CN116790813A - Primer group, kit and method for detecting three porcine viral diarrhea pathogens - Google Patents

Primer group, kit and method for detecting three porcine viral diarrhea pathogens Download PDF

Info

Publication number
CN116790813A
CN116790813A CN202310715432.XA CN202310715432A CN116790813A CN 116790813 A CN116790813 A CN 116790813A CN 202310715432 A CN202310715432 A CN 202310715432A CN 116790813 A CN116790813 A CN 116790813A
Authority
CN
China
Prior art keywords
porcine
detecting
pathogens
detection
viral diarrhea
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310715432.XA
Other languages
Chinese (zh)
Inventor
张明洲
马骉
付贤树
张晓峰
帅江冰
俞晓平
叶子弘
孙凯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Academy Of Science & Technology For Inspection & Quarantine
China Jiliang University
Original Assignee
Zhejiang Academy Of Science & Technology For Inspection & Quarantine
China Jiliang University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Academy Of Science & Technology For Inspection & Quarantine, China Jiliang University filed Critical Zhejiang Academy Of Science & Technology For Inspection & Quarantine
Priority to CN202310715432.XA priority Critical patent/CN116790813A/en
Publication of CN116790813A publication Critical patent/CN116790813A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6804—Nucleic acid analysis using immunogens
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a primer group, a kit and a method for detecting three porcine viral diarrhea pathogens, which establish a multiplex loop-mediated isothermal amplification technology based on a lateral flow chromatography test strip and can detect PEDV, poRV and PBoV simultaneously. Specific LAMP primers are designed aiming at the highly conserved PEDV gp6 gene, the PoRVvp6 gene and the PBoV vp1 gene, different fluorescent groups are marked at the 5' ends of three pairs of loop primers respectively to distinguish amplicons, and finally, the aim of multiplex detection is achieved by combining a lateral flow chromatography test strip technology. By comparing with the PCR detection result, the triple LAMP-LFD detection system can meet the requirements of clinical sample detection, and the detection result is reliable and effective.

Description

Primer group, kit and method for detecting three porcine viral diarrhea pathogens
Technical Field
The invention belongs to the technical field of pathogen detection, relates to detection of porcine viral diarrhea pathogens, and particularly relates to a primer set, a kit and a method for detecting three porcine viral diarrhea pathogens by multiple loop-mediated isothermal amplification (LAMP-LFD) based on a lateral flow chromatography test strip.
Background
Pork has long been the most important source of meat products and animal protein supplements in people's daily lives. With the expansion of the pig raising scale, the occurrence frequency of pig epidemic diseases is also higher and higher. At present, the porcine viral diarrhea is a main cause of high morbidity and mortality of piglets, and causes huge economic loss to farms around the world. Wherein, the mixed infection of the porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV), the porcine rotavirus (Porcine rotavirus, poRV) and the porcine bocavirus (Porcine bocavirus, PBoV) brings great difficulty to the identification and diagnosis of the porcine diarrhea pathogen.
Porcine epidemic diarrhea (Porcine epidemic diarrhea, PED) is an acute, high contact digestive tract (intestinal) infectious disease caused by porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV), which can cause diarrhea, vomiting, dehydration and even death of piglets. PEDV is a enveloped, positive-sense single-stranded RNA virus of genomic size about 28K belonging to the Coronaviridae family (Coronaviridae), genus a coronavirus (Alphacoronavirus). The PEDV genome is capable of encoding 4 structural proteins (spike protein (S), envelope protein (E), membrane protein (M), nucleocapsid protein (N)) and 16 non-structural proteins (NSP). Among them, nucleocapsid proteins, as one of structural proteins, play an important role in virion formation, viral assembly and cellular stress response. Currently, gp6 genes, which can encode nucleocapsid proteins, have been used as targets for PEDV detection and therapy.
Porcine rotavirus (Porcine rotavirus, poRV) is one of the main viruses causing viral diarrhea of piglets, and clinical symptoms of the porcine rotavirus are expressed as dysphoria, vomiting, anorexia, diarrhea and even death of the piglets. PoRV is a non-enveloped double-stranded RNA virus, belongs to reoviridae and rotavirus, and has genome capable of encoding 6 structural proteins (viral structural protein, VP) and 6 non-structural proteins (non-structural protein, NSP), wherein VP6 forms viral underwear shell proteins, the content of the viral particles is most abundant, the viral particles can be maintained stable, and the viral particles play an important role in the viral replication and assembly process. Studies have shown that although Rotaviruses (RV) separate multiple G-and P-types during evolution, the vp6 gene is highly conserved between different types [39] Can be used as a candidate target for PoRV detection.
Porcine bocavirus (Porcine bocavirus, PBoV) is a newly discovered virus in recent years that can cause intestinal and respiratory diseases in infected pigs, which clinically manifest themselves as inappetence, vomiting, diarrhea and even death. PBoV is a single-stranded linear DNA virus without envelope, belonging to Parvoviridae, bocabavirus. The virus genome can transcribe and translate 4 proteins VP1, VP2, NS1 and NP1, wherein VP1 proteins are distributed on the outer layer of a virus capsid, and play an important role in the pathogen invasion process. The genome encoding VP1 protein is about 2.1kb in length, and the 5' end of the genome comprises a unique conserved sequence-YXGXF domain, which is critical for the process of entering viral DNA into cell nucleus. Currently, there have been studies to select the vp1 gene as a PBoV identification target.
Current methods for laboratory detection of swine diarrhea-associated pathogens include viral isolation, immunological methods, and molecular biological methods. The virus separation method and the immune method are difficult to meet the requirement of on-site instant test, and often consume long time and are complex in preparation work.
The polymerase chain reaction technology (Polymerase Chain Reaction, PCR) has the advantages of high sensitivity, strong specificity and the like, and becomes an important means for detecting the pathogen related to the diarrhea of pigs. Although conventional PCR and multiplex RT-PCR have been able to meet the needs of most virus detection, the subsequent agarose gel electrophoresis for verifying amplified products takes more time and is difficult to break out of the laboratory environment and unsuitable for field detection or large-scale field detection. With the increasing detection demands, isothermal amplification methods of nucleic acids have been developed.
Wherein Loop-mediated isothermal amplification (LAMP) can react at 60-65℃for 30-60min to amplify trace amounts of nucleic acid templates to detectable levels. The LAMP reaction is rapid and efficient, is simple to operate, has high sensitivity and strong specificity, does not depend on a special instrument, and is very suitable for large-scale instant detection on site. When LAMP is combined with a lateral flow chromatography test strip technology (Lateral flow dipstick, LFD), visual detection and semi-quantitative detection can be realized with the aid of a colloid Jin Doushu instrument.
However, since the pathogens related to diarrhea of pigs often present mixed infection, great difficulty is brought to the identification and diagnosis of diseases, and a single pathogen detection method is difficult to meet the requirements of modern rapid detection
Disclosure of Invention
The invention establishes a multiple Loop-mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP) technology based on a lateral flow chromatography test strip (Lateral flow dipstick, LFD) and can detect PEDV, poRV and PBoV simultaneously. Specific LAMP primers are designed aiming at the highly conserved PEDV gp6 gene, the PoRVvp6 gene and the PBoV vp1 gene, different fluorescent groups are marked at the 5' ends of three pairs of loop primers respectively to distinguish amplicons, and finally, the aim of multiplex detection is achieved by combining a lateral flow chromatography test strip technology. The optimized multiplex LAMP-LFD detection system can be subjected to isothermal reaction for 30min at 64 ℃ by using a small miniature metal bath to complete amplification, and amplified products can pass throughThe lateral flow chromatography test strip shows a visual result within 30-60 seconds. In order to meet the requirement of quantitative detection, the portable colloidal gold test paper quantitative analyzer can be used for assisting in reading analysis. The optimized multiplex LAMP-LFD detection system has good specificity, and can only detect three targets of PEDV, poRV and PBoV, and has no cross reaction with other viruses. Meanwhile, the detection system shows higher sensitivity, and the detection limits of PEDV, poRV and PBoV can respectively reach 2.40X10 1 copies/μL、2.89×10 1 COPIES/. Mu.L and 2.52X10 1 COPies/. Mu.L. When the method is used for detecting an actual sample, the detection result of the multiplex LAMP-LFD method and the qPCR detection result show good consistency, which indicates that the method has reliable diagnosis result and can meet the detection requirement of the actual sample.
The multi-LAMP-LFD detection technology capable of simultaneously detecting PEDV, poRV and PBoV has the advantages of rapidness, sensitivity, visualization, simplicity in operation and the like, and provides a new means for on-site detection of porcine diarrhea pathogens.
First, the invention provides primer pairs, probes and fluorophores for detecting PEDV, polv and PBoV.
Next, the present invention provides a kit comprising the above primer pair, probe, and fluorescent group.
Finally, the invention provides a multiplex LAMP-LFD detection method capable of simultaneously detecting PEDV, poRV and PBoV.
In order to achieve the above purpose, the present invention adopts the following technical scheme:
in a first aspect, the invention provides a primer set for detecting three porcine viral diarrhea pathogens, wherein the three porcine viral diarrhea pathogens are porcine epidemic diarrhea virus PEDV, porcine rotavirus PoRV and porcine bocavirus PBoV respectively; the primer group sequences are as follows:
porcine epidemic diarrhea virus PEDV:
F3：GGTACTTGCAAACAACGCTG；
B3：TCTTTGCGCCTTCTTTAGCA；
FIP：TCAATTCGCTCACCACGGCGTTTTCAAGGGGAATAAGGACCAGC；
BIP：ACTACCTCGGAACAGGACCTCATTTTACCCAGAAAACACCCTCAGT；
LF：AGCGAATTTGCTCATTCCAGTA；
LB：GACCTCCGTTATAGGACTCGT；
porcine rotavirus PoRV:
F3：CATGCTACTGTCGGACTT；
B3：CAAGTTATCTTCTCTTGAAGGT；
FIP：GCCGTTACATTTGCCAATAAAGTTTTTTTGAACTGAATCTGCAGTTTGT；
BIP：TTCGTCAGGAATATGCTATACCAGTTTTTGAATAATTGGTAACCAGCTCTG；
LF：CGTCCGCAAGCACAGATTC；
LB：GACCAGTATTTCCACCAGGTATG；
porcine bocavirus PBoV:
F3：CAACACCACAGTCGGGTAAC；
B3：TTTCCCTCCCCCATCTGG；
FIP：GCTCTGGACGCCAATTCTTGGTTTTTATTTACGCAACGGGACAAGT；
BIP：GCAACAAGATGAGAGCCGACGTTTTTGGCATGGTTTCGTAGTAGCT；
LF：TCCCATTCAATTTCGCAGGAG；
LB：TACAAAATCAACGCCGATGGAGGAT。
as a preferred embodiment of the present invention, PEDV downstream loop primer LB is labeled with Digoxin, poRV downstream loop primer LB is labeled with ROX, PBoV downstream loop primer LB is labeled with Cy5, and three upstream loop primers LF are labeled with Biotin.
In a second aspect, the invention provides a kit for detecting three porcine viral diarrhea pathogens, which comprises the primer set and a lateral flow chromatography test strip, wherein the lateral flow chromatography test strip consists of a sample pad, a binding pad, an NC (numerical control) film and an absorption pad, and a T1 test line, a T2 test line, a T3 test line and a C quality control line are respectively arranged on the NC film.
As a preferred embodiment of the invention, T1 test line 1 is coated with 0.75mg/mL Anti-Digoxin monoclonal antibody for detecting target PEDV; t2 test line 2 was coated with 0.60mg/mL Anti-ROX monoclonal antibody for detection of target PoRV; t3 test line 3 was coated with 0.50mg/mLAnti-Cy5 monoclonal antibody for detection of target PBoV; the C quality control line is coated with 2mg/mL goat anti-mouse polyclonal antibody.
In a third aspect, the invention provides a method for detecting three pathogens of porcine viral diarrhea using the above kit.
As a preferred embodiment of the present invention, the method specifically includes the steps of:
1) Sample cDNA is obtained: extracting and purifying total DNA and total RNA in the fecal sample, carrying out reverse transcription on the RNA into cDNA, and preserving the DNA and the cDNA for later use;
2) Preparing positive standard plasmid;
3) LAMP amplification is carried out by using an inner primer, an outer primer and a loop primer with fluorescent marks;
4) The amplification product is detected by using a lateral flow chromatography test strip, the color development condition of the test strip is observed, and quantitative analysis is carried out by using a colloid Jin Doushu instrument.
As a preferred scheme of the invention, the specific steps of the step 1) are as follows: taking 200 mu L of swab washing liquid, adding 500 mu LBuffer VL, uniformly mixing for 15-30 seconds by using a vortex oscillator, and centrifugally collecting and transferring the mixed liquid into FastPure RNA Columns; centrifuging at 12000rpm for 1min, discarding filtrate, and adsorbing DNA and RNA on the adsorption column membrane; other impurities were removed using Buffer RW. Centrifuging the empty column for 1 minute after the impurity washing is completed; using 35. Mu.L RNase-free ddH 2 O elutes DNA and RNA bound to the adsorption column membrane; reverse transcription of the extracted RNA into cDNA; the DNA and cDNA were stored in a-20℃refrigerator for use.
As a preferred scheme of the invention, the specific steps of the step 2) are as follows: selecting PEDV F3/B3, poRV F3/B3 and PBoV F3/B3, and performing PCR amplification reaction by taking DNA and cDNA of a virus strain as templates; after the reaction is finished, electrophoresis is carried out by using 2.0% agarose gel, after 120V for 20 minutes, the agarose gel is placed under an ultraviolet lamp, and the gel is cut to collect PCR amplified products, and target fragments are recovered and purified; cloning the recovered target fragment into a pMD18-TVEctor vector to obtain a recombinant plasmid; transferring the recombinant plasmid into E.coli DH5 alpha competent cells; selecting a positive clone single colony, adding 3mL of liquid culture medium containing Amp resistance for enrichment culture at 200rpm and 37 ℃ for 4 hours; after the culture is finished, taking part of bacterial liquid for bacterial liquid PCR identification, and continuously culturing the rest bacterial liquid for 12 hours at 200rpm and 37 ℃; after the cultivation is finished, the recombinant plasmid is extracted and purified, and is preserved at-20 ℃ for standby.
As a preferred scheme of the invention, the steps of transferring the recombinant plasmid into the competent cells of the escherichia coli DH5 alpha are as follows:
(a) Thawing 50 mu L of DH5 alpha competent cells on ice, placing on an ultra-clean workbench after 10min, adding 1 mu L of recombinant plasmid into 50 mu L of DH5 alpha competent cells, gently blowing and mixing, and placing on ice for 30min;
(b) Heat shock is carried out for 90s at 42 ℃ by using a MiniT-100H metal water bath, and the ice is immediately placed for 2min after the ice is taken out;
(c) After the ice placement is finished, 400 mu L of LB liquid medium without resistance is added into an ultra-clean workbench, and the culture is carried out for 1h at 200rpm and 37 ℃;
(d) After the cultivation, 50. Mu.L of the bacterial liquid is coated on a solid medium containing Amp resistance in an ultra-clean workbench, and the culture is carried out at a constant temperature of 37 ℃ for 16 hours.
In step 4), the amplification product is diluted 100 times by using a diluent and is dripped on a sample pad, and the diluted amplification product moves to the other end of the test strip under the capillary action; if the amplification result is positive, in the moving process, the amplification product with the Biotin label is identified and combined by the colloid Jin Teyi marked with the Anti-Biotin monoclonal antibody on the combining pad to form a binary complex; in the process that the binary complex continuously moves to the absorption pad, the amplification products respectively marked by Digoxin, ROX, cy5 can be identified and combined by the specific monoclonal antibodies coated on the three test lines; with the continuous accumulation of the colloidal gold particles, the test line can gradually show red stripes, and can be directly observed by naked eyes.
Compared with the prior art, the invention has the following beneficial effects:
1) The invention establishes a multiple LAMP-LFD detection technology capable of simultaneously detecting porcine epidemic diarrhea virus, porcine rotavirus and porcine bocavirus. Because the LAMP reaction can be carried out under the constant temperature condition, the amplification can be finished by a simple water bath or a heating block, the dependence on professional instruments is reduced, and the LAMP reaction is more convenient for field or field detection. The amplification product of the LAMP reaction can be qualitatively analyzed through a lateral flow chromatography test strip, so that the detection result can be observed by naked eyes, and when a colloid Jin Doushu instrument is used for assistance, the quantitative analysis of the detection result can be realized, and the accuracy of the detection result is improved.
2) The multi-LAMP-LFD detection method established by the invention can detect porcine epidemic diarrhea virus, porcine rotavirus and porcine bocavirus in infected pigs at the same time. Multiple LAMP-LFD detection system can use miniature metal bath, and can complete the detection of as low as 2.40X10 in 30min at the constant temperature of 64 DEG C 1 copies/μL、2.89×10 1 copies/μL、2.52×10 1 The porcine epidemic diarrhea virus, the porcine rotavirus and the porcine bocavirus of the copies/mu L can be detected simultaneously, and the detection result can be visually displayed through a lateral flow chromatography test strip, and can also be assisted to carry out quantitative analysis by a colloid Jin Doushu instrument. The multiple LAMP-LFD detection technology established by the invention is quick and efficient, simple to operate, high in sensitivity, strong in specificity and independent of special instruments, and provides a new method for on-site instant and quick detection of porcine epidemic diarrhea virus, porcine rotavirus and porcine bocavirus.
3) By comparing with the PCR detection result, the triple LAMP-LFD detection system can meet the requirements of clinical sample detection, and the detection result is reliable and effective.
Drawings
FIG. 1 is a schematic diagram of a lateral flow chromatography test strip of the present invention.
FIG. 2 shows the results of optimizing the proportion of the primer set of the present invention
FIG. 3 shows the results of optimizing the enzyme concentration of the present invention.
FIG. 4 shows the result of optimizing dNTPs concentration according to the present invention.
FIG. 5 shows the results of the reaction temperature optimization according to the present invention.
FIG. 6 is a graph showing the results of the optimization of the reaction time according to the present invention.
FIG. 7 is a multiplex LAMP-LFD-specific evaluation according to the invention.
FIG. 8 is a multiplex LAMP-LFD sensitivity evaluation according to the present invention.
FIG. 9 is a graph showing the results of detection of actual samples by the multiplex LAMP-LFD technique and qPCR technique of the present invention.
Detailed Description
The technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The DNA/cDNA of the virus strain used in the multiplex LAMP-LFD system of the invention is provided by Zhejiang province inspection and quarantine scientific and technical institute, and the information of the virus strain is shown in Table 1.
TABLE 1 Virus Strain information
Note that: ZAIQ represents the institute of inspection and quarantine science and technology in Zhejiang province.
The instrument used in the present invention: spanish Telstar secondary biosafety cabinet, mini-6KS micro centrifuge, nano-100 micro spectrophotometer, miniT-100H metal water bath of Hangzhou O Cheng Yiqi Co., ltd., quantuder of Thermo company, U.S.A TM 5 Real-Time PCR instrument, micropipette, nano ultrapure water instrument of Millipore company, france, ZX1000 gold punctuation film system and CM 2000 test strip slitter of Hangzhou Korea company, GIC-S100-B14 colloidal gold test strip quantitative analyzer produced by precision instruments, inc. of Suzhou and Mich, autoclave, ultra clean bench (SW-CJ-1 FD type single bacterial purification bench), fume hood and the like are all made in China.
The reagent used in the present invention:
(1) DNA/RNA co-extraction kit was purchased from Tiangen Biochemical technology (Beijing) Co.
(2) TIANScript II cDNA first Strand Synthesis kit was purchased from Tiangen Biochemical technologies (Beijing) Co.
(3) The UE-MN-P-250 miniplasmid extraction kit was purchased from Yoghurt Biotechnology Inc.
(4) The UE-GX-250 gum recovery kit was purchased from Yoghurt biosciences Inc.
(5) Colloidal gold test strips were developed in cooperation with Hangzhou Kuaige technologies, inc., and Anti-Biotin (Anti-Biotin mAb), anti-Digoxin (Anti-Digoxin mAb), anti-fluorescein FAM (Anti-FAM mAb), anti-fluorescein Cy5 (Anti-Cy 5 mAb), anti-fluorescein ROX (Anti-ROX mAb), anti-fluorescein TEMRA (Anti-TEMRA mAb), anti-fluorescein TET (Anti-TET mAb), anti-fluorescein VIC (Anti-VIC mAb) monoclonal antibodies and goat Anti-mouse IgG secondary antibodies were provided by Hangzhou Kuaige technologies.
(6) LB liquid medium was purchased from bioengineering (Shanghai) Inc.
(7) Agar powder, tween 20, was purchased from Sigma-Aldrich, USA.
(8) LAMP amplification product dilutions were supplied by Hangzhou Kuaige technologies Co.
(9) Syto16, dNTPs, TE buffer were purchased from America Thermo Fisher Scientific.
(10)MgSO 4 、(NH 4 ) 2 SO 4 And KCl were purchased from Shanghai Biotechnology Co., ltd.
(11) 500mM Tris-HCl (pH 8.0): 3.028g Tris-base was weighed out in 45mL ddH 2 In O, pH was adjusted to 8.0 with 4M hydrochloric acid, and ddH was replenished 2 O to 50mL, and sterilizing at 121 ℃ for 20 minutes for later use.
(12) Bst 2.0WS DNA polymerase was purchased from New England Biolabs, USA.
(13) LAMP primers and fluorescent markers, qPCR primers and probes were obtained from Shanghai Biotechnology Co., ltd.
(14) Tween 20 was purchased from Sigma-Aldrich, inc. of America.
(15) 2 XPromix Ex Taq (Probe qPCR, taKaRa) and 0.2. Mu.L of RoxII were purchased from Takara Bio-engineering (Dai).
Example 1
The embodiment provides a method for detecting three pathogens of porcine viral diarrhea, which comprises the following steps:
1) Preparation of actual samples: 125 faeces swabs were collected from a pig farm in Zhejiang province, and the swab wash was stored in an ultra-low temperature freezer at-80 ℃. Total DNA and total RNA from fecal swabs were extracted and purified according to the FastPure Viral DNA/RNA Mini Kit (Nanjinouzan Biotechnology Co., ltd.) instructions. First, 200. Mu.L of swab washing solution was added to 500. Mu.L of Buffer VL, and the mixture was collected by centrifugation and transferred to FastPure RNA Columns after being homogenized by vortex shaking for 15 to 30 seconds. Centrifugation at 12000rpm for 1min, the filtrate was discarded, and DNA and RNA had been adsorbed on the adsorption column membrane. Next, buffer RW is used to remove other impurities. And (5) centrifuging the mixture for 1 minute by using an empty column after the impurity washing is completed. Finally, 35. Mu.L of RNase-free ddH was used 2 O elutes the DNA and RNA bound to the membrane of the adsorption column. The extracted RNA was reverse transcribed into cDNA according to the instructions of the TIANScript II cDNA first strand synthesis kit (Tiangen Biochemical Co., ltd.). Finally, the DNA and cDNA were stored in a-20℃freezer until use. In order to prevent RNase pollution, plastic products such as gun heads, collecting pipes and the like used in the experiment are free of RNase.
2) Positive standard plasmid preparation:
according to the primer set screening result, PEDV F3/B3, poRV F3/B3 and PBoV F3/B3 of a better primer set are selected, and DNA and cDNA of a virus strain are used as templates for PCR amplification reaction. The reaction system is shown in Table 2.5. The reaction procedure is: (1) reacting at 94 ℃ for 10min; (2) 94 ℃ for 30s,58 ℃ for 30s and 72 ℃ for 30s, for 35 cycles; (3) reaction at 72℃for 10min. The PCR reaction system is shown in Table 2.
TABLE 2 PCR reaction System
Composition of the components Concentration of mother liquor Volume (mu L) Final concentration
10×Buffer 10× 5.00 1×
dNTPs 10mM 4.00 10mM
F3 40μM 1.00 0.8μM
B3 40μM 1.00 0.8μM
Pyrobest 5U/μL 0.50 0.05U/μL
Templates - 1.00 -
ddH 2 O - 37.50 -
After the reaction was completed, electrophoresis was performed using 2.0% agarose gel, and after 120v for 20 minutes, the agarose gel was carefully placed under an ultraviolet lamp, and the gel was cut to collect PCR amplification products. The fragment of interest was recovered and purified according to the instructions of the DNA gel recovery kit (EU-GX-250, UElandy, st. Johnson, china). Cloning the recovered target fragment into a pMD18-TVector (TaKaRa) vector to obtain a recombinant plasmid. Transferring the recombinant plasmid into E.coli DH5 alpha competent cells, the steps are as follows: (1) Thawing 50 mu L of DH5 alpha competent cells on ice, placing on an ultra-clean workbench after 10min, adding 1 mu L of recombinant plasmid into 50 mu L of DH5 alpha competent cells, gently blowing and mixing, and placing on ice for 30min; (2) Heat shock is carried out for 90s at 42 ℃ by using a MiniT-100H metal water bath, and the ice is immediately placed for 2min after the ice is taken out; (3) After the ice placement is finished, 400 mu L of LB liquid medium without resistance is added into an ultra-clean workbench, and the culture is carried out for 1h at 200rpm and 37 ℃; (4) After the cultivation, 50. Mu.L of the bacterial liquid is coated on a solid medium containing Amp resistance in an ultra-clean workbench, and the culture is carried out at a constant temperature of 37 ℃ for 16 hours.
A positive clone single colony is picked, and 3mL of liquid culture medium containing Amp resistance is added for enrichment culture at 200rpm and 37 ℃ for 4 hours. And (3) taking part of bacterial liquid after the culture is finished, carrying out bacterial liquid PCR identification, and continuously culturing the rest bacterial liquid for 12 hours at 200rpm and 37 ℃. After the cultivation, the recombinant plasmid was extracted and purified according to the instructions of the plasmid preparation kit (EU-MN-P-250). And (3) sending part of the extracted and purified recombinant plasmid to Shanghai biological engineering Co., ltd for sequencing, and storing the rest at-20 ℃ for later use. The sequencing results of the three recombinant plasmids were analytically aligned with the target gene sequences using MagAlign software. Recombinant plasmid concentrations were determined using a Nano-100 differential spectrophotometer (Allsheng instruments, hangzhou, china) and corresponding plasmid copy numbers were calculated. The calculation formula of plasmid copy number is copies/. Mu.L= ((ng/. Mu.L). Times.10) -9 ×6.02×10 23 )/(genome length×660(g/mol))。
3) Preparation of multiple lateral flow chromatography test strips: the lateral flow chromatography test strip consists of a sample pad, a binding pad, an NC membrane and an absorption pad. First, a colloidal gold solution labeled with Anti-Biotin monoclonal antibody was uniformly sprayed on a binding pad using a spot film apparatus. Next, a test line and a quality control line were defined on the NC film. Test line 1 (T1) was coated with 0.75mg/mL Anti-Digoxin monoclonal antibody for detection of target PEDV; test line 2 (T2) coated with 0.60mg/mL Anti-ROX monoclonal antibody for detection of target PoRV; test line 3 (T3) was coated with 0.50mg/mLAnti-Cy5 monoclonal antibody for detection of target PBoV; and the quality control line (C) is coated with 2mg/mL goat anti-mouse polyclonal antibody. The conjugate pad and NC film were placed in a 37 ℃ oven for 12 hours. And (5) assembling the test paper card after the drying is finished, cutting the test paper card into a test paper strip with the thickness of 2.5mm by using a test paper strip cutting machine, and storing the test paper card in a dry environment for later use. A schematic of the multiplex lateral flow chromatography test strip is shown in FIG. 1.
4) LAMP amplification is carried out by using the inner primer, the outer primer and the loop primer with fluorescent label, and the loop primer can be complementary with a loop region formed in the middle of the synthesis reaction in the amplification process, so that the finally obtained positive amplification product carries fluorescent label. The sequences of the primer groups of the multiplex LAMP-LFD system and the fluorescent markers are shown in Table 3.
TABLE 3 multiplex LAMP-LFD system primer group sequence and fluorescent markers thereof
The amplification product was diluted 100-fold with a diluent and then dropped onto the sample pad, and the diluted amplification product was moved toward the other end of the test strip by capillary action. If the amplification result is positive, the amplification product with the Biotin label is identified and combined by the colloid Jin Teyi marked with the Anti-Biotin monoclonal antibody on the combining pad in the moving process to form a binary complex. During the continued movement of the binary complex towards the absorbent pad, the amplified products, each labeled with Digoxin, ROX, cy5, were recognized and bound by the specific monoclonal antibodies coated on the three test lines. With the continuous accumulation of the colloidal gold particles, the test line can gradually show red stripes, and can be directly observed by naked eyes.
4.1 Along with the continuous accumulation of the colloidal gold particles on the test line, red strips can be observed by naked eyes, so that the simple qualitative detection is realized. Then, the color intensity of the red band of the test line is also changed due to the difference of amplification efficiency. To be able to describe the detection results more accurately, semi-quantitative analysis can be achieved using a colloid Jin Doushu meter. The GIC-S100-B14 colloid Jin Doushu instrument can realize four-wire detection at most, the detection time is less than 5S, and the detection result has high repeatability and high sensitivity. The GIC-S100-B14 colloid Jin Doushu instrument can be combined with HMreader software to convert optical signals of a test line (T) and a quality control line (C) into electric signals with a T Value and a C Value, and generally define the ratio (T/C Value) of the T Value to the C Value as the strength of the test line, so that semi-quantitative analysis is realized.
Example 2
The present example is a multiple LAMP-LFD system optimization experiment, in order to determine the optimal multiple LAMP-LFD detection system, at 2.40X10 6 copies/μL、2.89×10 6 copies/μL、2.52×10 6 PEDV, poRV and PBoV standard plasmids with copies/mu L are used as templates, and the influence of different primer ratios, enzyme concentrations, dNTPs concentrations, reaction temperatures and reaction time on the multiplex LAMP-LFD amplification efficiency is respectively verified.
The ratio between PEDV, polv and PBoV primer sets was set to be 1.4:1:0.6, 1.2:1:0.8, 1.1:1:0.9, 1:1:1, 0.9:1:1.1, 0.8:1:1.2, 0.6:1:1.4, respectively. The primer ratio optimization experiment of the multiplex LAMP system is shown in Table 4.
TABLE 4 different primer ratios
The amplification reaction was performed in a MiniT-100H metal water bath at 64℃for 40 minutes. After the reaction is finished, the amplified product is diluted by 100 times and is dripped on a sample pad of the multiple lateral flow chromatography test strip. After 10 minutes, if the background plate of the test strip is completely run out, a colloid Jin Doushu instrument is used for reading, and the optimal primer group proportion of the multiple LAMP system is determined according to the quantitative analysis result. All experiments were repeated 3 times. The results are shown in fig. 2 and table 5, wherein in fig. 2, the left side is a graph of the results of the lateral flow chromatography test strip, and the right side is a data result of the colloid Jin Doushu instrument.
TABLE 5 final concentrations of the components of the primer set
Based on the result of primer proportion optimization, optimization of Bst 2.0WS DNA polymerase concentration was performed for the multiplex LAMP reaction system. The final concentrations of Bst 2.0. 2.0WS DNA polymerase in the reaction system were set to 0.16U/. Mu.L, 0.32U/. Mu.L, 0.48U/. Mu.L, 0.64U/. Mu.L, 0.80U/. Mu.L and 0.96U/. Mu.L, respectively. The remaining conditions were all set the same. The reaction was carried out at 64℃for 40 minutes. After the reaction is finished, detecting the amplified product by using a lateral flow chromatography test strip, observing the color development condition of the test strip, and then performing semi-quantitative analysis by using a colloid Jin Doushu instrument. All experiments were repeated 3 times. The results are shown in FIG. 3, wherein in FIG. 3, the left side is a result chart of the lateral flow chromatography test strip, and the right side is a data result of a colloid Jin Doushu instrument.
And after the optimization of the proportion of the primer group and the enzyme concentration is completed, optimizing the concentration of dNTPs aiming at a multiple LAMP reaction system. The final concentration of dNTPs in the reaction system was set to 0.8mM,1mM,1.2mM,1.4mM,1.6mM,1.8mM. The remaining conditions were all set the same. The reaction was carried out at 64℃for 40 minutes. The amplified products are detected by using a multiple lateral flow chromatography test strip, and the optimal dNTPs concentration of the multiple LAMP system is determined after the detection by a colloid Jin Doushu instrument. All experiments were repeated 3 times, the results are shown in fig. 4, in which the left side is a graph of the results of the lateral flow chromatography test strip, and the right side is the data of the colloid Jin Doushu instrument.
And (3) optimizing the reaction conditions of the multiple LAMP system on the basis of completing the optimization of the components of the multiple LAMP system. The conditions of the components of the system are controlled to be the same, so that the amplification reaction is respectively carried out at six temperatures of 55 ℃,58 ℃,61 ℃,64 ℃,67 ℃ and 70 ℃ for 40 minutes. After amplification, a lateral flow chromatography test strip is used for qualitative detection, a colloid Jin Doushu instrument is used for quantitative analysis, and finally the optimal reaction temperature of the multiple LAMP system is determined. All experiments were repeated 3 times, and the results are shown in fig. 5, in which the left side is a side flow chromatography test strip result diagram, and the right side is a colloid Jin Doushu instrument data result.
On the basis of the above optimization experiment, the reaction time of the multiple LAMP system is set to be 5min,10min,15min,20min,25min,30min,35min and 40min respectively. After the amplification reaction is finished, a lateral flow chromatography test strip and a colloid Jin Doushu instrument are used for detection and reading, and the optimal reaction time of the multiple LAMP is determined. All experiments were repeated 3 times, the results are shown in fig. 6, in which the left side is a side flow chromatography test strip result diagram, and the right side is a colloid Jin Doushu instrument data result.
Thus, the reaction was determined to be carried out in a MiniT-100H metal water bath at 64℃for 30min. And diluting the amplified product 100 times after the reaction is finished, performing qualitative detection by using a multiple lateral flow chromatography test strip, after 10min, completely running out the background plate of the test strip, performing data analysis by combining a colloid Jin Doushu instrument, and defining a T/C value as the strength of the test line. The multiple LAMP-LFD reaction system is shown in Table 6.
TABLE 6 multiplex LAMP-LFD reaction System
/>
Example 3
In this example, the multiplex LAMP-LFD specificity test was performed by using the DNA or cDNA of the virus strains shown in Table 3 as a template, and performing the multiplex LAMP-LFD system primer specificity evaluation and the methodology specificity evaluation under the optimal system and the optimal reaction conditions. The amplified product was diluted 10After 0-fold, the sample was added dropwise to the sample pad of the lateral flow chromatographic strip, and the methodological specificity was evaluated by observing the color development of the lateral flow chromatographic strip test line. All experiments were repeated 3 times. The results are shown in fig. 7, a: primer specificity evaluation results, B: as a result of methodological specificity evaluation, when a single target gene is used as a template, only its corresponding specific test line shows a red band, and none of the test lines corresponding to the other two target genes is developed. When the target genes are mixed in pairs as templates, only the two target genes are colored corresponding to the test lines. When three target genes were used simultaneously, bright and clear red bands appeared on all three test lines. When DEPC H is used 2 O was used as a negative control, the strip did not develop, indicating that no non-specific amplification occurred. The result proves that the primer group of the multiplex LAMP-LFD system has good specificity. The result of methodological specificity evaluation is shown as B in fig. 7, and when PCV1, TGEV, PRRSV, PRV, PPV was used as a template, no red bands appeared on the test strip test line. The results prove that the method has good specificity and does not generate cross reaction between viruses.
Example 4
In this example, a multiplex LAMP-LFD sensitivity test was performed, and the sensitivity of the multiplex LAMP-LFD system was evaluated using the positive standard plasmid prepared in example 1 as a template. The standard plasmid is diluted by 10 times of TE buffer solution and then 2.40 multiplied by 10 is selected 6 copies/μL-2.40×10 0 copies/μL、2.89×10 6 copies/μL-2.89×10 0 copies/μL、2.52×10 6 copies/μL-2.52×10 0 Sensitivity experiments were performed on standard plasmids of copies/. Mu.L. PEDV, polv and PBoV standard plasmids at the same copy number were mixed in a ratio of 1:1:1 as positive templates, DEPC H 2 O served as a negative control. And determining the detection lower limit of the multiplex LAMP-LFD system by the color development condition of the lateral flow chromatography test strip and semi-quantitative analysis of a colloid Jin Doushu instrument, and drawing a sensitivity standard curve.
The results are shown in FIG. 8, A is the result of a lateral flow chromatography test strip, B is a sensitivity standard curve, and after 10-time gradient dilution by TE buffer, the copy numbers of PEDV, poRV and PBoV standard plasmids are respectively 2.40X10 6 copies/μL-2.40×10 0 copies/μL，2.89×10 6 copies/μL-2.89×10 0 copies/μL，2.52×10 6 copies/μL-2.52×10 0 COPies/. Mu.L. The results of the multiplex LAMP-LFD system sensitivity evaluation are shown in FIG. 8. As the copy number of the target gene standard plasmid decreases, the brightness of the red band of the specific test line also gradually decreases. When the plasmid copy numbers of PEDV, poRV and PBoV were 2.40X10 respectively 1 copies/μL、2.89×10 1 copies/μL、2.52×10 1 At copies/. Mu.L, the test line appeared to be a faint red band visible to the naked eye when the plasmid copy number was 2.40X10 0 copies/μL、2.89×10 0 copies/μL、2.52×10 0 At copies/. Mu.L, the strip test line does not develop color. No non-specific amplification was detected throughout the reaction. The results showed that the sensitivity of multiplex LAMP-LFD detection of PEDV, poRV and PBoV was 2.40X10, respectively 1 copies/μL、2.89×10 1 copies/μL、2.52×10 1 COPies/. Mu.L. And drawing a sensitivity standard curve by combining a colloid Jin Doushu instrument data result, taking the logarithm of the plasmid copy number as an abscissa and taking a test line T/C value as an ordinate. PEDV linear equation is: y=0.192x+0.0647 (r2= 0.9841); the PoRV linear equation is: y=0.2009 x-0.0213 (r2= 0.9868); the PBoV linear equation is: y= 0.1991x-0.0587 (r2= 0.9882). The results prove that the multiple LAMP-LFD detection system has better correlation between the template concentration and the T/C value of the test line.
Example 5
This example is the establishment of a fluorescent quantitative PCR system, and the design of qPCR primers and probes was performed using Primer3 (v.0.4.0) on-line website and Beacon Designer 7.9 software for the highly conserved PEDV gp6 gene (accession number: NC-003436.1), poRV vp6 gene (accession number: KC 113249.1) and PBoV vp1 gene (accession number: NC-023673.1). The qPCR primer and probe sequences are shown in Table 7.qPCR primers and probes were synthesized by Shanghai Biotechnology Co.
TABLE 7 qPCR primer and probe sequences
/>
qPCR reactions in Quantum TM 5 Real-Time PCR Instrument, the reaction system is shown in Table 8. According to the requirements of the product specification of Premix Ex Taq (Probe qPCR, taKaRa), the reaction procedure is set as follows: (1) 95 ℃ for 5 minutes; (2) repeating 40 cycles: the reaction was carried out at 95℃for 5 seconds and at 60℃for 30 seconds.
Table 8.QPCR reaction System (in the example of PEDV)
Example 6
In this example, the actual sample was tested by multiplex LAMP-LFD, and genomic DNA and cDNA of 125 actual samples extracted in example 1 were used as templates, and the optimized multiplex LAMP-LFD reaction system and qPCR system were used for testing, respectively. And comparing the coincidence degree of the detection results of the multiple LAMP-LFD system and the qPCR system, thereby verifying whether the detection results of the multiple LAMP-LFD system are reliable or not and judging whether the method can meet the requirements of actual sample detection or not. And (3) quantitatively analyzing the result, and judging that the qPCR result is positive when the Ct value is less than or equal to 35. Finally, the two sets of data were analyzed and compared using Microsoft Excel software (Microsoft inc., USA).
The results of example 5 and example 6 are shown in fig. 9, which shows: "+" indicates positive and "-" indicates negative. The coincidence rate of the result of the multiple LAMP-LFD detection of the actual sample and the result of the qPCR detection of the actual sample is more than 99 percent, as shown in Table 9.
TABLE 9 detection of actual sample results by multiplex LAMP-LFD technique and qPCR technique
It can be seen that the multiple LAMP system of the invention can be usedThe miniature metal water bath is heated for 30min at 64 ℃ to complete the reaction, thereby not only getting rid of the dependence on professional instruments, but also realizing rapid and efficient amplification. And detecting the amplified product after the reaction is finished by using a lateral flow chromatography test strip, and quantitatively analyzing by using a colloid Jin Doushu instrument on the basis of visualization, so that the accuracy of the result is improved. The optimized multiplex LAMP-LFD detection system has high specificity and high sensitivity, does not cross react with other viruses, and has detection limits of PEDV, poRV and PBoV of 2.40X10 respectively 1 copies/μL、2.89×10 1 copies/μL、2.52×10 1 COPies/. Mu.L. To verify the reliability of the multiplex LAMP-LFD method, the detection of 125 actual samples was performed. The result shows that the coincidence rate of the multiple LAMP-LFD detection result and the qPCR detection result reaches more than 99 percent, the time is less, and the detection requirement of modern epidemiology can be met.
In conclusion, the multiplex LAMP-LFD method established by the invention is a method which is rapid and efficient, is simple and convenient to operate, has high specificity and high sensitivity and is suitable for on-site detection, and provides powerful support for identifying and diagnosing the porcine diarrhea virus.
While the invention has been described with respect to preferred embodiments thereof, it will be understood by those skilled in the art that various modifications and additions may be made without departing from the scope of the invention. Equivalent embodiments of the present invention will be apparent to those skilled in the art having the benefit of the teachings disclosed herein, when considered in the light of the foregoing disclosure, and without departing from the spirit and scope of the invention; meanwhile, any equivalent changes, modifications and evolution of the above embodiments according to the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims (10)

1. The primer group for detecting three porcine viral diarrhea pathogens is characterized in that the three porcine viral diarrhea pathogens are porcine epidemic diarrhea virus PEDV, porcine rotavirus PoRV and porcine bocavirus PBoV respectively; the primer group sequences are as follows: porcine epidemic diarrhea virus PEDV:
F3：GGTACTTGCAAACAACGCTG；
B3：TCTTTGCGCCTTCTTTAGCA；
FIP：TCAATTCGCTCACCACGGCGTTTTCAAGGGGAATAAGGACCAGC；
BIP：ACTACCTCGGAACAGGACCTCATTTTACCCAGAAAACACCCTCAGT；
LF：AGCGAATTTGCTCATTCCAGTA；
LB：GACCTCCGTTATAGGACTCGT；
porcine rotavirus PoRV:
F3：CATGCTACTGTCGGACTT；
B3：CAAGTTATCTTCTCTTGAAGGT；
FIP：GCCGTTACATTTGCCAATAAAGTTTTTTTGAACTGAATCTGCAGTTTGT；
BIP：TTCGTCAGGAATATGCTATACCAGTTTTTGAATAATTGGTAACCAGCTCTG；
LF：CGTCCGCAAGCACAGATTC；
LB：GACCAGTATTTCCACCAGGTATG；
porcine bocavirus PBoV:
F3：CAACACCACAGTCGGGTAAC；
B3：TTTCCCTCCCCCATCTGG；
FIP：GCTCTGGACGCCAATTCTTGGTTTTTATTTACGCAACGGGACAAGT；
BIP：GCAACAAGATGAGAGCCGACGTTTTTGGCATGGTTTCGTAGTAGCT；
LF：TCCCATTCAATTTCGCAGGAG；
LB：TACAAAATCAACGCCGATGGAGGAT。
2. the primer set for detecting three porcine viral diarrhea pathogens according to claim 1, wherein PEDV downstream loop primer LB is labeled Digoxin, poRV downstream loop primer LB is labeled ROX, PBoV downstream loop primer LB is labeled Cy5, and three upstream loop primers LF are labeled Biotin.
3. The kit for detecting three porcine viral diarrhea pathogens is characterized by comprising the primer group as claimed in claim 1 or 2 and a lateral flow chromatography test strip, wherein the lateral flow chromatography test strip consists of a sample pad, a binding pad, an NC film and an absorption pad, and a T1 test line, a T2 test line, a T3 test line and a C quality control line are respectively arranged on the NC film.
4. The kit for detecting three porcine viral diarrhea pathogens according to claim 3, wherein T1 test line 1 is coated with 0.75mg/mL Anti-Digoxin monoclonal antibody for detection of target PEDV; t2 test line 2 was coated with 0.60mg/mL Anti-ROX monoclonal antibody for detection of target PoRV; t3 test line 3 was coated with 0.50mg/mLAnti-Cy5 monoclonal antibody for detection of target PBoV; the C quality control line is coated with 2mg/mL goat anti-mouse polyclonal antibody.
5. A method for detecting three pathogens of porcine viral diarrhea, characterized in that the method uses the kit of claim 3 or 4.
6. The method for detecting three pathogens of porcine viral diarrhea according to claim 5, wherein the method comprises the steps of:
1) Sample cDNA is obtained: extracting and purifying total DNA and total RNA in the fecal sample, carrying out reverse transcription on the RNA into cDNA, and preserving the DNA and the cDNA for later use;
2) Preparing positive standard plasmid;
3) LAMP amplification is carried out by using an inner primer, an outer primer and a loop primer with fluorescent marks;
4) The amplification product is detected by using a lateral flow chromatography test strip, the color development condition of the test strip is observed, and quantitative analysis is carried out by using a colloid Jin Doushu instrument.
7. The method for detecting three pathogens of porcine viral diarrhea according to claim 6, wherein the specific steps of step 1) are: taking 200 mu L of swab washing liquid, adding 500 mu L of Buffer VL, uniformly mixing for 15-30 seconds by using a vortex oscillator, and centrifugally collecting and transferring the mixed liquid into FastPure RNA Columns; centrifuging at 12000rpm for 1min, discarding filtrate, and adsorbing DNA and RNA on the adsorption column membrane; other impurities were removed using Buffer RW. Washing impuritiesCentrifuging the empty column for 1 minute after completion; using 35. Mu.L RNase-free ddH 2 O elutes DNA and RNA bound to the adsorption column membrane; reverse transcription of the extracted RNA into cDNA; the DNA and cDNA were stored in a-20℃refrigerator for use.
8. The method for detecting three pathogens of porcine viral diarrhea according to claim 6, wherein the specific steps of step 2) are: selecting PEDV F3/B3, poRV F3/B3 and PBoV F3/B3, and performing PCR amplification reaction by taking DNA and cDNA of a virus strain as templates; after the reaction is finished, electrophoresis is carried out by using 2.0% agarose gel, after 120V for 20 minutes, the agarose gel is placed under an ultraviolet lamp, and the gel is cut to collect PCR amplified products, and target fragments are recovered and purified; cloning the recovered target fragment into a pMD18-TVEctor vector to obtain a recombinant plasmid; transferring the recombinant plasmid into E.coli DH5 alpha competent cells; selecting a positive clone single colony, adding 3mL of liquid culture medium containing Amp resistance for enrichment culture at 200rpm and 37 ℃ for 4 hours; after the culture is finished, taking part of bacterial liquid for bacterial liquid PCR identification, and continuously culturing the rest bacterial liquid for 12 hours at 200rpm and 37 ℃; after the cultivation is finished, the recombinant plasmid is extracted and purified, and is preserved at-20 ℃ for standby.
9. The method for detecting three pathogens of porcine viral diarrhea according to claim 8, wherein the step of transferring the recombinant plasmid into competent cells of escherichia coli DH5 a is as follows:
(a) Thawing 50 mu L of DH5 alpha competent cells on ice, placing on an ultra-clean workbench after 10min, adding 1 mu L of recombinant plasmid into 50 mu L of DH5 alpha competent cells, gently blowing and mixing, and placing on ice for 30min;
(b) Heat shock is carried out for 90s at 42 ℃ by using a MiniT-100H metal water bath, and the ice is immediately placed for 2min after the ice is taken out;
(c) After the ice placement is finished, 400 mu L of LB liquid medium without resistance is added into an ultra-clean workbench, and the culture is carried out for 1h at 200rpm and 37 ℃;
(d) After the cultivation, 50. Mu.L of the bacterial liquid is coated on a solid medium containing Amp resistance in an ultra-clean workbench, and the culture is carried out at a constant temperature of 37 ℃ for 16 hours.
10. The method for detecting three pathogens of porcine viral diarrhea according to claim 6, wherein in step 4), the amplification product is diluted 100 times by using a diluent, and the diluted amplification product is dripped into a sample pad, and moves to the other end of the test strip under the capillary action; if the amplification result is positive, in the moving process, the amplification product with the Biotin label is identified and combined by the colloid Jin Teyi marked with the Anti-Biotin monoclonal antibody on the combining pad to form a binary complex; in the process that the binary complex continuously moves to the absorption pad, the amplification products respectively marked by Digoxin, ROX, cy5 can be identified and combined by the specific monoclonal antibodies coated on the three test lines; with the continuous accumulation of the colloidal gold particles, the test line can gradually show red stripes, and can be directly observed by naked eyes.
CN202310715432.XA 2023-06-16 2023-06-16 Primer group, kit and method for detecting three porcine viral diarrhea pathogens Pending CN116790813A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310715432.XA CN116790813A (en) 2023-06-16 2023-06-16 Primer group, kit and method for detecting three porcine viral diarrhea pathogens

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310715432.XA CN116790813A (en) 2023-06-16 2023-06-16 Primer group, kit and method for detecting three porcine viral diarrhea pathogens

Publications (1)

Publication Number Publication Date
CN116790813A true CN116790813A (en) 2023-09-22

Family

ID=88034146

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310715432.XA Pending CN116790813A (en) 2023-06-16 2023-06-16 Primer group, kit and method for detecting three porcine viral diarrhea pathogens

Country Status (1)

Country Link
CN (1) CN116790813A (en)

Similar Documents

Publication Publication Date Title
CN107630109A (en) A kind of fluorescence quantification PCR primer and kit for detecting Novel pig acute diarrhea syndrome coronavirus
CN107190104B (en) Five-porcine diarrhea virus multiplex real-time fluorescent quantitative PCR rapid diagnosis kit and application
CN104946795B (en) Primer, probe and kit for Site Detection various serotype foot and mouth disease virus
CN108866243B (en) Porcine enterocoronavirus 4-fold fluorescent quantitative PCR detection kit
CN110951916A (en) Primer and kit for detecting SADS-CoV based on real-time fluorescent reverse transcription recombinase polymerase nucleic acid amplification technology
CN110904270A (en) Multiplex RT-PCR detection method for porcine delta coronavirus, porcine epidemic diarrhea virus and porcine sapelovirus and application
CN109609695A (en) Detect the RPA-LED visualizing agent box of Porcine epidemic diarrhea virus
CN112094953A (en) Kit, primer and probe for simultaneously detecting bovine viral diarrhea virus, bovine rotavirus and bovine coronavirus
CN103725794B (en) Detect fluorescent quantitation RT PCR primers, probe and its method for PRRSV
CN112746134A (en) Kit for rapidly detecting nucleic acid of African swine fever virus and application
CN108624713B (en) Method and kit for identifying and detecting porcine pseudorabies vaccine virus and wild virus
Li et al. Development of a recombinase-aided amplification combined with lateral flow dipstick assay for the rapid detection of the African swine fever virus
CN114015815A (en) Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof
CN113943831A (en) Multiple fluorescent quantitative primer and probe combination capable of diagnosing three high-incidence pathogens of porcine diarrhea disease simultaneously and application thereof
CN112553372A (en) Porcine pseudorabies virus and porcine circovirus type 3 dual-fluorescence quantitative PCR detection primer, probe, kit and method
CN111471802A (en) Porcine delta coronavirus rapid detection primer, kit and application thereof
CN114438265B (en) Nucleic acid composition, kit and detection method for simultaneously detecting porcine delta coronavirus, reovirus and porcine kokumi virus
CN116790813A (en) Primer group, kit and method for detecting three porcine viral diarrhea pathogens
CN116024208A (en) Kit capable of simultaneously detecting 26 pig epidemic diseases through single reaction
CN106701942A (en) Real-time fluorescence PCR detection reagent kit for mycoplasma hyopneumoniae of pigs and purpose of real-time fluorescence PCR detection reagent kit
CN111961757A (en) Double-gene probe method real-time fluorescence quantitative PCR kit for detecting duck tembusu virus and application
CN111500773A (en) Fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) primer, probe and kit for identifying serotype of epidemic hemorrhagic disease virus
CN116411136B (en) Primer probe combination and kit for simultaneously detecting bovine norovirus and bovine rotavirus and application of primer probe combination and kit
CN117802275B (en) Triple fluorescence quantitative PCR detection method for main pathogen of calf diarrhea and application thereof
CN116515840B (en) Kit and detection method for detecting bovine viral diarrhea virus type 3

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination