CN105907774B - A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect - Google Patents
A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect Download PDFInfo
- Publication number
- CN105907774B CN105907774B CN201610316474.6A CN201610316474A CN105907774B CN 105907774 B CN105907774 B CN 105907774B CN 201610316474 A CN201610316474 A CN 201610316474A CN 105907774 B CN105907774 B CN 105907774B
- Authority
- CN
- China
- Prior art keywords
- dsrna
- rnase
- migratory locusts
- insect
- control
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
- A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Catching Or Destruction (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention provides the application of migratory locusts nucleic acid hydrolysis enzyme gene 2 (RNase 2) in agricultural insect pests control.Specifically by bioinformatics method, 2 segment of RNase is obtained from migratory locusts transcript profile, is further verified by PCR amplification and is obtained its cDNA full length sequence.Design primer and synthesize the double-stranded RNA (dsRNA) of RNase 2 accordingly, injected after entering migratory locusts body cavity can specific silencing RNase 2, later to the dsRNA of migratory locusts feeding anti insect gene after, the migratory locusts death rate can be improved up to 50% or more.The application of RNase 2 makes it possible feeding dsRNA pest control, has important practical significance to control of insect.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to a kind of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene 2 (RNase 2) exists
Application in control of insect.
Background technique
Insect pest is the formidable enemy of agricultural production, and control of insect depends primarily on chemical prevention at present.But chronic administration chemistry
Insecticide brings pesticide residue, the problems such as drug resistance occur in environmental pollution, pest, and novel pesticide substitute is urgently developed.
RNA interference (RNAi) is gene silencing phenomenon after one kind usually specific transcriptional as caused by double-stranded RNA (dsRNA) molecule, in
The acquisition Nobel Prize in 2006.In recent years, deepening continuously with research work carries out control of insect using RNAi technology and has become
For the novel strategy in plant protection field.It is put forward for the first time within 2008 the control of insect new concept based on RNAi in the world, due to the technology
Have the characteristics that desinsection target specificity and Environmental security friendly, is known as within 2012 " forth generation insecticide " in the world
Core technology.Carrying out control of insect using RNAi has following features: 1) having specificity to pest, substantially reduce to non-target life
The influence of object；2) dsRNA is easily degraded in nature, and noresidue is nontoxic to environment.
When carrying out control of insect using RNAi, feeding method is the method for most application value: being sprayed on plant leaf blade
DsRNA entered in enteron aisle by insect mouthpart, by intestinal cell absorb play RNAi effect.Guarantee the dsRNA that feeding enters
Stability in enteron aisle, make its by intestinal wall cell absorbed intact be the key that realize RNAi.Studies have found that insect cell can
DsRNA is taken in into body cavity by pinocytosis, when dsRNA length is greater than 60bp, can effectively degrade target gene.
Agriculture important pests migratory locusts have high susceptibility to dsRNA, but ideal effect is not achieved in feeding dsRNA, system
About application of the pest-resistant dsRNA in control of insect.Research shows that there is a kind of special nuclease in insect bodies, it is degradable
DsRNA etc., thus referred to as hydrolase nucleic acid (DNA/RNA non-specific nuclease, RNase) or double-stranded RNA drop
It solves enzyme (double stranded RNA degrading enzyme, dsRNase), it may be possible to influence dsRNA in insect gut
The principal element of stability.The present invention conducts a research to stability of the dsRNA in migratory locusts enteron aisle digestive juice, finds dsRNA piece
Section is just thoroughly degraded within of short duration a few minutes.Based on this, system is carried out to the hydrolase nucleic acid of migratory locusts intestinal degradation dsRNA and is ground
Study carefully, to improve the stability of anti insect gene dsRNA in enteron aisle, is achieved feeding method pest control.
Summary of the invention
The degradation problem that control of insect faces is carried out for feeding dsRNA, the purpose of the present invention is improve anti insect gene
Stability of the dsRNA in insect gut, and then the efficiency of the lethal migratory locusts of feeding dsRNA is improved, to realize feeding dsRNA prevention and treatment
Pest provides new approaches.
The present invention is based on migratory locusts transcript profile database, the segment for searching for acquisition splices it by GeneDoc software,
Upstream and downstream primer is designed, is verified by PCR amplification, obtains the nucleic acid hydrolysis enzyme gene of 4 migratory locusts.By RT-qPCR technology, obtain
Obtain the different tissues position expression map of 4 genes.It was found that sequence is the RNase 2 of SEQ ID NO:1 in the high table of midgut tissue
It reaches.The length of nucleotides is 1240bp, the exploitation reading frame comprising 1218bp.Using ExPaSy online software to SEQ ID NO:
1 translated after obtain the amino acid sequence SEQ ID NO:2 of migratory locusts RNase 2.Bioinformatic analysis shows that gene encodes
405 amino acid, molecular weight 44KDa, theoretical isoelectric point are 4.75.Based on SEQ ID NO:1, pass through primer
Premier5.0 software design contains the upstream and downstream primer of T7 promoter, and obtaining a segment length by PCR amplification is 540bp's
DNA fragmentation (SEQ ID NO:3).According to T7 RiboMAX after kitsTM Express RNAi System(Promega)
Kit illustrates that synthesis dsRNA is transcribed in vitro.After in dsRNA injection migratory locusts body based on SEQ ID NO:3 synthesis, so that middle intestines
The anti insect gene dsRNA of highly expressed 2 silencing of RNase, external source is able to maintain good integrality in middle intestinal digestion liquid.
The present invention provide it is a kind of based on SEQ ID NO:3 synthesis dsRNA promote feed the lethal evil of anti insect gene dsRNA
Application in worm: the dsRNA injection of the RNase 2 of synthesis is entered in migratory locusts body cavity by microsyringe, feeding is anti-afterwards for 24 hours
The dsRNA of worm gene observes the death rate of migratory locusts.As a result, it has been found that: the mRNA transcriptional level of migratory locusts RNase 2 after injection dsRNA
It significantly reduces, then feeds migratory locusts after the dsRNA of anti insect gene migratory locusts chitinase gene 10 (LmCht10) husking occur difficult most
Dead phenotype, the death rate reach 50% or more eventually.
Detailed description of the invention
(dsGFP is the control for injecting GFP dsRNA to the influence to 2 mRNA of RNase transcription afterwards for 24 hours for Fig. 1: dsRNA injection
Group, dsRNase 2 are the experimental group for injecting 2 dsRNA of RNase, and * * indicates P < 0.01).
After Fig. 2: dsRNA injection for 24 hours, (dsGFP is injection GFP dsRNA for influence of the middle intestinal digestion liquid to dsRNA integrality
Control group, dsRNase 2 is the experimental group for injecting 2 dsRNA of RNase, Control be without plus middle intestinal digestion liquid pair
Be DL1000 DNA Marker according to, Marker, band is followed successively by 1000 from big to small, 700,500,400,300,200,
100bp)。
Fig. 3: injection RNase 2 dsRNA for 24 hours after, feed 5 age migratory locusts anti insect gene LmCht10 dsRNA, if statistics
(dsGFP is the control group that LmCht10 dsRNA is fed after injecting GFP dsRNA to the death rate of worm, and dsRNase 2 is that injection flies
The experimental group of LmCht10 dsRNA is fed after 2 dsRNA of locust RNase, * * indicates P < 0.01).
Fig. 4: injection RNase 2 dsRNA for 24 hours after, feed 5 age migratory locusts LmCht10 dsRNA, observation nymph growth hair
Educating situation, (dsGFP is the control group that LmCht10 dsRNA is fed after injecting GFP dsRNA, and dsRNase 2 is injection migratory locusts
The experimental group of LmCht10 dsRNA is fed after 2 dsRNA of RNase).
Specific embodiment
Embodiment 1: 2 full length cDNA sequence of migratory locusts RNase obtains and amino acid sequence analysis
1. the acquisition of 2 full length cDNA sequence of migratory locusts RNase
Transcript profile database based on migratory locusts, scans for its Unigene, and after NCBI Blastx analysis, determination is obtained
Obtain the segment of 1 migratory locusts RNase 2.The segment is analyzed with GeneDoc software, and uses primer premier5.0
Software design upstream primer ACGATGGCCTCCCTACCGCT (SEQ ID NO:6) and downstream primer
TGTTTCACATCTGAGACGGTTAG (SEQ ID NO:7), is synthesized by Sangon Biotech (Shanghai) Co., Ltd..
Selection physically well develop, be in the same size, half male and half female 5 age migratory locusts nymph, under Stereo microscope in fast anatomical
Intestines, and be frozen in liquid nitrogen.RNA is extracted according to TaKaRa Trizol kit.It is using M-MLV reverse transcriptase that mentioned RNA is anti-
It is transcribed into the first chain cDNA.With this as template, upstream and downstream primer is designed, 2 overall length piece of migratory locusts RNase is obtained by PCR amplification
Section, is purified PCR product with Gel Extroaction Kit (Omega), by product cloning after purification to pEASY-
In blunt zero vector (Quan Shi King Company), it is transferred to Trans-T1 competent cell, spot is chosen and expands bacterium solution culture, use
Bacterium solution is sent to the limited public affairs of raw work bioengineering (Shanghai) share after Plasmid Mini Kit1 (Omega) extraction plasmids detection
Department is sequenced.Sequencing obtains the sequence that nucleotides sequence is classified as SEQ ID NO:1.
2. 2 amino acid sequence analysis of migratory locusts RNase
It is translated by ExPaSy online software to 2 nucleotide sequence of RNase has been obtained, the opening of prediction RNase 2 is read
Frame encodes 405 amino acid, molecular weight 44KDa, isoelectric point 4.75.Functional domain prediction discovery RNase 2 has one
Signal peptide and Endonuclease NS structural domain (DNA/RNA non-specific endonuclease domain).Fly
The homologous degree of locust RNase2 amino acid sequence and 2 amino acid sequence of desert locust dsRNase reaches 68%.
Embodiment 2: the dsRNA of synthesis migratory locusts RNase 2
1. designing the dsRNA primer of migratory locusts RNase 2
Based on 2 sequence of migratory locusts RNase, using primer premier5.0 software design.Design dsRNA primer, sequence
Column are respectively taatacgactcactatagggGTCGGCTCCGACTTCTACAC (SEQ ID NO:4) and taatacgactcac
TatagggAGCTCCGTCTCGACATTGTT (SEQ ID NO:5) (italicized item is T7 promoter).All primers are by raw work
The synthesis of bioengineering (Shanghai) limited liability company.
2. the template of preparation synthesis 2 dsRNA of migratory locusts RNase
By 2 plasmid as template of RNase of above-mentioned preservation, PCR expansion is carried out with the primer with T7 promoter sequence of synthesis
Increase, obtain the segment that a segment length is 540bp, nucleotides sequence is classified as SEQ ID NO:3.With Gel Extroaction Kit
(Omega) PCR product is purified, is quantified later with NaNoDrop 2000 (Thermo scientific), makes it
Final concentration reaches 0.25 μ g/ μ l.In this, as the template of synthesis dsRNA.
3. synthesizing the dsRNA of migratory locusts RNase 2
By dsRNA synthesis template obtained above according to T7 RiboMAXTM Express RNAi System
(Promega) kit illustrates that synthesis dsRNA is transcribed in vitro.It is carried out using NaNoDrop 2000 (Thermo scientific)
It is quantitative.It is spare to be stored in -80 DEG C of super low temperature refrigerators.
Embodiment 3: the dsRNA of migratory locusts RNase 2 imports the stability of dsRNA and the influence of jamming effectiveness to feeding method.
1, the injection of specificity dsRNA
Selection 39 physically well develops, is in the same size, the 1st day half male and half female 5 age nymph is tested.Use 25 μ l specifications
Micro syringe 2 dsRNA of RNase that 4 μ l (10 μ g) are synthesized gently is injected into nymph flank portion two, three uromeres it
Between.39 nymphs are chosen simultaneously and are established as control group, in the dsRNA to control group body for injecting the GFP of same volume and concentration.It will
Migratory locusts after injection be placed in 30 DEG C of constant temperature biochemical cultivation cases raising (illumination: interlunation=14h:10h, 30 ± 2 DEG C of temperature,
Humidity 60%), fresh wheat seedling and wheat bran are fed daily.
2, the influence of the detection of 2 silence efficiency of migratory locusts RNase and middle intestinal digestion liquid to dsRNA integrality
Respectively collect 9 injection GFP and RNase2 dsRNA for 24 hours after nymph, carefully by parenteral face liquid use
Paper handkerchief put on the skin it is dry, then by middle intestines swill and digestive juice be put into 1.5ml centrifuge tube, be added 1ml nuclase-free
Water.After 1000g is centrifuged 8min, supernatant is then the middle intestinal digestion liquid of migratory locusts.The middle intestines that solution is cut, it is fast quick-frozen in liquid nitrogen.According to
RNA is extracted according to TaKaRa Trizol kit, using M-MLV reverse transcriptase by mentioned RNA reverse transcription at the first chain cDNA.It adopts
With Quantitative Real-time PCR method difference testing goal gene (RNase 2) and house-keeping gene (β-actin,
EF1 α) relative expression quantity, to be detected to its silence efficiency.The result shows that compared with the control group, after injecting dsRNA,
2 gene transcription level of processing group RNase significantly reduces (Fig. 1).3 biology of every group of setting repeat, and each biology repeats 3
Head nymph.By the dsRNA of chitinase 1 serving 0 and the middle intestinal digestion liquid of migratory locusts after 37 DEG C of incubation 10min, pass through Ago-Gel
The integrality of electrophoresis detection dsRNA.The result shows that the dsRNA of LmCht10 intestines in the control group migratory locusts for having injected GFP dsRNA
By fast degradation in digestive juice, and integrality (figure can be kept in intestinal digestion liquid in the experimental group migratory locusts of silencing RNase 2
2)。
3, the dsRNA of migratory locusts 5 age nymph injection RNase 2 feeds the dsRNA of LmCht10 afterwards for 24 hours, carries out Phenotypic Observation
Control group (the dsRNA injection group of GFP) and each 30 5 age nymphs of experimental group (the dsRNA injection group of RNase 2) inject dsRNA
After for 24 hours, hungry 5h feeds the dsRNA of (pipettor is sent directly into mouthpart) 10 μ l (25 μ g) LmCht10 respectively, gives immediately new
Fresh wheat seedling and wheat bran.It repeats to feed afterwards for 24 hours primary.Control group nymph all successfully casted off a skin to adult the 7-9 days 5 ages,
And Adult Development is in good condition after casting off a skin.The experimental group of 2 dsRNA of RNase is injected, 50% nymph is dead because casting off a skin difficulty
(Fig. 3), shows as that wing bud opens, back is arched, and old epidermis is difficult to slough from polypide until dead (Fig. 4).The result shows that flying
Feeding dsRNA can be improved to the silence efficiency of target gene in the silencing of locust RNase 2, to improve pest-resistant dsRNA to migratory locusts
Lethality will promote effective application of the dsRNA in control of insect, have important application value.
Claims (3)
1. a kind of migratory locusts hydrolase nucleic acid genetic fragment, nucleotides sequence is classified as SEQ ID NO:3.
2. using migratory locusts hydrolase nucleic acid genetic fragment described in claim 1 as the dsRNA of templated synthesis.
3. dsRNA as claimed in claim 2 is promoting the application in the feeding lethal migratory locusts of anti insect gene dsRNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610316474.6A CN105907774B (en) | 2016-05-13 | 2016-05-13 | A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610316474.6A CN105907774B (en) | 2016-05-13 | 2016-05-13 | A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105907774A CN105907774A (en) | 2016-08-31 |
| CN105907774B true CN105907774B (en) | 2019-06-25 |
Family
ID=56748923
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610316474.6A Active CN105907774B (en) | 2016-05-13 | 2016-05-13 | A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105907774B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108546692B (en) * | 2018-05-14 | 2020-04-07 | 中国农业科学院植物保护研究所 | Asian locusta protein tyrosine kinase PTK and coding gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101168738A (en) * | 2007-10-06 | 2008-04-30 | 南昌大学 | Expression of recombined bovine pancreas ribonucleic acid hydrolase A and purifying method thereof |
| CN101370940A (en) * | 2006-01-12 | 2009-02-18 | 德福根有限公司 | DsRNA as insect control agent |
| CN101775400A (en) * | 2009-01-14 | 2010-07-14 | 北京联合大学生物化学工程学院 | Rana chensinensis functional gene Rd-RNase2 sequence, construction method and amino acid sequence and application thereof |
-
2016
- 2016-05-13 CN CN201610316474.6A patent/CN105907774B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101370940A (en) * | 2006-01-12 | 2009-02-18 | 德福根有限公司 | DsRNA as insect control agent |
| CN101168738A (en) * | 2007-10-06 | 2008-04-30 | 南昌大学 | Expression of recombined bovine pancreas ribonucleic acid hydrolase A and purifying method thereof |
| CN101775400A (en) * | 2009-01-14 | 2010-07-14 | 北京联合大学生物化学工程学院 | Rana chensinensis functional gene Rd-RNase2 sequence, construction method and amino acid sequence and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| A double-stranded RNA degrading enzyme reduces the efficiency of oral RNA interference in migratory locust;Song H.等;《Insect Biochemistry and Molecular Biology》;20170531;全文 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105907774A (en) | 2016-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104630247B (en) | Insect chitin deacetylate enzyme gene 1 and its application in control of insect | |
| CN109504685B (en) | E93 gene and application of dsRNA thereof in pest control | |
| CN103937822B (en) | The sequence of locust I type chitinase gene and the application of dsRNA thereof | |
| CN101805746A (en) | Chitinase genes of insects and application of dsRNA thereof | |
| CN105695476A (en) | Migratory locust wing epidermis protein gene and application thereof in pest control | |
| CN114957426B (en) | SP6RARS and application thereof in preventing and treating cockroaches | |
| CN104774843B (en) | Applications of the Knickkopf genes dsRNA in control of insect | |
| CN107988231A (en) | Migratory locusts coria epidermal protein gene 6 and its application in locust control | |
| CN104789571B (en) | The application of Retroactive genes and its dsRNA in control of insect | |
| CN116769810B (en) | Asiatic dolly locust TRE gene and application thereof in locust control | |
| CN105907774B (en) | A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect | |
| CN112662689B (en) | Migratory locust Rab11A gene and application of dsRNA thereof in migratory locust control | |
| CN110172463B (en) | Application of Knickkopf3-5' gene dsRNA of migratory locust in pest control | |
| CN110184274B (en) | E75 gene and application of dsRNA thereof in pest control | |
| CN107699569A (en) | Migratory locusts coria epidermal protein gene 1 and its application in locust control | |
| CN107828792B (en) | Insect I-type chitin binding protein AA10 gene and application thereof in pest control | |
| CN109628459A (en) | The application of HR4 gene and its dsRNA in control of insect | |
| CN110106179B (en) | dsRNA of locusta migratoria fatty acid synthetase gene LmFAS3 as well as preparation method and application thereof | |
| CN110106177B (en) | dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof | |
| CN101831445B (en) | Insect chitin synthase 2 gene and application | |
| CN111394354B (en) | dsRNA of locusta migratoria fatty acid synthetase gene LmFAS, preparation method and application | |
| CN115029357B (en) | Insect m 6 dsRNA of A methylation reading protein elF3-S6 gene and application thereof | |
| CN115011577B (en) | Insect m 6 A-methylation transferase METTL3 gene fragment, dsRNA thereof and application thereof | |
| CN116751798B (en) | Trehalase gene of Asian small car locust and application thereof | |
| CN109504684B (en) | Application of Ran gene and dsRNA thereof in pest control |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |