CN110106179A - A kind of dsRNA and its preparation method and application of migratory locusts fatty acid synthetase gene LmFAS3 - Google Patents

A kind of dsRNA and its preparation method and application of migratory locusts fatty acid synthetase gene LmFAS3 Download PDF

Info

Publication number
CN110106179A
CN110106179A CN201910414226.9A CN201910414226A CN110106179A CN 110106179 A CN110106179 A CN 110106179A CN 201910414226 A CN201910414226 A CN 201910414226A CN 110106179 A CN110106179 A CN 110106179A
Authority
CN
China
Prior art keywords
fatty acid
dsrna
migratory locusts
acid synthetase
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910414226.9A
Other languages
Chinese (zh)
Other versions
CN110106179B (en
Inventor
张建珍
杨洋
赵小明
刘卫敏
马恩波
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanxi University
Original Assignee
Shanxi University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanxi University filed Critical Shanxi University
Priority to CN201910414226.9A priority Critical patent/CN110106179B/en
Publication of CN110106179A publication Critical patent/CN110106179A/en
Application granted granted Critical
Publication of CN110106179B publication Critical patent/CN110106179B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/50Biochemical production, i.e. in a transformed host cell

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pest Control & Pesticides (AREA)
  • Agronomy & Crop Science (AREA)
  • Microbiology (AREA)
  • Environmental Sciences (AREA)
  • Biochemistry (AREA)
  • Dentistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to gene engineering technology fields, and in particular to a kind of dsRNA and its preparation method and application of migratory locusts fatty acid synthetase gene LmFAS3.The preparation method of the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3 of the present invention, comprising the following steps: a designs upstream primer sequence and downstream primer sequence, and synthesizes;B, extract RNA, by mentioned RNA reverse transcription at the first chain cDNA, in conjunction with the upstream and downstream primer of design migratory locusts fatty acid synthetase gene LmFAS3, fatty acid synthetase full length gene segment is obtained by PCR amplification, obtained product is purified, Cloning Transformation is sequenced into Escherichia coli, and sequencing result is compared with transcript profile search result, the nucleotide sequence overall length of the gene is verified and obtains, nucleotides sequence is classified as SEQ ID NO:1;C is based on migratory locusts fatty acid synthetase gene order SEQ ID NO:1, designs dsRNA upstream and downstream primer, sequence is respectively SEQ ID NO:3 and SEQ ID NO:4, and upstream and downstream primer carries T7 promoter sequence;D, transcription synthesis dsRNA.

Description

A kind of dsRNA of migratory locusts fatty acid synthetase gene LmFAS3 and preparation method thereof and Using
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of migratory locusts fatty acid synthetase gene LmFAS3's DsRNA and its preparation method and application.
Background technique
Migratory locusts are a kind of biggish agricultural pests of harm, and distribution is extremely wide and transfer ability is very strong, and destructive power is big, because This causes to seriously endanger to agricultural.The method for being usually used in prevention and control migratory locusts at present still relies on chemical prevention, i.e. chemical insecticide.So And chemical pesticide is used for a long time incessantly can make pest and develop drug resistance reduction prevention and treatment efficiency, while can also destroy ecological environment, it is right Other non-target organisms cause damages.Therefore, there is an urgent need to develop novel insect pest control methods.
RNA interference (RNAi) technology for obtaining the Nobel Prize for 2006, is a kind of specificity as caused by double stranded rna molecule turn Gene silent technology after record.The technology is that the research of gene function, human disease treatment and crop pest prevention and treatment etc. is all opened New way is warded off.Progress control of insect is interfered to have a characteristic that 1, desinsection has specificity by RNA, to non-target organism Without lethal effect;2, RNA is easily degraded in nature, noresidue;3, nontoxic to environment, it is comparatively safe.Studies have shown that Specific crop pests can be effectively controlled in RNA perturbation technique, have very important application prospect in field of pest control.And Realize that carrying out the key of pest control based on the technology is to filter out the special dsRNA lethal to pest efficient.
Insect cuticle main chemical compositions are chitin, protein, phenols and lipid material.Insect cuticle is as one Two-way barrier enforcement effect, can both prevent the evaporation of insect internal water, additionally it is possible to which reversed prevents the micro- life of extraneous cause of disease The invasion of object.And epidermis lipid material plays critical function in this course.In addition, epidermis lipid material is also used as Pheromones play a role, and play an important role in the behaviors such as insect growth reproduction and communication.Insect cuticle lipid material Synthesis is related to the participation of a variety of enzymes, such as fatty acid synthetase, is one of the key enzyme in insect cuticle lipid synthesis access, Participate in the whole process that catalysis is synthesized palmitic acid by acetyl coenzyme A and malonyl CoA.The related function being currently known is ground Study carefully the influence in terms of being concentrated mainly on its spatial and temporal expression, diapause and reproduction.In addition, finding silencing rouge in model organism nematode Fat acid synthase gene will affect epidermis formation and its structure.Therefore, fatty acid synthetase has insect existence very heavy The meaning wanted.
Summary of the invention
The present invention, aiming to the above problems, provides the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3 a kind of and its preparations Methods and applications.
The invention adopts the following technical scheme in order to achieve the above objectives:
A kind of dsRNA of migratory locusts fatty acid synthetase gene LmFAS3, the nucleotides sequence of the dsRNA are classified as SEQ ID NO: 2。
A kind of preparation method of the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3, comprising the following steps:
A, the transcript profile database based on drosophila and migratory locusts, using bioinformatics method to migratory locusts fatty acid synthetase base Because scanning for, is analyzed by sequence, after splicing and comparing, obtain migratory locusts fatty acid synthetase gene LmFAS3 sequence, design Upstream primer sequence and downstream primer sequence, and synthesize;
B chooses healthy growth, and five age migratory locusts nymphs of half male and half female in the same size get off its epidermis fast anatomical, and RNA is extracted, by mentioned RNA reverse transcription at the first chain cDNA, with this as template, in conjunction with design migratory locusts fatty acid synthetase gene The upstream and downstream primer of LmFAS3 obtains fatty acid synthetase full length gene segment by PCR amplification, obtained product is carried out pure Change, Cloning Transformation is sequenced into Escherichia coli, and sequencing result is compared with transcript profile search result, is verified and is obtained the gene Nucleotide sequence overall length, nucleotides sequence is classified as SEQ ID NO:1;
C is based on migratory locusts fatty acid synthetase gene order SEQ ID NO:1, designs dsRNA upstream and downstream primer, sequence Respectively SEQ ID NO:3 and SEQ ID NO:4, upstream and downstream primer carry T7 promoter sequence;
D, using above-mentioned fatty acid synthetase gene clone carrier Escherichia coli as template, SEQ ID NO:3 and SEQ ID NO:4 is upstream and downstream primer, carries out PCR amplification, and by the PCR product of amplification, transcription synthesizes dsRNA after purification.
A kind of application of the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3 is used for pest control.
Compared with prior art the invention has the following advantages that
1, the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3 provided by the invention can significantly inhibit migratory locusts fat The expression of acid synthase gene LmFAS3, so as to cause death is dehydrated after the difficult death of migratory locusts husking or husking;
2, the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3 provided by the invention has special for migratory locusts control of insect One property and high efficiency, developing drug resistance there is no pest causes to prevent and treat the case where efficiency reduces, and will not destroy ecological environment, no It can cause damages to other non-target organisms.
Detailed description of the invention
Fig. 1 is that five ages the 1st day migratory locusts nymph injects nucleotides sequence respectively and be classified as SEQ ID in test of the embodiment of the present invention The result comparative diagram that the transcription of migratory locusts fatty acid elongase gene is influenced after the dsLmFAS3 and dsGFP of NO:2,168h;
Fig. 2 be in test of the embodiment of the present invention migratory locusts nymph inject nucleotides sequence be classified as it is right after the dsRNA of SEQ ID NO:2 The result comparative diagram of migratory locusts development impact;
Fig. 3 be in test of the embodiment of the present invention migratory locusts nymph inject nucleotides sequence be classified as it is right after the dsRNA of SEQ ID NO:2 The result comparative diagram that migratory locusts epidermal permeability influences.
Specific embodiment
For the technical solution that the present invention is further explained, the present invention is carried out with reference to the accompanying drawings and embodiments further Explanation.
A kind of dsRNA of migratory locusts fatty acid synthetase gene LmFAS3, the nucleotides sequence of the dsRNA are classified as SEQ ID NO: 2。
A kind of preparation method of the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3, comprising the following steps:
A, the transcript profile database based on drosophila and migratory locusts, using bioinformatics method to migratory locusts fatty acid synthetase base Because scanning for, is analyzed by sequence, after splicing and comparing, obtain migratory locusts fatty acid synthetase gene LmFAS3 sequence, use Primer premier5.0 software design upstream primer sequence and downstream primer sequence, and it is sent to raw work bioengineering (Shanghai) Co., Ltd's synthesis;
B chooses healthy growth, five age migratory locusts nymphs of half male and half female in the same size, by its epidermis under Stereo microscope Fast anatomical gets off, and is frozen in liquid nitrogen, and 3 first biology repeat, and four biology are arranged and repeat, according to TaKaRa public affairs It takes charge of Trizol kit and extracts RNA, using M-MLV reverse transcriptase by mentioned RNA reverse transcription at the first chain cDNA, with this as mould Plate obtains fatty acid synthetase by PCR amplification in conjunction with the upstream and downstream primer of design migratory locusts fatty acid synthetase gene LmFAS3 Full length gene segment purifies obtained product, and Cloning Transformation is into Escherichia coli, and it is limited to be sent to Hua Da biotechnology Company's sequencing, sequencing result are compared with transcript profile search result, verify and obtain the nucleotide sequence overall length of the gene, nucleosides Acid sequence is SEQ ID NO:1;
C is based on migratory locusts fatty acid synthetase gene order SEQ ID NO:1, is set using primerpremier5.0 software DsRNA upstream and downstream primer is counted, sequence is respectively SEQ ID NO:3 and SEQ ID NO:4, and upstream and downstream primer carries T7 starting Subsequence, all primers are synthesized by Shanghai bioengineering Co., Ltd;
D, using above-mentioned fatty acid synthetase gene clone carrier Escherichia coli as template, SEQ ID NO:3 and SEQ ID NO:4 is upstream and downstream primer, PCR amplification is carried out, by the PCR product of amplification, through Gel Extraction Kit (Sigma) reagent Box is after purification according to T7RiboMAXTMExpress RNAi System (Promega) kit illustrates that synthesis is transcribed in vitro DsRNA is control with green fluorescence protein gene GFP, synthesizes dsGFP, use 2000 (Thermo of NaNoDrop Scientific it) is quantified, so that its final concentration is reached 2.5 μ g/ μ l, it is spare to be stored in -80 DEG C of super low temperature refrigerators.
A kind of application of the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3 is used for pest control.
The lethal migratory locusts test of migratory locusts fatty acid synthetase gene dsRNA:
1, migratory locusts fatty acid synthetase gene dsRNA is injected
Choose healthy growth, in the same size, the 1st day five ages nymph of half male and half female 30 is tested.By synthesis DsLmFAS3 gently injects two, three abdomens that 4 μ l enter nymph flank portion along blood flow method using 25 μ l specification micro syringes Between section.30 nymphs are chosen simultaneously is established as control group.In the dsGFP to control group body for injecting same volume and concentration.Point Migratory locusts after injection raising (illumination: interlunation=14h:10h, temperature 30 ± 2 in 30 DEG C of constant temperature biochemical cultivation cases is not placed in DEG C, humidity 60%), fresh wheat seedling and wheat bran are fed daily.
2, migratory locusts fatty acid synthetase gene silencing detects
It is each to collect 9 injection dsGFP and dsLmFAS3,168h teleonymph polypides progress Total RNAs extractions, and reverse transcription is at the One chain cDNA, 3 biology of every group of setting repeat, and each biology repeats 3 nymphs.Using Real-time PCR method point The relative expression quantity of other testing goal gene LmFAS3 and house-keeping gene Rpl-32, calculate its silence efficiency.Such as Fig. 1 institute Show, the results showed that, compared with the control group, after injecting dsLmFAS3, processing group fatty acid elongase gene expression is significantly reduced, Silence efficiency reaches 94.2%.
3, the Phenotypic Observation after dsRNA is injected
As shown in Fig. 2, control group is all successfully casted off a skin to adult after eight days, and is casted off a skin after five age nymphs injection dsRNA Growth and development state is good afterwards.And after experimental group injection dsLmFAS3, there are 15 can not successfully cast off a skin up to dead, while having 9 Head nymph can successfully cast off a skin to adult, but can be dead because of dehydration after casting off a skin to adult, and two kinds of phenotype death rates reach 80%.
4, the eosin stains test after injecting dsRNA
After five age nymphs inject dsRNA, the experimental group just casted off a skin in adult 1h and identical quantity same period are chosen Control group, be placed in 0.5% Yihong solution, heat 30min in 45 DEG C of water-baths, be then cleaned multiple times, observe new table The coloring case of skin.As shown in figure 3, the coloring of experimental group migratory locusts body wall becomes apparent the results show that compared with the control, show it Permeability enhancing.
Main feature and advantage of the invention has been shown and described above, it is obvious to a person skilled in the art that this Invention is not limited to the details of above-mentioned exemplary embodiment, and without departing from the spirit or essential characteristics of the present invention, The present invention can be realized in other specific forms.Therefore, in all respects, the embodiments should be taken as demonstrations , and be non-limiting, the scope of the invention being indicated by the appended claims rather than by the foregoing description, it is intended that will fall All changes within the meaning and scope of the equivalents of the claims are included within the present invention.It should not will be in claim Any appended drawing reference is construed as limiting the claims involved.
In addition, it should be understood that although this specification is described in terms of embodiments, but not each embodiment is only wrapped Containing an independent technical solution, this description of the specification is merely for the sake of clarity, and those skilled in the art should It considers the specification as a whole, the technical solutions in the various embodiments may also be suitably combined, forms those skilled in the art The other embodiments being understood that.
Sequence table
SEQ ID NO:1
gccgactctgcgtggtgccacaagacactcagctcgtggaaagtgctccaggccgctgactgctgcag aggacgactctacaacctgtcgacaccgtgttccaagacttgccacaatgaccaaaacttcaggcagctcagcggc cctaccagacgtctatgcagaatttattcctgctggaaagaaactggcatcaccaccacctggtgaggagttggtc attagtggtatatcaggacgatttccaaagagtgttggaatgtatgagcttcaggacaatcttctgaacttacatg atctcataagtgatgttgacagtggctttcaaggttcatctaacataccacatcggttgggtaaaattccatgtgc acagaagtttgatgcttcattttttggagtggatgcaaacacagcttaccatgcagatccattaatgcgtttgcag atggaaactacctacgaggccattgtagatgcaggattccatccacattccttacgaaataaacgtgtagcagtta ttacaagtggcatatttagtgagtcagaggtggcagtttttaactatgagaacataggtaaaggactgatgtactg caatcgtgcattacaagccggagtgattgcctactggcttggagtgactgggcctgtgtatgtagctgatacagct tgctcttcaagcatgtttgccctggatgctgcgtatcagtttatacgcactggcaagtgtgatgctgccattgtgg caggagctaatttgtgcctccacgagttcagcacagcacaatttgcaaatctcggtgttcttagtgtagatggtat ttgtcgaagttttgatgatgcaggtaatggttatgtacgttctgaagtcactggaacaatctttgtccaaaaagca aaagatgctcgtagaatgtatgccaagctaattcacatgcaaaccaactgtgatggatacaaaaaagaaggtatca cttatccttcaggtcttatgcaggaattactgttacgccgattctatgaagagtctggagttgatttacaaagtgt aaaatatattgaagctcatggaactggaacaaaggtaggtgatccggaagaactacgagcactagacagagtattt tgttctggacgaaaagatgactgcccaatacttataggatctgtgaagtcaaatttaggtcattcagaaccagttt ctggaattgcatctcttgccaaggttatccttagtatggaatcaggattaataccagcaaatgccaattacaaaaa accacgcagtggagcaaaatcactggaagaagggagattaaaggttgtagcagaacacacaccatttcctggaggt cctgttccagtaaattcttttggttttgggggctgcaactctcatacagttattgctccaaatcccaaggaaaaaa taaataattgtattcgcaaagatggattgccaagattagttgcagtatcagggagaacatctgaggcagtgaattc aattcttagtcatgttgaagatatgagaaaagtggatgcagagtttgtgagcctactgcatgacgtgtatgccaca aacatacctggccatttgtaccgtggctatacagttgtaccagcagttttaggaagctgttgtaggacagtagagt tgagtcctatggagaagaaatgttcagtacatatgatcttgacattgggagaaaacaagtgcaattcagctacagt tggctctttaatgcagtttgatatatttgctgccacaatgaatgaatgctttcaggcattaatacttgaaggtgtt gacttgttatatgctgcattttcaactgatggagatgagtgggctctccggaacagcgtcactactgctgtacaga tttccctgctcagtcttctgacagcaattggtgtgaagatagatgttttcattggttcatgcccagcaaggacgta tgctgaaggaggctacacaattgaagaagctgttcgtgctgcctatgaactggatgttgaagagcgccatgactgc ttgaaaggagcttcatatttttcaactatggacatgcagactggttactggcaaatccaggttgacgaagctgaca aagagaagacggcttttattacttctgacggcctctatgaatttaaagtaatgccatctggattatgtaatgctcc agccacattcgaacgcatgatggacaatttgcttcgacaccttaagtggacgacgtgtctctgctatttagatgac attgtcgttttgtcgaaaacatttgaagaacatctgagtcgcctgtcaactgtgttgaagtgtgttcagactgcag aactgattactcatcttcagttcagtcttgcagcagtaggaatgcatacaccacacaactacattaaaagaaacta tgaaggtttcagaactcaagtgaaagaaataattgtcctcgaaatatcaccagtcagcaagcttcctaattctctt aatatcctgagtaacagccgaaccttattgcagattcttggcagattgtacctctcacacgtggacttacatctca ctgaactgtaccccaaagttcagtatcctgtaagtcgaggaacaaccatgctttcaccattcatcagatgggaaca ttcagaagactggtttttgacaacaggaaatagtagtgaggtaatggcaggagatcaagcttttactgtggatgtg aagatgttgcaaaagaaaaatcaatttttatttggacattccattgatgggagattcttgtatccagccacaggat acataataatggttcttcagggattctgtatgcgtaaaaatttggatatgtcaaagcacaaagttctttttgaaaa tgtacgatttttgagagccactaacgtacccaaaactgcgtcagttgtttttgaagtgataagtagtgctggatct catgaatttgaaattatggagggaggcagtttgattgttacgggcaagtttcagttgtgtgatgctcctatgttaa gtgatggcttggagcttccaaaaccagctcctggtgttcccatggataaaaaagacatatacaaggagatgaaact gaggggctacaattataatggaattttccggagtttggttagtttggatccttcagcttcagtgggtcatatcgca tggcaggagaactggattgcctacatggacaatatgttgcaaataggcatcttccaacaggacactcgcaatctgt atgtcccagttcgaataaagagaatcgtggctgacttcagcaaacacacagaatgtattgccaagagtgatgaaac aggagctatacctatttacagctggaaagaaataaggctagtaagatcaggtggcatagaaatttatggcctgtat gcaagtccaatcccaaaacgccgtgtaatggcagaacctgtacttgagaactatggatttgttccttaccaagggc aaatcaatctgtctctcaaagaacttctgcgggtcagcgtccatgtggctttggagaacaatcctatggtaaagaa ggtgaaaactgttgaagtgcctggagataattgcactgaatttttgtctactgaaattgcaagtatttttgcagat cttcctgtcatacaggcaaacctgacagttcttggggaaactccttcatcaaacccaccagaaggtatacagtttg agaaacatgacctgaataaagaacaaggctgtttgctggtactgggcactggcttggtatttggaaagaactctca atatctgaaaaacgctgttgctgcactttctgacaatggcttcattatttccaaagaaacattaaatggtgatatt agagaccttgaacagtctctaattgttgtaatgaactatgcaatatctgatggaaacgatcatctaatcgtaatga aaaagggcaatccaaaaccagatatacaatttgtcaatgtgagtggaaatgactgtacttggctgccacggttaaa atccttggtccagaaaggccaaaacgaagttgtgctggtggcacaaggaaataataacagtggaatactaggtctg accaattgcatacgcatggaaccaggaggaacatgcatcaggtgcttatttatcaaagatcataaagctccagcat ttgatccaaaccttgaattttatcgaagtcagcttgctttggacctagcaatgaatgtgtatgagaaaggctgttg gggaagttaccgacatcttcccctgaaaccccccaaaactgtgaagacagctcatgcattcaatgtagttaagaat attggagatttatcctcttctgtatggcaacaaggatatttagatccaacaagggatattaatgatgatggttttg cttttgtttattattctgctctcaacttccgtgatattatgacagcaactggtagactatcatatgatgtcgtgaa cccagacagatgtacacaggattgtattcaaggtattgagttttctgggagagacaaaaatggcagacgtgttatg ggtttggcatcaagagggtctatgtcaacaatgattgtaacaaacccaatcactgtatttccggtaccagacaatt ggacactggaagaagctgctacagtacccgcagtttattgtacagttatgttggccttaattagaggcggaggact acgtaaaggtcaatctgtattgatccatgctggcactggtggcattggacaagctgccatcaattactgttcgttc catggctgcgatattttcactactgttggaacaccacaaaagaaggaatttattctaaagaatttcccacaggtgc ctgaatctcatattggtaactctcgagacacatcttttgaggaaatggtcatgagggaaactaagggccgtggagt tgacgtggttttgaactctcttgcagaagaaaaacttcaggcatcagttcgatgcttggcaagaggaggacgattt tttgagataggaaaatttgatttggcaaatgataataaactagctatggatgtccaatcccgggatatcactatca cctctgtaatgttcgatgcatttttcgacaatgataagatgcaggatgatcttaaggttattagtgaagtgttaag gaatggtctcaaggaaggttccataaaaccgctcgtaaggactacttttaaggtggatgaagttgagcaagcttat aggtatatggcagctgcaaagcacattggtaaggtgttggtggttgtacgagaggaagaaccgcaaaaagttattc gtccatcaattcctgaaatggaggctgaatcacgattttattgcaaatctgaactcacatacatcattattggagg tcttggtggttttggattggagttagctgattggctaatcctgaggaaagccaaaaaactcattcttacatcgagg aaaggtatcagcaatggataccaacagtcaagaatcagattatggatgaattatggtgtgaaagtaattgtgtcca cagcagatgttaccacacaagaaggatgttacaatctcttggtggaagcaaacaaattaggctcagttggaggcat tttcaacctggcagtggatctccaagatgctgtactggagaaccaaaccgttgaaagtttccacaaatcagctgga ccaaaagcagtagctactggtctactggatgtaatctctcaaaagctgtgtccacagctgcattcatttgttgttt tctcaagtgtgtcctgtggtaggggcaatgcaggacagtcaaattacggatggagcaactcagtgatggagcgcat ttgtgaggaacgacactctaaaggattacctgctgttgccatccagtggggggctgttggtgatgtgggccttgta gctaaaatgcaagatgatgacaaagaatttgttataggtggtacattgccccaaagaattacatcctgcttatcct tattggacacattcctccttcaaccatgccctattgtggccagtatggttgtagctgagaaacgtggagtactgtc tgagtcagcaaatgtcctcgagtatgttgctaatgtgttgggaatcaaggatttgaaaagtgtaaaccataatgca ccactggcagagctgggaatggattccatgatggctgtagaaatcaagcaagctgtggaaattacatttgaagtat ttttgactgcagaagaagttcgaaatttaaccctttcagcacttgtggaaatggcgaaaaaaccagcaagtgaagc agaagtggaagttccagaagaggttgggaagggtataagacagggttgtagcctttctccaatgttattcaatttg tgcaatgaccaagctataaaggaaagcaaggaaaaatttggagaaggaattaaagttcagggtgaagaaataaaaa ccttgcattttgctgatgacattgtaattctctcagagacagcaaaagacctggaggagcaattgcagggaatgga cagtgtgctggaaggagcatataagatgaacatcaacaagagcaaaacaatggtaatggaatgcagtcttagaaag tcagccgatgccgaaggaattaaattagtgccaacctttgcgatagttgggttttcatttggtggtctagtagcgc tagaactaacagcgttactagaagcacagggccacaagggttctttggttctgattgatagcagtccagactactt aaaatcatctgctcaggcatttggagaagattattctctaacatggttatcagaatttttgcccaaaatgggttgt ggaccaactgcagctcttaaattacatgctgagggtgctggtttggaatggccagagaagttggaggttgccatga aactatttccagatgttgaaattcagaacagtcatgaagcacgatcatttctttcaacgatttataatcgtttaac agaagttcattctggaagtggcacctacaaaactattcagtctccagtaagactaattaagtctacagagagtgcc atacctggtattggcgaagcatatggtttggaaaagatatgcaaaaatattgaaggaatccacactgttactggaa cacactattctattgtagaagagcctgaaacagcaaatataattaataatatgctcaagaactaaaatacgcatga ataccagtatgatcatcaacatacttaagatgtgcacaatcaggttaaagattcttgtaaatctgtgacatcatta taatttatgttgtgtatattgtaaattgatggaattattctcttgttttgagaagagtatcatcaattattaagcc agaagtgtctaagtaatcacgtttgttatacgtgatctagtgatcacctgaagtgacaactgaaggactgttttag gttactcagcatcattatgtcacaattgtttcaacaattcaccatgatcatgcatttgtatgtaaaatgatgtgtc gtagtaagaaataaatcaatattaaattaaaatttttaaaaaat
SEQ ID NO:2
tcagcttgctttggacctagcaatgaatgtgtatgagaaaggctgttggggaagttaccgacatcttc ccctgaaaccccccaaaactgtgaagacagctcatgcattcaatgtagttaagaatattggagatttatcctcttc tgtatggcaacaaggatatttagatccaacaagggatattaatgatgatggttttgcttttgtttattattctgct ctcaacttccgtgatattatgacagcaactggtagactatcatatgatgtcgtgaacccagacagatgtacacagg attgtattcaaggtattgagttttctgggagagacaaaaatggcagacgtgttatgggtttggcatcaagagggtc tatgtcaacaatgattgtaacaaacccaatcactgtatttccggtaccagacaattggacactggaagaagctgct acagtacccgcagtttattgtacagt
SEQ ID NO:3
taatacgactcactatagggtcagcttgctttggacctag
SEQ ID NO:4
taatacgactcactatagggactgtacaataaactgcgggt。
Sequence table
<110>University Of Shanxi
<120>a kind of dsRNA and its preparation method and application of migratory locusts fatty acid synthetase gene LmFAS3
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 7560
<212> DNA
<213>migratory locusts (Locusta migratoria)
<400> 1
gccgactctg cgtggtgcca caagacactc agctcgtgga aagtgctcca ggccgctgac 60
tgctgcagag gacgactcta caacctgtcg acaccgtgtt ccaagacttg ccacaatgac 120
caaaacttca ggcagctcag cggccctacc agacgtctat gcagaattta ttcctgctgg 180
aaagaaactg gcatcaccac cacctggtga ggagttggtc attagtggta tatcaggacg 240
atttccaaag agtgttggaa tgtatgagct tcaggacaat cttctgaact tacatgatct 300
cataagtgat gttgacagtg gctttcaagg ttcatctaac ataccacatc ggttgggtaa 360
aattccatgt gcacagaagt ttgatgcttc attttttgga gtggatgcaa acacagctta 420
ccatgcagat ccattaatgc gtttgcagat ggaaactacc tacgaggcca ttgtagatgc 480
aggattccat ccacattcct tacgaaataa acgtgtagca gttattacaa gtggcatatt 540
tagtgagtca gaggtggcag tttttaacta tgagaacata ggtaaaggac tgatgtactg 600
caatcgtgca ttacaagccg gagtgattgc ctactggctt ggagtgactg ggcctgtgta 660
tgtagctgat acagcttgct cttcaagcat gtttgccctg gatgctgcgt atcagtttat 720
acgcactggc aagtgtgatg ctgccattgt ggcaggagct aatttgtgcc tccacgagtt 780
cagcacagca caatttgcaa atctcggtgt tcttagtgta gatggtattt gtcgaagttt 840
tgatgatgca ggtaatggtt atgtacgttc tgaagtcact ggaacaatct ttgtccaaaa 900
agcaaaagat gctcgtagaa tgtatgccaa gctaattcac atgcaaacca actgtgatgg 960
atacaaaaaa gaaggtatca cttatccttc aggtcttatg caggaattac tgttacgccg 1020
attctatgaa gagtctggag ttgatttaca aagtgtaaaa tatattgaag ctcatggaac 1080
tggaacaaag gtaggtgatc cggaagaact acgagcacta gacagagtat tttgttctgg 1140
acgaaaagat gactgcccaa tacttatagg atctgtgaag tcaaatttag gtcattcaga 1200
accagtttct ggaattgcat ctcttgccaa ggttatcctt agtatggaat caggattaat 1260
accagcaaat gccaattaca aaaaaccacg cagtggagca aaatcactgg aagaagggag 1320
attaaaggtt gtagcagaac acacaccatt tcctggaggt cctgttccag taaattcttt 1380
tggttttggg ggctgcaact ctcatacagt tattgctcca aatcccaagg aaaaaataaa 1440
taattgtatt cgcaaagatg gattgccaag attagttgca gtatcaggga gaacatctga 1500
ggcagtgaat tcaattctta gtcatgttga agatatgaga aaagtggatg cagagtttgt 1560
gagcctactg catgacgtgt atgccacaaa catacctggc catttgtacc gtggctatac 1620
agttgtacca gcagttttag gaagctgttg taggacagta gagttgagtc ctatggagaa 1680
gaaatgttca gtacatatga tcttgacatt gggagaaaac aagtgcaatt cagctacagt 1740
tggctcttta atgcagtttg atatatttgc tgccacaatg aatgaatgct ttcaggcatt 1800
aatacttgaa ggtgttgact tgttatatgc tgcattttca actgatggag atgagtgggc 1860
tctccggaac agcgtcacta ctgctgtaca gatttccctg ctcagtcttc tgacagcaat 1920
tggtgtgaag atagatgttt tcattggttc atgcccagca aggacgtatg ctgaaggagg 1980
ctacacaatt gaagaagctg ttcgtgctgc ctatgaactg gatgttgaag agcgccatga 2040
ctgcttgaaa ggagcttcat atttttcaac tatggacatg cagactggtt actggcaaat 2100
ccaggttgac gaagctgaca aagagaagac ggcttttatt acttctgacg gcctctatga 2160
atttaaagta atgccatctg gattatgtaa tgctccagcc acattcgaac gcatgatgga 2220
caatttgctt cgacacctta agtggacgac gtgtctctgc tatttagatg acattgtcgt 2280
tttgtcgaaa acatttgaag aacatctgag tcgcctgtca actgtgttga agtgtgttca 2340
gactgcagaa ctgattactc atcttcagtt cagtcttgca gcagtaggaa tgcatacacc 2400
acacaactac attaaaagaa actatgaagg tttcagaact caagtgaaag aaataattgt 2460
cctcgaaata tcaccagtca gcaagcttcc taattctctt aatatcctga gtaacagccg 2520
aaccttattg cagattcttg gcagattgta cctctcacac gtggacttac atctcactga 2580
actgtacccc aaagttcagt atcctgtaag tcgaggaaca accatgcttt caccattcat 2640
cagatgggaa cattcagaag actggttttt gacaacagga aatagtagtg aggtaatggc 2700
aggagatcaa gcttttactg tggatgtgaa gatgttgcaa aagaaaaatc aatttttatt 2760
tggacattcc attgatggga gattcttgta tccagccaca ggatacataa taatggttct 2820
tcagggattc tgtatgcgta aaaatttgga tatgtcaaag cacaaagttc tttttgaaaa 2880
tgtacgattt ttgagagcca ctaacgtacc caaaactgcg tcagttgttt ttgaagtgat 2940
aagtagtgct ggatctcatg aatttgaaat tatggaggga ggcagtttga ttgttacggg 3000
caagtttcag ttgtgtgatg ctcctatgtt aagtgatggc ttggagcttc caaaaccagc 3060
tcctggtgtt cccatggata aaaaagacat atacaaggag atgaaactga ggggctacaa 3120
ttataatgga attttccgga gtttggttag tttggatcct tcagcttcag tgggtcatat 3180
cgcatggcag gagaactgga ttgcctacat ggacaatatg ttgcaaatag gcatcttcca 3240
acaggacact cgcaatctgt atgtcccagt tcgaataaag agaatcgtgg ctgacttcag 3300
caaacacaca gaatgtattg ccaagagtga tgaaacagga gctataccta tttacagctg 3360
gaaagaaata aggctagtaa gatcaggtgg catagaaatt tatggcctgt atgcaagtcc 3420
aatcccaaaa cgccgtgtaa tggcagaacc tgtacttgag aactatggat ttgttcctta 3480
ccaagggcaa atcaatctgt ctctcaaaga acttctgcgg gtcagcgtcc atgtggcttt 3540
ggagaacaat cctatggtaa agaaggtgaa aactgttgaa gtgcctggag ataattgcac 3600
tgaatttttg tctactgaaa ttgcaagtat ttttgcagat cttcctgtca tacaggcaaa 3660
cctgacagtt cttggggaaa ctccttcatc aaacccacca gaaggtatac agtttgagaa 3720
acatgacctg aataaagaac aaggctgttt gctggtactg ggcactggct tggtatttgg 3780
aaagaactct caatatctga aaaacgctgt tgctgcactt tctgacaatg gcttcattat 3840
ttccaaagaa acattaaatg gtgatattag agaccttgaa cagtctctaa ttgttgtaat 3900
gaactatgca atatctgatg gaaacgatca tctaatcgta atgaaaaagg gcaatccaaa 3960
accagatata caatttgtca atgtgagtgg aaatgactgt acttggctgc cacggttaaa 4020
atccttggtc cagaaaggcc aaaacgaagt tgtgctggtg gcacaaggaa ataataacag 4080
tggaatacta ggtctgacca attgcatacg catggaacca ggaggaacat gcatcaggtg 4140
cttatttatc aaagatcata aagctccagc atttgatcca aaccttgaat tttatcgaag 4200
tcagcttgct ttggacctag caatgaatgt gtatgagaaa ggctgttggg gaagttaccg 4260
acatcttccc ctgaaacccc ccaaaactgt gaagacagct catgcattca atgtagttaa 4320
gaatattgga gatttatcct cttctgtatg gcaacaagga tatttagatc caacaaggga 4380
tattaatgat gatggttttg cttttgttta ttattctgct ctcaacttcc gtgatattat 4440
gacagcaact ggtagactat catatgatgt cgtgaaccca gacagatgta cacaggattg 4500
tattcaaggt attgagtttt ctgggagaga caaaaatggc agacgtgtta tgggtttggc 4560
atcaagaggg tctatgtcaa caatgattgt aacaaaccca atcactgtat ttccggtacc 4620
agacaattgg acactggaag aagctgctac agtacccgca gtttattgta cagttatgtt 4680
ggccttaatt agaggcggag gactacgtaa aggtcaatct gtattgatcc atgctggcac 4740
tggtggcatt ggacaagctg ccatcaatta ctgttcgttc catggctgcg atattttcac 4800
tactgttgga acaccacaaa agaaggaatt tattctaaag aatttcccac aggtgcctga 4860
atctcatatt ggtaactctc gagacacatc ttttgaggaa atggtcatga gggaaactaa 4920
gggccgtgga gttgacgtgg ttttgaactc tcttgcagaa gaaaaacttc aggcatcagt 4980
tcgatgcttg gcaagaggag gacgattttt tgagatagga aaatttgatt tggcaaatga 5040
taataaacta gctatggatg tccaatcccg ggatatcact atcacctctg taatgttcga 5100
tgcatttttc gacaatgata agatgcagga tgatcttaag gttattagtg aagtgttaag 5160
gaatggtctc aaggaaggtt ccataaaacc gctcgtaagg actactttta aggtggatga 5220
agttgagcaa gcttataggt atatggcagc tgcaaagcac attggtaagg tgttggtggt 5280
tgtacgagag gaagaaccgc aaaaagttat tcgtccatca attcctgaaa tggaggctga 5340
atcacgattt tattgcaaat ctgaactcac atacatcatt attggaggtc ttggtggttt 5400
tggattggag ttagctgatt ggctaatcct gaggaaagcc aaaaaactca ttcttacatc 5460
gaggaaaggt atcagcaatg gataccaaca gtcaagaatc agattatgga tgaattatgg 5520
tgtgaaagta attgtgtcca cagcagatgt taccacacaa gaaggatgtt acaatctctt 5580
ggtggaagca aacaaattag gctcagttgg aggcattttc aacctggcag tggatctcca 5640
agatgctgta ctggagaacc aaaccgttga aagtttccac aaatcagctg gaccaaaagc 5700
agtagctact ggtctactgg atgtaatctc tcaaaagctg tgtccacagc tgcattcatt 5760
tgttgttttc tcaagtgtgt cctgtggtag gggcaatgca ggacagtcaa attacggatg 5820
gagcaactca gtgatggagc gcatttgtga ggaacgacac tctaaaggat tacctgctgt 5880
tgccatccag tggggggctg ttggtgatgt gggccttgta gctaaaatgc aagatgatga 5940
caaagaattt gttataggtg gtacattgcc ccaaagaatt acatcctgct tatccttatt 6000
ggacacattc ctccttcaac catgccctat tgtggccagt atggttgtag ctgagaaacg 6060
tggagtactg tctgagtcag caaatgtcct cgagtatgtt gctaatgtgt tgggaatcaa 6120
ggatttgaaa agtgtaaacc ataatgcacc actggcagag ctgggaatgg attccatgat 6180
ggctgtagaa atcaagcaag ctgtggaaat tacatttgaa gtatttttga ctgcagaaga 6240
agttcgaaat ttaacccttt cagcacttgt ggaaatggcg aaaaaaccag caagtgaagc 6300
agaagtggaa gttccagaag aggttgggaa gggtataaga cagggttgta gcctttctcc 6360
aatgttattc aatttgtgca atgaccaagc tataaaggaa agcaaggaaa aatttggaga 6420
aggaattaaa gttcagggtg aagaaataaa aaccttgcat tttgctgatg acattgtaat 6480
tctctcagag acagcaaaag acctggagga gcaattgcag ggaatggaca gtgtgctgga 6540
aggagcatat aagatgaaca tcaacaagag caaaacaatg gtaatggaat gcagtcttag 6600
aaagtcagcc gatgccgaag gaattaaatt agtgccaacc tttgcgatag ttgggttttc 6660
atttggtggt ctagtagcgc tagaactaac agcgttacta gaagcacagg gccacaaggg 6720
ttctttggtt ctgattgata gcagtccaga ctacttaaaa tcatctgctc aggcatttgg 6780
agaagattat tctctaacat ggttatcaga atttttgccc aaaatgggtt gtggaccaac 6840
tgcagctctt aaattacatg ctgagggtgc tggtttggaa tggccagaga agttggaggt 6900
tgccatgaaa ctatttccag atgttgaaat tcagaacagt catgaagcac gatcatttct 6960
ttcaacgatt tataatcgtt taacagaagt tcattctgga agtggcacct acaaaactat 7020
tcagtctcca gtaagactaa ttaagtctac agagagtgcc atacctggta ttggcgaagc 7080
atatggtttg gaaaagatat gcaaaaatat tgaaggaatc cacactgtta ctggaacaca 7140
ctattctatt gtagaagagc ctgaaacagc aaatataatt aataatatgc tcaagaacta 7200
aaatacgcat gaataccagt atgatcatca acatacttaa gatgtgcaca atcaggttaa 7260
agattcttgt aaatctgtga catcattata atttatgttg tgtatattgt aaattgatgg 7320
aattattctc ttgttttgag aagagtatca tcaattatta agccagaagt gtctaagtaa 7380
tcacgtttgt tatacgtgat ctagtgatca cctgaagtga caactgaagg actgttttag 7440
gttactcagc atcattatgt cacaattgtt tcaacaattc accatgatca tgcatttgta 7500
tgtaaaatga tgtgtcgtag taagaaataa atcaatatta aattaaaatt tttaaaaaat 7560
<210> 2
<211> 474
<212> DNA
<213>migratory locusts (Locusta migratoria)
<400> 2
tcagcttgct ttggacctag caatgaatgt gtatgagaaa ggctgttggg gaagttaccg 60
acatcttccc ctgaaacccc ccaaaactgt gaagacagct catgcattca atgtagttaa 120
gaatattgga gatttatcct cttctgtatg gcaacaagga tatttagatc caacaaggga 180
tattaatgat gatggttttg cttttgttta ttattctgct ctcaacttcc gtgatattat 240
gacagcaact ggtagactat catatgatgt cgtgaaccca gacagatgta cacaggattg 300
tattcaaggt attgagtttt ctgggagaga caaaaatggc agacgtgtta tgggtttggc 360
atcaagaggg tctatgtcaa caatgattgt aacaaaccca atcactgtat ttccggtacc 420
agacaattgg acactggaag aagctgctac agtacccgca gtttattgta cagt 474
<210> 3
<211> 40
<212> DNA
<213>migratory locusts (Locusta migratoria)
<400> 3
taatacgact cactataggg tcagcttgct ttggacctag 40
<210> 4
<211> 41
<212> DNA
<213>migratory locusts (Locusta migratoria)
<400> 4
taatacgact cactataggg actgtacaat aaactgcggg t 41

Claims (4)

1. a kind of dsRNA of migratory locusts fatty acid synthetase gene LmFAS3, it is characterised in that: the nucleotides sequence of the dsRNA is classified as SEQ ID NO:2.
2. a kind of preparation method of the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3, it is characterised in that: including following step It is rapid:
A, the transcript profile database based on drosophila and migratory locusts, using bioinformatics method to migratory locusts fatty acid synthetase gene into Row search, is analyzed by sequence, after splicing and comparing, is obtained migratory locusts fatty acid synthetase gene LmFAS3 sequence, is designed upstream Primer sequence and downstream primer sequence, and synthesize;
B, chooses healthy growth, and five age migratory locusts nymphs of half male and half female in the same size get off its epidermis fast anatomical, and extract RNA, by mentioned RNA reverse transcription at the first chain cDNA, with this as template, in conjunction with design migratory locusts fatty acid synthetase gene The upstream and downstream primer of LmFAS3 obtains fatty acid synthetase full length gene segment by PCR amplification, obtained product is carried out pure Change, Cloning Transformation is sequenced into Escherichia coli, and sequencing result is compared with transcript profile search result, is verified and is obtained the gene Nucleotide sequence overall length, nucleotides sequence is classified as SEQ ID NO:1;
C is based on migratory locusts fatty acid synthetase gene order SEQ ID NO:1, designs dsRNA upstream and downstream primer, sequence difference For SEQ ID NO:3 and SEQ ID NO:4, upstream and downstream primer carries T7 promoter sequence;
D, using above-mentioned fatty acid synthetase gene clone carrier Escherichia coli as template, SEQ ID NO:3 and SEQ ID NO:4 is Upstream and downstream primer carries out PCR amplification, and by the PCR product of amplification, transcription synthesizes dsRNA after purification.
3. the preparation method of the dsRNA of migratory locusts fatty acid elongase gene LmElo according to claim 2 a kind of, special Sign is: transcription synthesis dsRNA concrete operations are to try through Gel Extraction Kit (Sigma) after purification in the step d Agent box is after purification according to T7 RiboMAXTMExpress RNAi System (Promega) kit illustrates that synthesis is transcribed in vitro dsRNA。
4. a kind of application of the dsRNA of migratory locusts fatty acid synthetase gene LmFAS3, it is characterised in that: be used for pest control.
CN201910414226.9A 2019-05-17 2019-05-17 dsRNA of locusta migratoria fatty acid synthetase gene LmFAS3 as well as preparation method and application thereof Active CN110106179B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910414226.9A CN110106179B (en) 2019-05-17 2019-05-17 dsRNA of locusta migratoria fatty acid synthetase gene LmFAS3 as well as preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910414226.9A CN110106179B (en) 2019-05-17 2019-05-17 dsRNA of locusta migratoria fatty acid synthetase gene LmFAS3 as well as preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN110106179A true CN110106179A (en) 2019-08-09
CN110106179B CN110106179B (en) 2020-09-29

Family

ID=67490902

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910414226.9A Active CN110106179B (en) 2019-05-17 2019-05-17 dsRNA of locusta migratoria fatty acid synthetase gene LmFAS3 as well as preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN110106179B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111394354A (en) * 2020-03-31 2020-07-10 山西大学 dsRNA of locusta migratoria fatty acid synthetase gene L mFAS, preparation method and application

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017077212A (en) * 2015-10-21 2017-04-27 国立大学法人徳島大学 Screening method for pest control component
CN109504685A (en) * 2018-12-20 2019-03-22 山西大学 The application of E93 gene and its dsRNA in control of insect
CN109628459A (en) * 2018-12-20 2019-04-16 山西大学 The application of HR4 gene and its dsRNA in control of insect

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017077212A (en) * 2015-10-21 2017-04-27 国立大学法人徳島大学 Screening method for pest control component
CN109504685A (en) * 2018-12-20 2019-03-22 山西大学 The application of E93 gene and its dsRNA in control of insect
CN109628459A (en) * 2018-12-20 2019-04-16 山西大学 The application of HR4 gene and its dsRNA in control of insect

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
COOPER等: "Molecular mechanisms influencing efficiency of RNA interference in insects", 《PEST MANAGEMENT SCIENCE》 *
李大琪: "飞蝗几丁质酶家族基因功能及RNAi介导的害虫防治应用研究", 《中国博士学位论文全文数据库 农业科技辑》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111394354A (en) * 2020-03-31 2020-07-10 山西大学 dsRNA of locusta migratoria fatty acid synthetase gene L mFAS, preparation method and application
CN111394354B (en) * 2020-03-31 2022-03-18 山西大学 dsRNA of locusta migratoria fatty acid synthetase gene LmFAS, preparation method and application

Also Published As

Publication number Publication date
CN110106179B (en) 2020-09-29

Similar Documents

Publication Publication Date Title
CN101805746B (en) Chitinase genes of insects and application of dsRNA thereof
McGregor et al. Cupiennius salei and Achaearanea tepidariorum: spider models for investigating evolution and development
CN104630247B (en) Insect chitin deacetylate enzyme gene 1 and its application in control of insect
CN104673812B (en) A kind of insect cell cytochrome p 450 gene and its application
CN109504685B (en) E93 gene and application of dsRNA thereof in pest control
CN114957426B (en) SP6RARS and application thereof in preventing and treating cockroaches
CN104774843B (en) Applications of the Knickkopf genes dsRNA in control of insect
CN105695476A (en) Migratory locust wing epidermis protein gene and application thereof in pest control
CN107988231A (en) Migratory locusts coria epidermal protein gene 6 and its application in locust control
CN104789571B (en) The application of Retroactive genes and its dsRNA in control of insect
Carpio et al. Zebrafish as a genetic model organism
CN110106179A (en) A kind of dsRNA and its preparation method and application of migratory locusts fatty acid synthetase gene LmFAS3
CN101831447B (en) Insect chitin synthase 1A gene segment, dsRNA and application thereof
CN110172463B (en) Application of Knickkopf3-5&#39; gene dsRNA of migratory locust in pest control
CN101818159B (en) Insect chitin synthetase 1 gene segment, dsRNA and application thereof
CN110184274B (en) E75 gene and application of dsRNA thereof in pest control
CN110106177A (en) A kind of dsRNA and its preparation method and application of migratory locusts fatty acid elongase gene LmElo
CN109628459A (en) The application of HR4 gene and its dsRNA in control of insect
CN107699569A (en) Migratory locusts coria epidermal protein gene 1 and its application in locust control
CN110144351A (en) A kind of dsRNA and its preparation method and application of migratory locusts fatty acid synthetase gene LmFAS2
CN105907774B (en) A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect
CN102876691A (en) Beta-N-acetylglucosaminidase genes of insects and application thereof
CN111394354B (en) dsRNA of locusta migratoria fatty acid synthetase gene LmFAS, preparation method and application
CN110106181A (en) Application of 2 LmLRP2 and its dsRNA of migratory locusts LDL receptor related gene in migratory locusts prevent and treat
CN101831445B (en) Insect chitin synthase 2 gene and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant