CN116064516A - Targeting long-chain non-coding double-stranded RNA and application thereof - Google Patents

Abstract

The invention provides a targeted long-chain non-coding double-stranded RNA, the nucleotide sequence of the sense strand of which is shown as SEQ ID NO: 1. The double-stranded RNA can inhibit the growth and development of schistosome, reduce the generation of ova and effectively relieve the pathological damage of the liver of a host. The invention also provides an application of the double-stranded RNA in preparation of anti-schistosome drugs. Through animal experiments, the schistosome has a good inhibition effect on the development stage of schistosome, can effectively inhibit the growth and development of schistosome and the oviposition of female schistosome, lightens the pathological damage to a host, and has great application value and prospect.

Description

Targeting long-chain non-coding double-stranded RNA and application thereof

Technical Field

The invention relates to the technical fields of molecular biology and biological medicine, in particular to targeted long-chain non-coding double-stranded RNA for inhibiting schistosome growth and oviposition and application thereof.

Background

Schistosomiasis is a parasitic disease of the human and animal co-occurrence caused by schistosome infection, and is recognized by the world health organization as the second most overlooked tropical disease in the world after intestinal helminthiasis. Worldwide, about 2.29 million people are infected. The epidemic of China is mainly Japanese blood fluke, which is intensively distributed in the middle and downstream river basin of the Yangtze river. The pathological damage and transmission of schistosomiasis are mainly caused by a large number of ova generated by female worms after the female worms hug the female worms to develop and mature. Therefore, the deep research on the reproductive development process of the schistosoma japonicum can provide a new idea for developing anti-schistosome vaccines and medicaments.

At present, a plurality of teams including the applicant have conducted intensive studies on protein coding genes important in the schistosoma japonicum reproductive development process, but less studies are conducted on various types of non-coding RNAs (miRNA, lncRNAs, snoRNA and the like) and roles thereof in the schistosoma japonicum reproductive development process. In recent years, a great deal of research shows that long non-coding RNAs (lncRNAs) are major participants in gene regulation, and can play a key role in the development and reproduction of a plurality of species, and are involved in regulating important biological processes such as tissue and organ development, sex determination and gonadogenesis, sex hormone reaction, meiosis, gametogenesis and the like. Thus, applicants speculate that lncRNAs-mediated transcription and posttranscriptional regulation may play a key role in the process of the male and female cohesion of Schistosoma japonicum to reproductive maturation.

Functional studies of lncRNAs in schistosome are relatively lacking due to lack of technical means. Currently, potential lncRNAs that may have regulatory effects on coding genes are identified based on co-expression related networks, mainly by bioinformatic methods. Kim et al identified lncRNAs characteristic of 711 metacercaria stages by collecting samples of schistosome metacercaria stages and identified central lncRNAs with potential regulatory capacity by constructing lncRNAs-mRNA co-expression networks. Maciel et al analyzed lncRNAs and mRNAs for all life cycles in Schistosoma mansoni using a weighted gene co-expression network and calculated a modular network with tissue and period specificity, and these results showed that lncRNAs of Schistosoma were expressed in a period-specific manner and had a co-expression pattern, providing a reference for the study of the regulatory function of lncRNAs. In addition, exciting the schistosome lncRNAs has also achieved a certain result in the functional exploration, silveira et al can cause the adhesion, movement and pairing disorder, the viability reduction of 20% and the female oviposition reduction of 33% of schistosome and the egg development defect after knocking down SmLINC156349 gene in schistosome through RNA interference in vitro. These results all show the great potential to characterize lncRNAs as potential therapeutic targets against schistosome and the importance of further studying the regulatory mechanisms of lncRNAs in schistosome.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a targeted Long-chain non-coding double-stranded RNA which can inhibit the growth and development of schistosome, reduce the generation of ova, effectively reduce the pathological damage of the liver of a host, and also prove that the Long-chain non-coding RNA can be used as an anti-schistosome drug target for the first time.

In order to solve the technical problems, the targeted long-chain non-coding double-stranded RNA and the application thereof provided by the invention are characterized in that the nucleotide sequence of the sense strand of the double-stranded RNA is shown as SEQ ID NO: 1.

The invention also provides application of the double-stranded RNA in preparation of anti-schistosome medicines.

Specifically, the schistosome is schistosoma japonicum.

Specifically, the double-stranded RNA has an effect of inhibiting the oviposition of schistosoma japonicum bodies in vitro.

In particular, the double-stranded RNA has the effect of inhibiting the growth and development of Japanese blood flukes in vivo.

In particular, the double-stranded RNA reduces the effect of schistosoma japonicum on pathological damage of the liver of a host in vivo.

Specifically, the dosage form of the medicine is injection, oral preparation, buccal tablet, spray, suspension, capsule, tablet, pill or granule.

Specifically, the medicine also comprises one or more of pharmaceutically acceptable carriers, diluents or excipients, and also comprises a schistosome dsRNANONSJP003385 solution prepared by taking normal saline as a solvent.

The invention provides a targeted long-chain non-coding double-stranded RNA, which is found to have a good inhibition effect on the development stage of schistosome, can effectively inhibit the growth and development of schistosome and the oviposition of female schistosome, lightens the pathological damage to a host, and has a great application value and prospect through animal experiments.

Drawings

In order to more clearly illustrate the technical solutions of the present invention, the following brief description of the drawings is given for the purpose of the present invention, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings can be obtained according to these drawings without the need for inventive work for a person skilled in the art.

FIG. 1 is a statistical plot of the number of oviposition of interfering Japanese blood flukes in vitro with dsRNANONSJP 003385;

FIG. 2 is a graph showing the recovery rate and statistical result of insect length of Schistosoma japonicum after injection of dsRNANONSJP003385 at the stage of development of insect bodies after infection establishment;

FIG. 3 shows the development of female and male worms before and after interference under a body view;

FIG. 4 shows development of the Japanese schistosome reproductive system after injection of dsRNANONSJP003385 at the stage of development of the insect body after establishment of infection;

FIG. 5 is HE staining and Masson staining of mouse livers after injection of dsRNANONSJP003385 at the stage of development of the worms after infection establishment.

Detailed Description

The following description of the embodiments of the present invention will be made more apparent and fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the invention are shown. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example one preparation of double-stranded RNA

1. Amplification of target Gene

(1) Amplification of the target Gene NONSJP003385

Primer design is carried out according to the sequence of NONSJP003385 of non-coding RNA in the Japanese blood fluke long non-coding RNA annotation library (note: data which are not yet disclosed), the amplification length is 458bp, a T7 promoter sequence is added to the 5' end of the primer, and the primer sequence (5 ' -3 ') is as follows:

F:TAATACGACTCACTATAGGGAGATAGATTATGGCAGCTACTTG；(SEQ ID NO：3)

R:TAATACGACTCACTATAGGGAGAACCTTGTGGAGCCTAGAA；(SEQ ID NO：4)

the PCR amplification procedure was: 94 ℃ for 5min;94℃for 30s,60℃for 30s,72℃for 1min,35cycles;72 ℃ for 10min;4 ℃ last forever. And (3) performing gel cutting recovery on the target band cDNA, and verifying the sequencing to be correct.

The nucleotide sequence of the NONSJP003385 gene amplified fragment is shown in SEQ ID NO: shown at 5.

(2) Control Gene GFP amplification

Primer design was performed according to the sequence of GFP (green fluorescent protein ) vector plasmid constructed in the laboratory, the amplification length was 451bp, and the T7 promoter sequence was added to the 5' end of the primer, and the primer sequence (5 ' -3 ') was as follows: f, TAATACGACTCACTATAGGGAGAAGTCAGTGGAGAGGGTGAAG; (SEQ ID NO: 6) R: TAATACGACTCACTATAGGGAGAACTAGTTGAACGGATCCATC; (SEQ ID NO: 7)

The PCR amplification procedure was: 94 ℃ for 5min;94℃for 30s,60℃for 30s,72℃for 1min,35cycles;72 ℃ for 10min;4 ℃ last forever. And (3) performing gel cutting recovery on the target band cDNA, and verifying the sequencing to be correct.

The nucleotide sequence of the amplified fragment of the GFP gene is shown as SEQ ID NO: shown at 8.

2. Synthesis and purification of dsRNA

(1) The in vitro transcription system for dsRNA synthesis of the two genes using the in vitro transcription kit High Yield Transcription Kit is as follows:

composition of the components	Additive amount
		10 x T7 reaction buffer	2μL
T7 enzyme mix	2μL
		ATP	2μL
UTP	2μL
		GTP	2μL
CTP	2μL
		cDNA	0.5μg
Nuclease-free water	Supplement to 20 mu L

And (3) respectively preparing two sets of synthesis systems of dsRNA by the two DNA templates, shaking and uniformly mixing the system mixtures, and incubating overnight in a water bath at 37 ℃.

(2) Purification step

The following are provided:

1) The overnight product was transferred from 37 ℃ water bath to 75 ℃ water bath for 5min, and the reaction was terminated;

2) Adding 1 μl TURBO DNase, blowing with gun head, mixing, and water-bathing at 37deg.C for 15min;

3) Adding 115 mu L of nucleic-free water and 15 mu L of NH4Ac, and blowing with a gun head to mix uniformly;

4) Adding 150 μl of isopropanol, shaking, mixing, centrifuging slightly, and precipitating 1 h at-20deg.C;

5) 13000rpm,4℃for 15min;

6) Removing supernatant, adding 700 μL of 75% ethanol, washing precipitate, centrifuging at 12000 rpm and 4deg.C for 5min, sucking ethanol as far as possible with gun head, and standing at room temperature for 15min to volatilize ethanol;

7) Adding 30 mu L of nucleic-free water to dissolve dsRNA, shaking and mixing uniformly, slightly centrifuging, and carrying out water bath denaturation at 65 ℃ for 15min;

8) dsRNA concentration was measured using Nano Drop 2000;

9) RNA electrophoresis was used to verify the products, and the two dsRNAs were designated as dsRNA NONSJP003385 and dsRNA GFP, respectively, and stored at-20 ℃.

10 The nucleotide sequence of the sense strand of the synthesized dsRNA nomjp 003385 is set forth in SEQ ID NO:1, the nucleotide sequence of the antisense strand is shown as SEQ ID NO: 2.

11 The nucleotide sequence of the sense strand of the synthesized dsGFP is set forth in SEQ ID NO:9, the nucleotide sequence of the antisense strand is shown as SEQ ID NO: shown at 10.

Example two interference experiments on double-stranded RNA

1. Double-stranded RNA in vitro interference

The method comprises the steps of taking 6-week-old Kunming mice, carrying out abdominal percutaneous infection on 200 cercarias on each mouse, then placing the mice in a suitable environment for feeding, dissecting the mice on the 30 th day after infection, collecting Japanese blood flukes by a hepatic portal vein perfusion method, then culturing the mice by using a 24-pore plate, dividing the mice into a control group and an experimental group, wherein each group comprises 6 pores, each pore comprises 6 pairs of Japanese blood flukes, changing a culture medium every two days, adding dsGFP of GFP (green fluorescent protein ) fragments in the culture medium of the control group, adding dsRNANONSJP003385 in the culture medium of the experimental group, and the concentration of dsRNANONSJP003385 is 10 mug/mL. After 7 days of culture, 3 holes of Japanese blood fluke bodies are randomly taken from each group to carry out RNA extraction, qPCR experiments are carried out, the knocking down condition of target genes is verified, all residual eggs in the remaining 3 holes are removed, a new culture medium is replaced, dsRNA NONSJP003385 is not added, and the culture is continued for three days, so that the subsequent spawning count is counted (see figure 1), and the egg calculation method is egg count/male and female insect logarithm.

2. Double-stranded RNA in vivo interference at the stage of development of the parasite after infection establishment

The 6-week-old Kunming mice were each infected with 60 cercarias via abdominal percutaneous infection and divided into control and experimental groups of 4 mice each. dsRNANONSJP003385 was injected intravenously at 14dpi, 18dpi, 22dpi, 26dpi, 30dpi, 34dpi via the tail of mice, 10 μg each time, with 200 μl of saline as solvent; control group injected dsRNAGFP of GFP (green fluorescent protein ) fragment, experimental group injected dsRNA nonjp 003385. On day 38 after infection, mice were dissected and Japanese blood flukes were collected from each mouse using portal vein infusion for phenotype observation, and livers were collected for observation of liver ova and liver fibrosis (see FIG. 2).

3. Effect of interference experiments

(1) Evaluation criteria

1) Insect count statistics and insect length measurement

Counting the numbers of all male worms and female worms flushed out by a hepatic portal vein infusion method in each mouse; the obtained insect bodies are subjected to anesthesia treatment, 1mL of AFA fixing liquid is added into the obtained insect bodies to be fixed for 24 hours at normal temperature, then the insect bodies are photographed, and the insect length measurement is carried out by using software Image J.

The counting method of the cohesive logarithm and the number of the unbiased male worms and female worms is as follows:

total number of insects = cohesive logarithm x 2+ number of unaggled male insects + number of unaggled female insects

Embracing rate = embracing logarithm/(embracing logarithm + minimum number of uncombined male and female worms)

2) Alum card red dyeing

And (3) carrying out alum card red staining on the insect bodies fixed by the AFA, and observing the development condition of male and female gonads. The alum card red staining sample can also be used as a sample observed by a laser confocal microscope, the emission wavelength is selected to be 488nm, and the wave band is the card red excitation wavelength.

3) Paraffin embedded section of liver tissue

(1) Fresh liver tissue of the same part of the mouse is fixed for more than 24 hours in 4% paraformaldehyde. Taking out the tissue from the fixing liquid, trimming and cutting, and then placing the tissue in a dehydration box;

(2) sequentially dehydrating in a dehydrator;

(3) embedding the waxed tissue in an embedding machine;

(4) the wax block was sliced with a paraffin microtome to a thickness of about 4 μm. The tissue was flattened on 40 ℃ water and then placed on a slide and placed in a 60 ℃ oven. And taking out the mixture after the water is baked and the wax is baked, preserving the mixture at normal temperature, and carrying out HE dyeing and Masson dyeing.

(2) Double-stranded RNA in vitro interference effect

The enfolded mature male and female worms are cultured in vitro, and the expression of a target gene NONSJP003385 is interfered by dsRNA NONSJP003385 in vitro. The difference of the spawning numbers of the experimental group and the control group was observed 7 days after the interference, and the quantitative change of gene expression was detected by qPCR by collecting the insect body-extracted RNA. The results showed that the expression of the target gene NONSJP003385 was significantly reduced in both the female and male worms of the experimental group (as shown in FIG. 1A, P-value < 0.05) and the number of eggs laid per pair of adults on average was also significantly reduced in the experimental group (as shown in FIG. 1B, P-value < 0.05) as compared with the control group. These results indicate that expression of non-coding RNA nomjp 003385 in schistosoma japonicum is significantly knocked down by dsRNA interference, and that interference of this gene may have an important role in schistosoma japonicum oviposition process.

(3) Double-stranded RNA in vivo interference effect

1) Inhibiting schistosome growth and development

The NONSJP003385 gene of Schistosoma japonicum was disrupted in mice from day 14 after infection, and the worms were collected at 38d after infection. After counting the insect length and the number of male and female insects, compared with a GFP control group, the insect length of male and female insects is obviously shortened (P-value < 0.05) after NONSJP003385 gene interference, the insect load of male insects is also reduced (shown in figures 2A and B), and similar results are also observed under a stereoscopic vision (shown in figures 3A and B). It is shown that the interference of NONSJP003385 gene can cause the influence on the growth and development of male and female schistosome and has certain effect of reducing male schistosome.

In addition, the difference between the male and female reproductive systems before and after the interference was also observed by alum-red staining of the two groups of worms. Observations under fluorescence and confocal laser microscopy showed that: compared with the control group, the testis of the male insects becomes smaller and the ovary of the female insects becomes smaller after NONSJP003385 gene knockout, a large number of immature oocytes exist, yolk glands shrink morphologically, and the arrangement of yolk gland cells is disordered (as shown in figures 4A and B). These results indicate that NONSJP003385 has an important role in the normal development of the male and female reproductive system.

2) Alleviating pathological damage to the liver of a host

Liver samples of mice from control and experimental groups were collected, sectioned, and then HE stained and Masson stained, respectively, to observe deposition of eggs from the liver and granulomatous fibrosis. HE staining results showed that the number of eggs was reduced, the accumulation of eggs was reduced, the number of granulomas was significantly reduced, and the granulomas size was reduced in the nonjp 003385 group compared to the GFP control group. The results of Masson's staining showed that the liver fibrosis in mice was significantly reduced after NONSJP003385 interference, and the inflammatory cell infiltration and fibroplasia range were significantly lower than in the control group (see FIG. 5). These results indicate that the interference of NONSJP003385 gene affects the spawning process of female insects, reduces spawning number, and can effectively alleviate liver pathological damage condition of host.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather to enable any modification, equivalent replacement, improvement or the like to be made within the spirit and principles of the invention.

Claims (8)

1. A double-stranded RNA targeting long non-coding, characterized in that the nucleotide sequence of the sense strand of the double-stranded RNA is set forth in SEQ ID NO: 1.

2. Use of the double-stranded RNA of claim 1 for the preparation of an anti-schistosome medicament.

3. The use according to claim 2, characterized in that: the schistosome is Schistosoma japonicum.

4. A use according to claim 3, characterized in that: the double-stranded RNA is applied to the aspect of in vitro inhibition of schistosoma japonicum oviposition.

5. A use according to claim 3, characterized in that: the double-stranded RNA is applied to the aspect of inhibiting the growth and development of Japanese blood fluke in vivo.

6. A use according to claim 3, characterized in that: the double-stranded RNA is applied to alleviating pathological damage of schistosoma japonicum to the liver of a host in vivo.

7. The use according to claim 2, characterized in that: the medicament is in the form of injection, oral preparation, buccal tablet, spray, suspension, capsule, tablet, pill or granule.

8. The use according to claim 2, characterized in that: the medicament also comprises one or more of a pharmaceutically acceptable carrier, diluent or excipient.

Images