CN105907774A - Application of migratory locust intestinal tract RNase gene 2 to pest prevention and control - Google Patents
Application of migratory locust intestinal tract RNase gene 2 to pest prevention and control Download PDFInfo
- Publication number
- CN105907774A CN105907774A CN201610316474.6A CN201610316474A CN105907774A CN 105907774 A CN105907774 A CN 105907774A CN 201610316474 A CN201610316474 A CN 201610316474A CN 105907774 A CN105907774 A CN 105907774A
- Authority
- CN
- China
- Prior art keywords
- dsrna
- rnase
- control
- migratory locust
- migratory locusts
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
- A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Environmental Sciences (AREA)
- Dentistry (AREA)
- Pest Control & Pesticides (AREA)
- Agronomy & Crop Science (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Catching Or Destruction (AREA)
Abstract
The invention provides application of a migratory locust intestinal tract RNase gene 2 to agricultural pest prevention and control. Particularly, by a bioinformatic method, RNase 2 fragments are obtained from a migratory locust transcriptome; the cDNA full length sequence is obtained through PCR (polymerase chain reaction) amplification verification. The double-chain RNA (dsRNA) of RNase 2 is synthesized according to the design primer; after the injection into the migratory locust body cavity, the specific silencing RNase 2 can be performed; then, after the migratory locust is fed with insect-resistant gene DsRNA, the migratory locust death rate can reach 50 percent or higher; through the application of the RNase 2, the pest prevention and control through dsRNA feeding becomes possible; important practical significance can be realized on the pest prevention and control.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of migratory locusts enteron aisle hydrolase nucleic acid gene 2 (RNase 2) insect
Application in preventing and treating.
Background technology
Insect pest is the formidable enemy of agricultural production, and current control of insect depends primarily on chemical prevention.But chronic administration chemical insecticide
Bring residues of pesticides, environmental pollution, insect occur that the problems such as the resistance to the action of a drug, novel agricultural chemicals substitute are urgently developed.RNA does
Disturbing (RNAi) is gene silencing phenomenon after a kind of specific transcriptional generally caused by double-stranded RNA (dsRNA) molecule, in
Within 2006, obtain the Nobel Prize.In recent years, along with deepening continuously of research work, RNAi technology is utilized to carry out control of insect
Become the novel strategy in plant protection field.Control of insect new concept based on RNAi is proposed first, due to this skill for 2008
Art has the features such as desinsection target selectivity and Environmental security friendly, within 2012, is known as " forth generation insecticide " in the world
Core technology.Utilize RNAi to carry out control of insect and have following features: 1) insect is had selectivity, it is substantially reduced non-target
Biological impact；2) dsRNA easily degrades at nature, noresidue, nontoxic to environment.
When utilizing RNAi to carry out control of insect, feeding method is the method most having using value: be sprayed on plant leaf blade
DsRNA enters in enteron aisle by insect mouthpart, is absorbed performance RNAi by intestinal cell and acts on.Ensure to feed the dsRNA of entrance
Stability in enteron aisle so that it is be the key realizing RNAi by intestinal wall cell absorbed intact.Studies have found that insect cell can
By pinocytosis, dsRNA is taken in body cavity, when dsRNA length is more than 60bp, target gene of can effectively degrading.
Agricultural important pests migratory locusts have high susceptibility to dsRNA, but feeding dsRNA does not reaches ideal effect, restriction
Pest-resistant dsRNA application in control of insect.The nuclease that a class is special, degradable is there is in research in showing insect bodies
DsRNA etc., thus it is referred to as hydrolase nucleic acid (DNA/RNA non-specific nuclease, RNase) or double-stranded RNA
Digestive enzyme (double stranded RNA degrading enzyme, dsRNase), it may be possible to affect dsRNA steady at insect gut
Principal element qualitatively.DsRNA stability in migratory locusts enteron aisle digestive juice is conducted a research by the present invention, finds dsRNA sheet
Section was just thoroughly degraded within of short duration a few minutes.Based on this, the hydrolase nucleic acid of migratory locusts intestinal degradation dsRNA is carried out system
Research, to improving the stability of anti insect gene dsRNA in enteron aisle, makes feeding method pest control be achieved.
Summary of the invention
Carry out, for feeding dsRNA, the degradation problem that control of insect faces, it is an object of the invention to improve anti insect gene dsRNA
Stability in insect gut, and then improve the efficiency of the lethal migratory locusts of feeding dsRNA, for realizing feeding dsRNA preventing and treating evil
Worm provides new approaches.
It is spliced by GeneDoc software by the present invention based on migratory locusts transcript profile database, the fragment that search obtains, design
Upstream and downstream primer, by PCR amplification checking, it is thus achieved that the hydrolase nucleic acid gene of 4 migratory locusts.Through RT-qPCR technology,
Obtain the different tissues position expression map of 4 genes.Find that sequence is that the RNase 2 of SEQ ID NO:1 is at midgut tissue
High expressed.This length of nucleotides is 1240bp, comprises the exploitation reading frame of 1218bp.Use the online software of ExPaSy to SEQ
ID NO:1 obtains the amino acid sequence SEQ ID NO:2 of migratory locusts RNase 2 after translating.Bioinformatic analysis shows
405 amino acid of gene code, molecular weight is 44KDa, and theoretical isoelectric point is 4.75.Based on SEQ ID NO:1, pass through
Primer premier5.0 Software for Design contains the upstream and downstream primer of T7 promoter, and obtaining a segment length by PCR amplification is 540
The DNA fragmentation (SEQ ID NO:3) of bp.According to T7 RiboMAX after kitsTM Express RNAi System
(Promega) kit explanation in-vitro transcription synthesis dsRNA.DsRNA based on SEQ ID NO:3 synthesis injects migratory locusts
After internal so that the RNase 2 of middle intestines high expressed is reticent, and the anti insect gene dsRNA of external source can keep in middle intestinal digestion liquid
Well integrality.
The present invention provides a kind of dsRNA based on SEQ ID NO:3 synthesis to feed the lethal evil of anti insect gene dsRNA in promotion
Application in worm: by microsyringe, the dsRNA injection of the RNase 2 of synthesis is entered in migratory locusts body cavity, feed after 24h
The dsRNA of anti insect gene, observes the death rate of migratory locusts.Found that: the mRNA of migratory locusts RNase 2 after injection dsRNA
Transcriptional level significantly reduces, then feeds migratory locusts appearance after the dsRNA of anti insect gene migratory locusts chitinase gene 10 (LmCht10)
The final dead phenotype of difficulty of casting off a skin, the death rate reaches more than 50%.
Accompanying drawing explanation
(dsGFP is injection GFP dsRNA in the impact after Fig. 1: dsRNA injection 24h transcribed RNase 2 mRNA
Control group, dsRNase 2 is the experimental group of injection RNase 2 dsRNA, and * * represents P < 0.01).
After Fig. 2: dsRNA injection 24h, on the impact of dsRNA integrality, (dsGFP is injection GFP dsRNA to middle intestinal digestion liquid
Control group, dsRNase 2 be injection RNase 2 dsRNA experimental group, Control is the comparison not adding middle intestinal digestion liquid,
Marker is DL1000 DNA Marker, and band is followed successively by 1000,700,500,400,300,200,100 from big to small
bp)。
Fig. 3: injection RNase 2 dsRNA 24h after, feed 5 age migratory locusts anti insect gene LmCht10 dsRNA, statistics
(dsGFP is the control group feeding LmCht10 dsRNA after injection GFP dsRNA, and dsRNase 2 is for the death rate of nymph
Feeding the experimental group of LmCht10 dsRNA after injection migratory locusts RNase 2 dsRNA, * * represents P < 0.01).
Fig. 4: injection RNase 2 dsRNA 24h after, feed 5 age migratory locusts LmCht10 dsRNA, observe nymph growth
(dsGFP is to feed the control group of LmCht10 dsRNA after injection GFP dsRNA to developmental state, and dsRNase 2 is injection
The experimental group of LmCht10 dsRNA is fed) after migratory locusts RNase 2 dsRNA.
Detailed description of the invention
Embodiment 1: migratory locusts RNase 2 full length cDNA sequence obtains and amino acid sequence analysis
1. the acquisition of migratory locusts RNase 2 full length cDNA sequence
Transcript profile databases based on migratory locusts, scan for its Unigene, after NCBI Blastx analyzes, determine acquisition 1
The fragment of individual migratory locusts RNase 2.This fragment GeneDoc software is analyzed, and uses primer premier5.0 software
Design upstream primer ACGATGGCCTCCCTACCGCT (SEQ ID NO:6) and downstream primer
TGTTTCACATCTGAGACGGTTAG (SEQ ID NO:7), is closed by Sangon Biotech (Shanghai) Co., Ltd.
Become.
Choose physically well develop, in the same size, male and female half and half 5 age migratory locusts nymph, intestines in fast anatomical under Stereo microscope,
And be frozen in liquid nitrogen.RNA is extracted according to TaKaRa Trizol kit.Use M-MLV reverse transcriptase by carried RNA
Reverse transcription becomes the first chain cDNA.With this as template, design upstream and downstream primer, obtain migratory locusts RNase 2 by PCR amplification
Full length fragment, is purified PCR primer with Gel Extroaction Kit (Omega), product cloning is after purification arrived
In pEASY-blunt zero vector (Quan Shi King Company), proceed to Trans-T1 competent cell, choose spot and expand bacterium solution cultivation,
After using Plasmid Mini Kit1 (Omega) to extract plasmids detection, bacterium solution is sent to the raw limited public affairs of work bioengineering (Shanghai) share
Department checks order.Order-checking obtains nucleotides sequence and is classified as the sequence of SEQ ID NO:1.
2. migratory locusts RNase 2 amino acid sequence analysis
Translated obtaining RNase 2 nucleotide sequence by the online software of ExPaSy, it was predicted that the ORFs of RNase 2
Encoding 405 amino acid, molecular weight is 44KDa, and isoelectric point is 4.75.Functional domain prediction finds that RNase 2 has a letter
Number peptide, and Endonuclease NS domain (DNA/RNA non-specific endonuclease domain).Migratory locusts RNase
2 amino acid sequences reach 68% with the homology degree of desert locust dsRNase 2 amino acid sequence.
Embodiment 2: the dsRNA of synthesis migratory locusts RNase 2
1. design the dsRNA primer of migratory locusts RNase 2
Based on migratory locusts RNase 2 sequence, use primer premier5.0 Software for Design.Design dsRNA primer, its sequence is divided
Not Wei taatacgactcactatagggGTCGGCTCCGACTTCTACAC (SEQ ID NO:4) and
TaatacgactcactatagggAGCTCCGTCTCGACATTGTT (SEQ ID NO:5) (italicized item is T7 promoter).
All primers are synthesized by Sangon Biotech (Shanghai) Co., Ltd..
2. the template of preparation synthesis migratory locusts RNase 2 dsRNA
By RNase 2 plasmid as template of above-mentioned preservation, carry out PCR amplification with the primer of the band T7 promoter sequence of synthesis,
Obtaining the fragment that a segment length is 540bp, nucleotides sequence is classified as SEQ ID NO:3.With Gel Extroaction Kit (Omega)
PCR primer is purified, carries out quantitatively with NaNoDrop 2000 (Thermo scientific) afterwards so that it is final concentration reaches
To 0.25 μ g/ μ l.Template in this, as synthesis dsRNA.
3. synthesize the dsRNA of migratory locusts RNase 2
By dsRNA synthesis template obtained above according to T7 RiboMAXTM Express RNAi System(Promega)
Kit explanation in-vitro transcription synthesis dsRNA.NaNoDrop 2000 (Thermo scientific) is used to carry out quantitatively.Preserve
Standby in-80 DEG C of super low temperature refrigerators.
Embodiment 3: the dsRNA of migratory locusts RNase 2 imports stability and the impact of jamming effectiveness of dsRNA to feeding method.
1, the injection of specific dsRNA
Choose 39 physically well develop, nymph in the 1st day 5 ages in the same size, male and female half and half is tested.Use 25 μ l specifications
RNase 2 dsRNA that 4 μ l (10 μ g) are synthesized by micro syringe gently inject enter nymph flank portion two, three uromeres it
Between.Choose 39 nymphs simultaneously and be established as control group, in the dsRNA of the GFP of injection same volume and concentration to control group body.
Will injection after migratory locusts be placed in 30 DEG C of constant temperature biochemical cultivation cases raising (illumination: interlunation=14h:10h, temperature 30 ± 2 DEG C,
Humidity 60%), feed fresh wheat seedling and wheat bran every day.
2, the detection of migratory locusts RNase 2 silence efficiency and the impact on dsRNA integrality of the middle intestinal digestion liquid
Respectively collect 9 injection GFP and RNase2 dsRNA 24h after nymph, carefully by parenteral liquid use
Paper handkerchief is put on the skin dry, then the swill in middle intestines and digestive juice is put in 1.5ml centrifuge tube, adds 1ml nuclase-free water.
After 1000g is centrifuged 8min, supernatant is then the middle intestinal digestion liquid of migratory locusts.The middle intestines that solution cuts, fast quick-frozen is in liquid nitrogen.Depend on
Extract RNA according to TaKaRa Trizol kit, use M-MLV reverse transcriptase that carried RNA reverse transcription is become the first chain cDNA.
Use Quantitative Real-time PCR method testing goal gene (RNase 2) and house-keeping gene (β-actin, EF1 α) respectively
Relative expression quantity, thus its silence efficiency is detected.Result shows, compares with control group, after injection dsRNA, and place
Reason group RNase 2 gene transcription level significantly reduces (Fig. 1).Often group arranges 3 biology repetitions, and each biology repeats 3
Head nymph.After the dsRNA of chitinase 1 serving 0 and the middle intestinal digestion liquid of migratory locusts are hatched 10min in 37 DEG C, coagulated by agarose
The integrality of gel electrophoresis detection dsRNA.Result shows that the dsRNA of LmCht10 is at the control group having injected GFP dsRNA
By fast degradation in intestinal digestion liquid in migratory locusts, and in the reticent experimental group migratory locusts of RNase 2, intestinal digestion liquid can keep
Whole property (Fig. 2).
3, feed the dsRNA of LmCht10 after the dsRNA 24h of migratory locusts 5 nymph in age injection RNase 2, carry out Phenotypic Observation
Control group (the dsRNA injection group of GFP) and experimental group (the dsRNA injection group of RNase 2) each 30 5 age nymph note
After penetrating dsRNA 24h, hungry 5h, feed the dsRNA of (pipettor is sent directly into mouthpart) 10 μ l (25 μ g) LmCht10 respectively,
Give fresh wheat seedling and wheat bran immediately.Repeat after 24h to feed once.Control group nymph is in all successes in the 7-9 days 5 ages
Cast off a skin to adult, and Adult Development is in good condition after casting off a skin.The experimental group of injection RNase 2 dsRNA, the nymph of 50% is because sloughing off
Skin difficulty and dead (Fig. 3), show as that wing bud opens, arch in back, and old epidermis is difficult to slough from polypide until dead (figure
4).Result shows that the silence of migratory locusts RNase 2 can improve the feeding dsRNA silence efficiency to target gene, thus improves pest-resistant
The dsRNA fatal rate to migratory locusts, by promoting the dsRNA effective application in control of insect, has important using value.
Claims (3)
1. a migratory locusts hydrolase nucleic acid genetic fragment, its nucleotides sequence is classified as SEQ ID NO:3.
2. the dsRNA of migratory locusts hydrolase nucleic acid genetic fragment synthesis as claimed in claim 1.
3. dsRNA as claimed in claim 2 feeds the application in the lethal migratory locusts of anti insect gene dsRNA in promotion.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610316474.6A CN105907774B (en) | 2016-05-13 | 2016-05-13 | A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610316474.6A CN105907774B (en) | 2016-05-13 | 2016-05-13 | A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105907774A true CN105907774A (en) | 2016-08-31 |
| CN105907774B CN105907774B (en) | 2019-06-25 |
Family
ID=56748923
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610316474.6A Active CN105907774B (en) | 2016-05-13 | 2016-05-13 | A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105907774B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108546692A (en) * | 2018-05-14 | 2018-09-18 | 中国农业科学院植物保护研究所 | Oedaleus asiaticus B protein tyrosine kinase PTK and its encoding gene and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101168738A (en) * | 2007-10-06 | 2008-04-30 | 南昌大学 | Expression of recombined bovine pancreas ribonucleic acid hydrolase A and purifying method thereof |
| CN101370940A (en) * | 2006-01-12 | 2009-02-18 | 德福根有限公司 | DsRNA as insect control agent |
| CN101775400A (en) * | 2009-01-14 | 2010-07-14 | 北京联合大学生物化学工程学院 | Rana chensinensis functional gene Rd-RNase2 sequence, construction method and amino acid sequence and application thereof |
-
2016
- 2016-05-13 CN CN201610316474.6A patent/CN105907774B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101370940A (en) * | 2006-01-12 | 2009-02-18 | 德福根有限公司 | DsRNA as insect control agent |
| CN101168738A (en) * | 2007-10-06 | 2008-04-30 | 南昌大学 | Expression of recombined bovine pancreas ribonucleic acid hydrolase A and purifying method thereof |
| CN101775400A (en) * | 2009-01-14 | 2010-07-14 | 北京联合大学生物化学工程学院 | Rana chensinensis functional gene Rd-RNase2 sequence, construction method and amino acid sequence and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| SONG H.等: "A double-stranded RNA degrading enzyme reduces the efficiency of oral RNA interference in migratory locust", 《INSECT BIOCHEMISTRY AND MOLECULAR BIOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108546692A (en) * | 2018-05-14 | 2018-09-18 | 中国农业科学院植物保护研究所 | Oedaleus asiaticus B protein tyrosine kinase PTK and its encoding gene and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105907774B (en) | 2019-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109504685B (en) | E93 gene and application of dsRNA thereof in pest control | |
| CN104630247B (en) | Insect chitin deacetylate enzyme gene 1 and its application in control of insect | |
| CN105695476A (en) | Migratory locust wing epidermis protein gene and application thereof in pest control | |
| CN103937822B (en) | The sequence of locust I type chitinase gene and the application of dsRNA thereof | |
| CN104774843B (en) | Applications of the Knickkopf genes dsRNA in control of insect | |
| CN104789571B (en) | The application of Retroactive genes and its dsRNA in control of insect | |
| CN116769810B (en) | Asiatic dolly locust TRE gene and application thereof in locust control | |
| CN112662689B (en) | Migratory locust Rab11A gene and application of dsRNA thereof in migratory locust control | |
| CN110184274B (en) | E75 gene and application of dsRNA thereof in pest control | |
| CN110172463B (en) | Application of Knickkopf3-5' gene dsRNA of migratory locust in pest control | |
| CN105907774B (en) | A kind of application of migratory locusts enteron aisle nucleic acid hydrolysis enzyme gene in control of insect | |
| CN101818159B (en) | Insect chitin synthetase 1 gene segment, dsRNA and application thereof | |
| CN107828792B (en) | Insect I-type chitin binding protein AA10 gene and application thereof in pest control | |
| CN109439689A (en) | A kind of application of migratory locusts metallothionein I type gene LmMt I in locust control | |
| CN109628459A (en) | The application of HR4 gene and its dsRNA in control of insect | |
| CN110106177B (en) | dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof | |
| CN110106179B (en) | dsRNA of locusta migratoria fatty acid synthetase gene LmFAS3 as well as preparation method and application thereof | |
| CN101831445B (en) | Insect chitin synthase 2 gene and application | |
| CN110157743A (en) | For striking the injection and application method of low turbot 14-3-3 gene expression | |
| CN115011577B (en) | Insect m 6 A-methylation transferase METTL3 gene fragment, dsRNA thereof and application thereof | |
| CN111394354B (en) | dsRNA of locusta migratoria fatty acid synthetase gene LmFAS, preparation method and application | |
| CN116790638B (en) | Asiatic dolly locust UDP-N-acetamido glucose pyrophosphorylase gene and application thereof | |
| CN109504684B (en) | Application of Ran gene and dsRNA thereof in pest control | |
| CN113249397B (en) | Tabanus trehalase gene dsRNA and application thereof | |
| CN108841827B (en) | dsRNA (double-stranded ribonucleic acid) of wing development related gene wingless and application of dsRNA in controlling bactrocera dorsalis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |