCCTATGCAAGG-3') to which a T7 promoter sequence was added at the 5' -end, and DNA was obtained, the reaction system and conditions are shown in Table 7 below.
TABLE 7 high fidelity PCR reaction system and conditions
Figure BDA0003753216570000111
(2) Performing an in vitro transcription test using the purified DNA obtained in the step (1) as a template and using a Transcriptaid T7 high-yield transcription kit (Thermo Scientific); specific procedures are described in the specification to obtain RNA transcripts.
(3) Using RNA Clean&Concentrator TM -5 kit (Zymo Research) purification of the RNA transcripts obtained in step (2), for specific procedures reference instructions.
(4) And (3) detecting the size and the integrity of the RNA transcript purified in the step (3) through agarose gel electrophoresis.
a. RNA transcripts were diluted 20-40 fold with DEPC water to a final concentration of 0.1-0.5. Mu.g/. Mu.L.
b. Mixing 2-4 mu L diluted RNA transcript (0.5-1 mu g) with equal volume of 2X RNA Loading Dye Solution;
heating at 70℃for 10min (simultaneously heating the RNA transcripts in RiboRuler RNA Ladder and b).
d. Ice-bath for 3min (RiboRuler RNA Ladder and RNA transcripts) and mixing well before loading;
e. 1.5. Mu. L RiboRuler RNA Ladder and 3. Mu.L of RNA transcripts were each loaded onto a 1% agarose gel and run at 180V for 20min. The size and integrity of the RNA transcripts were then observed and recorded under an agarose gel imager, as shown in FIG. 5, where M represents the marker and 1 represents the size of the synthesized RNA transcripts. As can be seen from FIG. 5, the size of the synthesized RNA transcript was 945bp, which was consistent with the full length of the AcCRaV coat protein gene.
(5) 1 ng/. Mu.L AcCRaV coat protein RNA transcript was transcribed with RNase-free H 2 O was serially diluted 10-fold (i.e., from 1 ng/. Mu.L to 10 -10 ng/. Mu.L, in particular 1 ng/. Mu.L, 10 -1 ng/μL、10 -2 ng/μL、10 -3 ng/μL、10 -4 ng/μL、10 -5 ng/μL、10 -6 ng/μL、10 -7 ng/μL、10 -8 ng/μL、10 -9 ng/μL、10 -10 ng/. Mu.L). The sensitivity of three detection methods, RT-RPA-LFD, RT-PCR and RT-qPCR, were compared using serial dilutions of AcCRaV coat protein RNA transcripts as templates. The specific operation of the one-step RT-RPA-LFD is the same as that of example 3; PCR-AcCRaV-F and PCR-AcCRaV-R in Table 1 were used as amplification primer pairs, primeScript was used TM One Step RT-PCR Kit Ver.2 (Takara) One-Step RT-PCR was performed, and specific procedures were described in the specification; the One Step TB was used with qPCR-AcCRaV-F and qPCR-AcCRaV-R of Table 1 as amplification primer pairs
Figure BDA0003753216570000121
PrimeScript TM RT-PCR Kit II(Perfect Real Time)(Takara), performing one-step RT-qPCR, referring to a specific operation reference specification, performing one-step RT-RPA-LFD, performing RT-PCR, wherein the detection results of the RT-qPCR are shown in figures 6-8, wherein figure 6 is the detection result of the RT-PCR, figure 7 is the detection result of the RT-RPA-LFD, and figure 8 is the detection result of the RT-qPCR, wherein N in figures 6-8 represents a negative control group (taking nontoxic large-seed kiwi total RNA as a template). />
As can be seen from FIGS. 6 to 8, the detection limit of RT-RPA-LFD is 10 -8 ng/. Mu.L, RT-qPCR detection limit is 10 - 7 ng/. Mu.L, RT-PCR detection limit of 10 -6 ng/. Mu.L. Namely, the sensitivity of the RT-RPA-LFD of the invention is highest and is 10 times of that of RT-qPCR and 100 times of that of RT-PCR.
Example 14
Detection of AcCRaV from crude plant extracts
The large-seed kiwi fruit tissue culture seedlings infected with AcCRaV are taken as test materials, a leaf disc with the diameter of about 0.5cm is taken by a cover of a 1.5mL centrifuge tube, placed in 300 mu L of freshly prepared alkaline PEG buffer (6% PEG 200, 20mM NaOH), and after short vortex, incubated for 3-5 min at room temperature. The crude extract is treated as 1X dilution, further subjected to 10 times serial dilution, and provided with 4 concentration gradients, namely 1 time dilution, 10 time dilution, 100 time dilution and 1000 time dilution, which are sequentially recorded as 1, 10 1 ，10 2 And 10 3 . Then 1 mul of crude extracts with different concentrations are taken as templates for RT-RPA reaction, and after the reaction is finished, a lateral flow chromatography test strip is used for terminal detection, and the specific operation is the same as that of example 3, and the detection result is shown in a graph 9, wherein N in the graph 9 represents a negative control group (taking nontoxic large-seed kiwi fruit crude extract as a template).
According to FIG. 9, it can be seen that the detection method of the RT-RPA-LED of the invention can successfully detect AcCRaV in the crude extract, and can still detect the AcCRaV after diluting the crude extract by 100 times, and the invention has higher compatibility with the template.
Example 15
According to the flow chart of fig. 10, the field rapid detection of AcCRaV is specifically: randomly selected kiwi leaves suspected of being infected with AcCRaV and kiwi leaves without virus symptoms are taken as samples, a leaf disc with the diameter of about 0.5cm is taken by a cover of a 1.5mL centrifuge tube, placed in 300 mu L of freshly prepared alkaline PEG buffer (6% PEG 200, 20mM NaOH), simply ground by a grinding rod, incubated at room temperature for 3-5 min, and meanwhile, the corresponding leaf samples are frozen in liquid nitrogen for subsequent RT-PCR detection, and the specific operation is the same as in example 13. Taking 1 mu L of crude extract of a corresponding sample as a template to perform RT-RPA reaction, and performing terminal detection by using a lateral flow chromatography test strip after the reaction is finished, wherein the detection result is shown in FIG. 11, and (A) in FIG. 11 is the PT-PCR detection result; (B) For the detection results of RT-RPA-LFD, P in (A) and (B) represents positive control (taking total RNA or crude extract of large-seed kiwi fruit infected with AcCRaV as a template), N represents negative control group (taking total RNA or crude extract of non-toxic large-seed kiwi fruit as a template), 1-10 are detection results of randomly selected kiwi fruit leaves suspected to be infected with AcCRaV and kiwi fruit leaf samples without virus symptoms, and specific numbers 1, 2, 3, 6 and 8 are kiwi fruit leaves suspected to be infected with AcCRaV; the numbers 4, 5, 7, 9 and 10 are samples of kiwi leaves without viral symptoms. As can be seen from FIG. 11, the RT-RPA-LFD detection result is consistent with the RT-PCR detection result, which shows that the detection method of the RT-RPA-LED of the invention can be used for detecting the kiwi fruit chlorosis virus.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims (10)

1. A primer pair for detecting the kiwi fruit chlorosis virus by utilizing RPA is characterized by comprising an upstream primer RPA-AcCRaV-F with a sequence shown as SEQ ID NO.1 and a downstream primer RPA-AcCRaV-R with a sequence shown as SEQ ID NO. 2.
2. A primer group for detecting kiwi fruit chlorosis virus by utilizing RPA-LFD is characterized by comprising an upstream primer RPA-AcCRaV-F shown in SEQ ID NO.1, a downstream primer RPA-AcCRaV-R shown in SEQ ID NO.2 and a probe Ac CRaV-nfo-probe shown in SEQ ID NO. 3.
3. The primer set according to claim 2, wherein Y in the probe AcCRaV-nfo-probe is replaced by [ THF ], FITC label is added to the 5 '-end of the probe AcCRaV-nfo-probe, and a polymerase amplification blocking group is added to the 3' -end of the probe AcCRaV-nfo-probe.
4. A kit for detecting the kiwi fruit chlorosis virus by using RPA-LFD, which is characterized by comprising the primer group, the reaction buffer solution and the positive control according to claim 2 or 3.
5. The test kit of claim 4, further comprising a reverse transcription reagent, a nucleic acid extraction reagent, and an RNase inhibitor.
6. The method for detecting the kiwi fruit chlorosis ringspot virus based on RT-RPA-LFD is characterized by comprising the following steps of:
extracting total RNA of a sample to be detected containing the kiwi fruit chlorosis virus;
carrying out RT-RPA reaction on total RNA by using the primer group of claim 2 or 3 to obtain an RPA product;
and detecting the RPA product by using a flow measurement chromatography test strip, and judging whether the kiwi fruit sample to be detected contains the kiwi fruit chlorosis ringspot virus.
7. The method according to claim 6, wherein the RT-RPA reaction is performed by adding 150 to 600nM of the upstream primer RPA-AcCRaV-F,150 to 600nM of the downstream primer RPA-AcCRaV-R,50 to 150nM of the probe ACCRaV-nfo-probe, 29.5. Mu. LPrimer Free Rehydration buffer, 1. Mu.L of total RNA, 1. Mu.L of LM-MLV reverse transcriptase, 1.4. Mu. L RNase Inhibitor, 2.5. Mu.L of 280mM magnesium acetate and the balance RNase-free H to a dry powder reaction tube in 50. Mu.L of the total system 2 O；
The dry powder reaction tube contains recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase.
8. The method according to claim 7, wherein the temperature of the RT-RPA reaction is 35-40℃and the reaction time is 10-30 min.
9. The method according to any one of claims 6 to 8, wherein the judging method comprises: after the RPA product is dripped into a sample application area of the flow-measuring chromatography test strip, the test strip is vertically inserted into an analysis buffer MGBB, incubated for 5-15 min, a test strip reading result is taken out, and if mauve lines appear at a quality control line and a detection line on the test strip, a positive sample is judged; if only the purple red line appears on the test strip at the quality control line, the test strip is judged to be a negative sample.
10. The method of claim 9, wherein the assay buffer MGCBB comprises a citrate phosphate buffer.
CN202210846901.7A 2022-07-19 2022-07-19 Primer pair, primer group, kit and method for detecting kiwi fruit chlorosis virus Pending CN116083642A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210846901.7A CN116083642A (en) 2022-07-19 2022-07-19 Primer pair, primer group, kit and method for detecting kiwi fruit chlorosis virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210846901.7A CN116083642A (en) 2022-07-19 2022-07-19 Primer pair, primer group, kit and method for detecting kiwi fruit chlorosis virus

Publications (1)

Publication Number Publication Date
CN116083642A true CN116083642A (en) 2023-05-09

Family

ID=86206921

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210846901.7A Pending CN116083642A (en) 2022-07-19 2022-07-19 Primer pair, primer group, kit and method for detecting kiwi fruit chlorosis virus

Country Status (1)

Country Link
CN (1) CN116083642A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117778620A (en) * 2024-02-27 2024-03-29 中国热带农业科学院三亚研究院 DNA probe, kit and method for distinguishing resistant varieties of papaya ringspot viruses

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117778620A (en) * 2024-02-27 2024-03-29 中国热带农业科学院三亚研究院 DNA probe, kit and method for distinguishing resistant varieties of papaya ringspot viruses

Similar Documents

Publication Publication Date Title
CN113817868B (en) Primer, probe composition and kit for detecting novel coronavirus and variant strain thereof
CN116083642A (en) Primer pair, primer group, kit and method for detecting kiwi fruit chlorosis virus
CN115852052A (en) Real-time fluorescent quantitative PCR primer probe combination for detecting CymRSV and method thereof
CN111534603B (en) Method for identifying aedes albopictus by using fluorescent RPA
CN107385117B (en) Detection method for composite virus disease (SPVD) pathogen of sweet potato seed
CN111690777B (en) Specific primer, kit and method for RT-RPA detection of citrus leaf mottle virus
CN109234461B (en) Multiple RT-PCR detection kit and detection method for peach virus
CN116479185A (en) Method for detecting lily asymptomatic virus by RT-qPCR
CN116790813A (en) Primer group, kit and method for detecting three porcine viral diarrhea pathogens
CN107937615B (en) Primers and probes for distinguishing wild strains and vaccine strains of swine Japanese encephalitis virus
CA2735978A1 (en) Method for simultaneous detection of viroids, pstvd and tcdvd
CN113684318A (en) Fluorescent PCR (polymerase chain reaction) detection kit for M protein gene of porcine reproductive and respiratory syndrome virus
CN106755602B (en) Method for synchronously detecting SPVG, SPLV and SPMMV
CN113604590A (en) Fluorescent quantitative PCR detection method and kit for plant pathogenic bacteria Pantoea ananatis
CN115786570B (en) Primer, probe, kit and method for detecting dalbergia odorifera
CN117210593B (en) Primer group for specifically detecting Pasteurella multocida and Mannheimia haemolytica and detection method
CN116515840B (en) Kit and detection method for detecting bovine viral diarrhea virus type 3
CN113322353B (en) RPA kit for detecting sweet potato pinnate mottle virus and sweet potato chlorotic stunt virus
CN112322794B (en) Kit for detecting peanut dwarf virus and tomato ringspot virus by using multiple DPO-RT-PCR
CN117965809A (en) RT-PCR detection primer and detection method for citrus delta split virus 1
CN118028539A (en) Detection primer set for non-split novel viruses of order picornaviridae infecting rice and RT-PCR detection method
CN117965813A (en) Real-time fluorescence quantitative PCR primer and kit for detecting tomato brown wrinkle fruit virus and application thereof
CN113215319A (en) Cross primer isothermal amplification primer group for detecting tobacco ringspot virus, kit and application
CN117025839A (en) Primer and detection method for detecting three kiwi fruit viruses of AcVA, ACVB and AcCRaV
CN116356076A (en) Real-time fluorescence quantitative PCR method for detecting tobacco vein banding mosaic virus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination