CN110791501A

CN110791501A - Long-chain non-coding RNA and application of interference RNA thereof in treatment of atherosclerosis

Info

Publication number: CN110791501A
Application number: CN201911002400.5A
Authority: CN
Inventors: 于波; 田进伟; 孙长斌; 袭祥文; 顾霞; 刘新新
Original assignee: Harbin Medical University
Current assignee: Harbin Engineering University; Harbin Medical University
Priority date: 2019-08-02
Filing date: 2019-10-21
Publication date: 2020-02-14
Anticipated expiration: 2039-10-21
Also published as: CN110791501B

Abstract

The invention discloses a long-chain non-coding RNA and application of an interference RNA thereof in treating atherosclerosis. According to the invention, through high-throughput sequencing on the aorta tissue of an atherosclerosis mouse model, a significant difference of the expression of a long-chain non-coding RNA (lncRNA) molecule in the aorta tissue of a normal atherosclerosis mouse and a late atherosclerosis mouse is found, and the lncRNA molecule is highly expressed in the atherosclerosis tissue and is named lncRNA-AFIAR. Experiments prove that the lncRNA-AFIAR has the functions of enhancing macrophage proliferation, inhibiting macrophage apoptosis and the like, and participates in the process of promoting the development of atherosclerosis. The purpose of inhibiting macrophage proliferation and reducing plaque formation and further inhibiting AS progression can be achieved by inhibiting lncRNA-AFIAR. Therefore, the invention provides a new molecular marker and an intervention target point for diagnosing and treating atherosclerosis, and also provides a new technical means for treating atherosclerosis.

Description

Long-chain non-coding RNA and application of interference RNA thereof in treatment of atherosclerosis

Technical Field

The invention relates to a long-chain non-coding RNA and application of an interference RNA thereof in treating atherosclerosis. The invention belongs to the technical field of biological medicines.

Background

In 2018, in 1 month, the national cardiovascular disease center issued "report 2017 on cardiovascular diseases in China". It indicates that in 2017, the number of patients with coronary atherosclerotic heart disease in China is 1100 million, the prevalence rate and death rate of cardiovascular disease in China are still in the rising stage in general, and the number of patients with cardiovascular disease will still increase rapidly in the next 10 years. Coronary heart disease is one of the diseases with the highest global mortality as a high morbidity of cardiovascular diseases, and according to the report of the world health organization in 2011, the number of deaths of coronary heart disease in China is listed in the second world.

Atherosclerosis is believed to be a chronic inflammatory response in which macrophages progressively accumulate on the walls of dilated arteries, partially within the lesion, engulf lipids, produce multiple mediators of inflammation, and exacerbate the disease. Macrophage accumulation is not actually dependent on monocyte recruitment, but rather on local macrophage proliferation. Therefore, the proliferation and apoptosis of macrophages are indistinguishable from the development and progression of atherosclerosis.

Long non-coding RNA (lncRNA) is a type of transcript with the length of more than 200nt (nucleotide) and cannot be translated into functional RNA molecules of protein, and most of lncRNA is transcribed by RNA polymerase II catalysis and shows stronger specificity in tissues and cells. Research on lncRNA has progressed rapidly in recent years, but the function of the vast majority of lncRNA remains unclear. According to the invention, an lncRNA molecule with high expression quantity and large difference is screened from the whole transcriptome high-throughput sequencing of atherosclerotic arterial tissue, named lncRNA-AFIAR, and the function detection of the lncRNA-AFIAR further discovers the relationship between the lncRNA-AFIAR and atherosclerotic diseases, so that the disease mechanism can be better understood, and a new diagnosis and treatment target point is provided for atherosclerosis from the RNA level.

Disclosure of Invention

The invention aims to provide lncRNA with remarkably increased expression level in atherosclerotic tissues relative to normal arterial tissues, interference RNA thereof and application of the lncRNA in treating atherosclerosis as a new target.

In order to achieve the purpose, the invention adopts the following technical means:

according to the invention, a long-chain non-coding RNA is screened by performing high-throughput sequencing on an artery tissue in a mouse atherosclerosis model, and is named as lncRNA-AFIAR, the nucleotide sequence of the long-chain non-coding RNA is shown in SEQ ID NO.1, and the expression quantity of the lncRNA-AFIAR in the atherosclerosis tissue is obviously increased compared with that in a non-atherosclerosis tissue. Designing primer sequences related to the incRNA-AFIAR fluorescent quantitative PCR amplification and silencing incRNA-AFIAR (siRNA) sequences. Fluorescent quantitative PCR experiments further prove that high-throughput sequencing results are obtained by extracting RNA from mouse atherosclerotic tissues, performing reverse transcription to synthesize cDNA, performing PCR amplification by using a designed lncRNA-AFIAR PCR primer, and obtaining an amplified product for the first time. The lncRNA-AFIAR is constructed to silence the macrophage RAW264.7 of a mouse, and the function of the lncRNA-AFIAR in the functions of proliferation, apoptosis and the like of RAW264.7 cells is researched, so that the action mechanism of the lncRNA-AFIAR in atherosclerosis is explored. Through the regulation and control function of lncRNA-AFIAR on macrophages, the lncRNA-AFIAR plays an important role in the whole occurrence and development process of atherosclerosis, and LncRNA-AFIAR siRNA inhibits the progress of AS by inhibiting the proliferation of macrophages and reducing the formation of plaques.

On the basis of the research, the invention provides a long-chain non-coding RNA, which is named lncRNA-AFIAR, and the nucleotide sequence of the long-chain non-coding RNA is shown in SEQ ID NO. 1.

Reagents for detecting the long non-coding RNA are also within the scope of the invention. Preferably, the reagent is a primer, and more preferably, the primer sequence is shown as SEQ ID NO.2 and SEQ ID NO. 3.

Agents for inhibiting the long non-coding RNA are also within the scope of the invention. Preferably, the agent is interfering RNA (siRNA), and more preferably, the sequence of the interfering RNA (siRNA) is shown as SEQ ID NO.4 and SEQ ID NO. 5.

Furthermore, the invention also provides application of the long-chain non-coding RNA as a target spot in preparation of medicines for diagnosing or treating atherosclerosis.

Furthermore, the invention also provides the application of the reagent for detecting the long-chain non-coding RNA in preparing the medicine for diagnosing atherosclerosis.

Furthermore, the invention also provides the application of the reagent for inhibiting the long-chain non-coding RNA in preparing the medicine for treating atherosclerosis.

Compared with the prior art, the invention has the beneficial effects that:

experiments prove that the lncRNA-AFIAR has the regulation and control function on macrophages, and the lncRNA-AFIAR plays an important role in the whole occurrence and development process of atherosclerosis. Through screening the target spot in clinic, the early atherosclerosis timely drug intervention can be realized, and the disease can be delayed or even reversed. In the screening of the advanced atherosclerosis, the development condition of the pathological changes of the patient can be known, and the intervention is carried out in time to avoid the occurrence of clinical time. Therefore, the invention provides a new molecular marker and an intervention target point for diagnosing and treating atherosclerosis, and also provides a new technical means for treating atherosclerosis.

Drawings

FIG. 1 is a pathological staining established for an atherosclerotic mouse model;

A-D are ApoE mouse aortic atherosclerosis model aortic whole oil red O staining; A. b: an early AS model; C. d: a late AS model;

E-F is oil red O staining of a frozen section of the aortic root of a mouse atherosclerosis model; e: an early AS model; f: a late AS model;

FIG. 2 is a graph of the distribution of lncRNA differentially expressed from advanced mouse aortic tissue (ADV) and normal mouse aortic tissue (NOR) by high throughput sequencing;

FIG. 3 is a graph showing the expression of aortic tissue (ADV) in advanced atherosclerosis mice and aortic tissue (NOR) in normal mice by high throughput sequencing of IncRNA-AFIAR;

FIG. 4 is a diagram showing that Real-time PCR detects the expression of IncRNA-AFIAR in aortic tissue (ADV) of mice in advanced atherosclerosis and aortic tissue (NOR) of normal mice;

FIG. 5 shows the proliferation of RAW264.7 cells 48 hours after EDU staining detection of silencing sequences si-AFIAR of transfection-independent sequences si-NC and lncRNA-AFIAR; after lncRNA-AFIAR is silenced, RAW264.7 cell proliferation is obviously inhibited;

FIG. 6 shows the apoptosis of RAW264.7 cells 48 hours after Hochest33342 staining detection of silencing sequences si-AFIAR of transfection-independent sequences si-NC and lncRNA-AFIAR; after lncRNA-AFIAR is silenced, the apoptosis rate of RAW264.7 cells is obviously increased;

FIG. 7 shows that after Apoe-/-mice are subjected to high fat for 16 weeks, the AAV2/9-NC group and the AAV2/9-sh-AFIAR group are pathologically stained by the oil red O at the aortic root, and the aortic root plaques of the mice are stained by the oil red O staining, so that the AAV2/9-sh-AFIAR group is obviously reduced and reduced in atherosclerotic plaques (red) compared with the AAV2/9-NC group.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1: pathological staining after establishment of mouse model of atherosclerosis in different stages

1. Material

1.1 animals

The Apoe mice are purchased from Beijing Wintonlihua laboratory animal technology GmbH, and the laboratory animals are randomly grouped and respectively draw aorta at 12 weeks of age (the high fat feeding is started for 4 weeks at 8 weeks of age, EAR group) and 24 weeks of age (the high fat feeding is started for 16 weeks at 8 weeks of age, ADV group). The use of experimental animals was approved by the ethical committee of the university of harlbine medical science.

1.2 reagents

High fat diet (10% lard, 4% milk powder, 2% cholesterol, 0.5% sodium cholate) was purchased from Nanjing Senberg Biochemical, and modified oil Red O staining solution was purchased from Beijing Solebao Co.

2. Method of producing a composite material

2.1 taking materials

Mouse hearts and mouse aortas were taken under a stereomicroscope at high fat 4 weeks and 16 weeks, respectively.

2.2 mouse aortic oil Red O staining

Removing the specimen from the formaldehyde solution, washing for 15 minutes by running water, stripping the outer membrane, and then washing by distilled water; adding distilled water into 60ml of stock solution to 100ml, uniformly mixing, standing for 10 minutes, and dyeing for 2-4 hours; soaking the specimen with 70% ethanol until the plaque is red and the bottom color is white, soaking with distilled water, and soaking in formaldehyde solution for preservation.

2.3 pathological oil red O staining of aortic root in mice

Selecting frozen section of 10 microns, balancing for 5 minutes at room temperature, and repeatedly washing with dd water for 5 times; wiping the slices, dripping 60% isopropanol for 30-40 seconds, and removing liquid; dripping oil red O into the hatching membrane for 35 minutes, and placing the hatching membrane into water after the coloration name is obvious when the hatching membrane is observed; hematoxylin was added dropwise for 3 minutes, the staining was stopped with running water, observed under the mirror, and turned blue.

3. Results

And observing and photographing under a pathological microscope. The results are shown in FIG. 1, which illustrates the success of the model building.

Example 2: expression of LncRNA-AFIAR in arterial tissue of mice with different stages of atherosclerosis

1. Material

1.1 organization

Apoe of the invention^-/-Mice were purchased from experimental animals technology ltd, viton, beijing, and experimental animals were randomly grouped, and aortas were obtained at 8 weeks of age (NOR group) and 24 weeks of age (16 weeks of high fat feeding at 8 weeks of age, ADV group), respectively. The use of experimental animals was approved by the ethical committee of the university of harlbine medical science.

1.2 reagents

TRIzol Reagent is available from Invitrogen, USA. The reverse transcription kit (04897030001) was purchased from Roche, Germany. SYBRGreen Master (ROX) kit for fluorescent Real-time (Real-time) quantitative PCR (polymerase chain reaction) was purchased from Roche, Germany. The Real-Time PCR specific primers were designed and synthesized by Rui Boxing Ke Biotechnology GmbH. lncRNA high throughput sequencing was performed by the agency of BioInformation technologies, Inc., of kindred origin.

2. Method of producing a composite material

2.1 IncRNA high-throughput sequencing technology of mouse aortic tissue

6 NOR group tissue samples and 6 ADV group tissue samples, and the LncRNA high-throughput sequencing and subsequent analysis related work is finished by the Beijing Nora biogenic bioinformatics science and technology company Limited.

2.2 Real-Time PCR detection of LncRNA

2.2.1 Total RNA extraction

Apoe at 8 weeks of age (NOR group) and 8 24 weeks of age (8 weeks of age starting high fat feeding for 16 weeks, ADV group) respectively^-/-Mouse aortic tissue samples were used as subjects and 1ml TRIzol Reagent was added. Then fully grinding by a grinder, and placing at room temperature (15-30 ℃) to completely separate the nucleoprotein complex. After 3 minutes, 0.2 ml of chloroform was added, the cap was closed, the mixture was vigorously shaken for 15 seconds, left at room temperature for 3 minutes, centrifuged at 12000r/min at 4 ℃ for 15 minutes, and the mixture was addedThe colorless aqueous layer was transferred (ca. 0.5ml) to another 1.5ml centrifuge tube (taking care not to suck in the middle layer). 0.5ml of isopropanol was added to each tube, and the mixture was allowed to stand at room temperature for 5 minutes, centrifuged at 12000r/min at 4 ℃ for 10 minutes, and the supernatant was discarded. The RNA pellet was washed with 1ml of 75% ethanol, aspirated sufficiently that the RNA was in contact with the ethanol, centrifuged at 12000r/min at 4 ℃ for 6min, and the supernatant discarded. The RNA pellet was washed with 1ml of 100% ethanol, aspirated well, centrifuged at 12000r/min at 4 ℃ for 5min, and the supernatant was discarded. After air-drying for 10 minutes, RNA was dissolved in RNase-free DEPC solution and the solution was pipetted repeatedly to dissolve the RNA sufficiently. The concentration of RNA is measured by using an ultraviolet spectrophotometer, and the RNA can be stored in a refrigerator at the temperature of minus 80 ℃ after being subpackaged.

2.2.2 primer design

According to the transcript sequence of lncRNA-AFIAR, primers are designed on line by a Primer design tool (Primer BLAST) of NCBI website, and an upstream Primer: 5-ATCAGGAGCAAGATGGGGGT-3 (shown in SEQ ID NO. 2), and the downstream primer: 5-TTCTGATCGCACAAGGCACT-3 (shown in SEQ ID NO. 3).

2.2.3 reverse transcription

The extracted total RNA (1 μ g) is used as a template, and the following Reaction system is added, specifically, 0.5 μ l of Transcriptor reverse transcription (20U/μ l), 4 μ l of Transcriptor RT Reaction Buffer (5X), 0.5 μ l of Protector RNase Inhibitor (40U/μ l), 1 μ l of Deoxync-leo-tide Mix, 1 μ l of Random Hexamer Primer (600 μ M), and the Reaction volume is complemented to 20 μ l by DEPC water without RNase. The reaction solution is placed in a common PCR instrument and subjected to the steps of 25 ℃ for 10min, 55 ℃ for 30min, 85 ℃ for 5min and 4 ℃ for 5min to obtain cDNA. The cDNA can be used for Real-Time PCR detection of lncRNA.

The lncRNA-AFIAR specific primers were dissolved in RNase-free DEPC water according to the instructions of the SYBR Green Master (ROX) kit of Roche, Germany, and the concentration of the primers was adjusted to 10. mu.M. The following reaction system was set up: SYBRGreen Master (ROX) 10. mu.l, RNase-free DEPC water 7. mu.l, PCR formed Primer (10. mu.M) 0.5. mu.l, PCRinterfere Primer (10. mu.M) 0.5. mu.l, diluted cDNA 2. mu.l. Pre-denaturation at 95 deg.C for 10min, and annealing at 95 deg.C for 15s and 62 deg.C for 20s for 40 times to obtain CT value. And inputting the obtained CT value into a PCR calculator to calculate the relative expression content of the lncRNA-AFIAR.

3. Results

3.1 high throughput LncRNA sequencing results

Apoe was obtained by high throughput sequencing techniques at 8 weeks of age (NOR group) and 24 weeks of age (8 weeks of age starting high fat feeding for 16 weeks, ADV group)^-/-LncRNA differentially expressed in aortic tissues of mice (FIG. 2), wherein lncRNA-AFIAR (corresponding DNA sequence shown in SEQ ID NO. 1) was significantly higher in ADV group than in NOR group (FIG. 3).

3.2 LncRNA high throughput sequencing result validation

In order to verify the lncRNA high-throughput sequencing result, the Real-Time PCR detection of lncRNA-AFIAR is carried out on two groups of samples, namely NOR and ADV, so that the expression of lncRNA-AFIAR in the ADV group is obviously higher than that in the NOR group (figure 4), and the lncRNA-AFIAR is suggested to play a role in regulation and control in the atherosclerosis development process and has the treatment potential of delaying the atherosclerosis development.

Example 3: construction of silencing model of RAW264.7 cell lncRNA-AFIAR

1. Material

1.1 cells and siRNA

RAW264.7 cells used in the present invention were purchased from Shanghai Cell Bank of Chinese academy of sciences, and cultured in DMEM medium containing 10% inactivated fetal bovine serum (Science Cell, USA), penicillin (100U/mL) and streptomycin (100. mu.g/mL) at 37 ℃ under 5% CO 2.

Design the sequence of silencing lncRNA-AFIAR (siRNA), wherein a sense strand (sequence): GCAGAUAACUCGUUAGCAAUU (shown in SEQ ID NO. 4) and an Antisense strand (Antisense): UUGCUAACGAGUUAUCUGCUU (shown in SEQ ID NO. 5). The design and synthesis of small interfering RNA (siRNA) was accomplished by the Suzhou Jima Gene GmbH.

1.2 reagents

Small interfering RNA (siRNA) Transfection with X-tremeGENE siRNA Transfection Reagent from Roche, Germany; DMEM medium was purchased from Hyclone, and penicillin and streptomycin were purchased from Shanghai Bitian Biotechnology Ltd. The other reagents were the same as in example 1.

2. Method of producing a composite material

2.1 expression of LncRNA-AFIAR in RAW264.7 cells

RAW264.7 cells were plated at 2X 10⁵Each well was inoculated in a 6-well plate and cultured in DMEM medium containing 10% serum. When the cell confluency reaches 70% -80%, remove the culture medium, transfect RAW264.7 cells with X-tremeGENE siRNA Transfectionreagent and siRNA mixture, 6 hours later to discard the culture medium, add fresh complete culture medium. After 48 hours, the expression of IncRNA in the cells was determined by Real-time PCR as described in example 1.

3. Results

The extracted RAW264.7 cell total RNA is analyzed by Real-time PCR for the expression of IncRNA-AFIAR. Compared with the si-NC transfection group, the expression level of the lncRNA-AFIAR of the si-AFIAR transfection group is obviously reduced, which indicates that the cellular silencing model of the lncRNA-AFIAR is successfully modeled, and thus, a foundation is laid for further research on the function of the lncRNA-AFIAR in the RAW264.7 cell.

Example 4: regulating and controlling effect of LncRNA-AFIAR on proliferation and apoptosis of RAW264.7 cells

1. Cells

The cells and culture method used in the experiment were the same as in example 3.

1.2 reagents

The siRNA used in the experiment was the same as in example 3. EDU staining kit was purchased from Sharp Biotechnology, Inc. of Guangzhou, and Hochestt 33342 staining reagent was purchased from Biotechnology engineering (Shanghai) Inc. Reagents such as 4% paraformaldehyde, 0.5% Triton X-100 penetrating agent, 2mg/mL glycine solution and the like are prepared by the laboratory.

2. Method of producing a composite material

2.1 EDU experiment

Cells grown in log phase were inoculated into a 24-well plate, the cell density was below 5% in the experiment, EDU solution (reagent A) was diluted with cell culture medium at a ratio of 1:1000, and paper cup 50. mu.M EDU medium was used. Add 300. mu.L of EDU medium above per well, incubate for 2 hours, discard medium, wash cells twice with PBS, 5 minutes each. mu.L of cell fixative was added to each well, incubated at room temperature for 30 minutes, and the fixative was discarded. Then 150. mu.L of 2mg/mL glycine was added to each well, and after incubation for 5 minutes in a decolorization shaker, the glycine solution was discarded. After that, 200. mu.L of PBS was added to each well, followed by washing with a shaker for 5 minutes and discarding of PBS. Then 100. mu.L of the penetrant was added to each well, followed by 10 minutes incubation in a decolorized shaker, and 1 wash in PBS for 5 minutes. Preparing Appolo staining solution as required, adding 100 mu L of staining solution into each hole, keeping out of the sun, incubating at room temperature for 30 minutes in a shaking table, and then discarding the staining reaction solution. Adding 100 μ L of penetrant, washing with a decolorizing shaker for 3 times, each time for 10min, and discarding the penetrant. The reagent F was diluted with deionized water at a ratio of 1:100 to prepare a 1 × Hochest33342 reaction solution, which was stored in the dark. mu.L of 1 Xhochest 33342 reaction solution was added to each well, and after incubating for 30 minutes in a shaking table with a color removed at room temperature in the dark, the staining reaction solution was discarded. Add 100. mu.L PBS per well and wash 2 times. And (5) debugging the instrument, enabling the exposure time to be about 30ms and not to exceed 1s as much as possible, and photographing and storing.

2.2 Hochest33342

Cells growing in the logarithmic phase are taken and inoculated into a 24-well plate, the cell density is below 5% when an experiment is carried out, 4% paraformaldehyde is fixed for 30 minutes, the cell is washed twice by PBS, 300 mu L of Hochest33342 staining solution is added to cover the sample, the sample is placed for 5 minutes at room temperature, the Hochest staining solution is sucked off and washed for 2 times by PBS, and each time is 5 minutes. Observation can be directly under a fluorescent microscope (blue light). When the cell is apoptotic, the cell nucleus of the apoptotic cell is densely and deeply dyed or densely dyed in a broken block shape.

3. Results

3.1 Effect of LncRNA-AFIAR on the proliferative Capacity of RAW264.7 cells

In order to verify whether lncRNA-AFIAR affects the proliferation capacity of RAW264.7 cells, the invention detects the cell proliferation condition of si-RNA transfected cells after 48 hours through EDU (EDU), and finds that the proliferation of lncRNA-AFIAR silencing group cells is obviously inhibited (figure 5), which indicates that lncRNA-AFIAR has the capacity of promoting the proliferation of RAW264.7 cells.

3.2 Effect of LncRNA-AFIAR on the level of apoptosis in RAW264.7 cells

In order to verify whether lncRNA-AFIAR affects the apoptosis level of RAW264.7 cells, the invention detects the apoptosis level of si-RNA transfected cells after 48 hours through Hochest33342, and finds that the apoptosis level of lncRNA-AFIAR silent cells is obviously increased (figure 6), thereby prompting that lncRNA-AFIAR has the capability of inhibiting the apoptosis of RAW264.7 cells.

Example 5: effect of adeno-associated virus AAV2/9-shRNA (AAV2/9-sh-AFIAR) on plaque progression in atherosclerotic mice.

1. Material

1.1 adeno-associated Virus AAV2/9-NC (adeno-associated Virus carrying the unrelated sequence si-NC), AAV2/9-sh-AFIAR (adeno-associated Virus carrying the silencing sequence of IncRNA-AFIAR)

The vector construction, virus packaging, collection and purification of the adeno-associated virus AAV (AAV2/9-NC and AAV2/9-sh-AFIAR) applied in the invention are all from Henan bioscience (Shanghai) GmbH. Virus type and titer: AAV-GFP, type 2/9, titer 1X 10¹²vg/ml, injection amount: 100 μ l, injection site: mouse tail vein, storage: a minus 80 degree refrigerator.

1.2 animals

Apoe of the invention^-/-Mice were purchased from Beijing Wintonlitha laboratory animals technology Ltd, and the laboratory animals were randomly divided into 2 groups (AAV2/9-NC group, AAV2/9-sh-AFIAR group) and were fed at 8 weeks of age with high fat for 16 weeks, and the aorta was taken. The use of experimental animals was approved by the ethical committee of the university of harlbine medical science.

2. Method of producing a composite material

2.1 intravenous injection of the mouse Tail

Two groups of mice were administered with AAV2/9-NC and AAV2/9-sh-AFIAR once by rat tail vein injection at 8 weeks of age, respectively. The method comprises the following specific operations: firstly, fixing a mouse, straightening and tightening the tail; wiping tail with alcohol cotton ball to expand tail vein, and observing 2 red veins close to two sides of coccyx; fixing the tail of the mouse by using the index finger, the middle finger, the ring finger and the thumb of the left hand; and (3) holding a 1mL insulin injection needle with the right hand, enabling the inclined surface of the needle head to face upwards, inserting the needle with the inclination of 30 degrees, and slowly pushing the medicine.

2.1 taking materials

At 16 weeks of high fat, mouse heart and mouse aorta were separately obtained under a stereomicroscope.

2.2 pathological oil Red O staining of rat aortic root

3. Results

The AAV2/9 can infect mouse atherosclerosis plaque, and the AAV2/9-sh-AFIAR group can reduce the expression of LncRNA-AFIAR in the plaque and inhibit the proliferation of macrophage in the plaque. The atherosclerotic plaque (red) is stained by the oil red O, so that the aortic root atherosclerotic plaque of the mice in the AAV2/9-sh-AFIAR group is obviously reduced and reduced compared with the AAV2/9-NC group. The specimens were observed under a pathological microscope and photographed (FIG. 7).

Sequence listing

<110> Harbin university of medicine

<120> application of long-chain non-coding RNA and interfering RNA thereof in treatment of atherosclerosis

<130>KLPI190070

<160>5

<170>PatentIn version 3.3

<210>1

<211>2279

<212>DNA

<213>AFIAR

<400>1

actctcccgc tggctactgc tcatcaggag caagatgggg gtggggactg tccaatgatt 60

cctctgtgtg atagatgacc aagtggctgc agtcgtgggg gtctacacag cagtgcaaga 120

ttgtttgtag ctgatttgat caaactctgg cttcctgaac tggaatgaaa tgcagataac 180

tcgttagcaa acttttgtgg gaaaaaagtg ccttgtgcga tcagaacaaa gccgttttat 240

aatcagattt accaagctga gaagagggag tttcagcaaa tggaagcttc agctttctgt 300

caccaggaaa cactgcgtta tccagaatcg gaattgttaa agcatactga ctacaactgg 360

agacaaaaat ggaacctaag aaaataaaat cacttgggaa ggatgtgaat tcatatatct 420

tttctcttaa agttgttttg aaaagtaagt acttgccatt cctaattgtt tttgttttgc 480

tttttttttt tgtaatctga tactgaaagc gttgatttgt gcataaagta tatatagtta 540

ctgccatctg ggagtttgca ttttaagtga catggcatgg gtaagaacag acataaaaca 600

tatacacacc attatataga caactagact agatctagcc tgacaacaaa tggagcttga 660

tattcataga tcttacctga gtggatgtta tttcatgata tctgaaccct tgtccaaact 720

ctatatcatc tggcctgact agctagtgat gtattcctgt taacctttat attcttgttt 780

agcaagagtc ccatctgcat aaaagagtta cttcttttgt cattttggtt tggttcagct 840

gggagggata gcatcattgc ttcaggctga aatggactaa tctgtttcac ttgtgggtaa 900

ggagaaacga atactttgag aacagtgtgg cgtgggggag aaaggacaca attgctgcct 960

ttcatccttc cctgccctgg ctcaggatcc cagtgtggaa atggggatgc ttaggactta 1020

atgagcacat ttatttcctt ggatgagttg catagggaac caaaaggaag atgaagaaat 1080

ggacatgtag gaagtaggga agtcctaggg gagtgaagaa cccgttgctt tcaagcccag 1140

gtgtcagccc tttattctcc ctggtggctg ggacatgctg ccccacccct gcttccatcc 1200

tatgaatcaa gtgactgctt agaactgagc accactttgc tgagtaactg aggagagtga 1260

ggaattcaag aatggccttt taaggcacca ttttgtatga atcatcctgc gtacatctct 1320

ctactgaatc tacttctaga aatagagagc taccttcttg tcttgaagac aacagcacac 1380

attgtctgta agcattgtgt tgtgctcact ccttcctccg aggcctaatc tcctgtcctt 1440

ggtccttctt gtatgttccc tgaaatttcc ctctcctgcc atgtaaatcc agacaacttt 1500

ctgcctgcat tctatttctg cctttgaatt gagtctcttc gaaacaattg tgtggtggct 1560

gggcactgca aaatgagtca gttcctacag tttggttaca agttctcaaa aagtatttca 1620

gaatgtggat gtggtcagca gagtcatttt ccaggcatct aaaaggaaac ccacatcaac 1680

tgtaacaatt gagctctgac cggatggtgc catacaacag aaccaaggcc tattttctct 1740

tagagcaatg cctagagcca tacacgaatt tatctgctcc tagcacatct tcaatggaaa 1800

gtcttgttct tgtttgcagg tcacatttta tttgccacca tttgaaaaac aatgtgacac 1860

aggttttaac cttatttact tttggatgtt ggtctgaatt tgaaaaatta ttaattattt 1920

ttataaacta gaatcagtga gactagagta tgattagtag atgacttgaa gtatgactta 1980

tggatgaaaa gtgggtaatt tttctgagga ataaccaagg ggcactttta gatatcatgt 2040

agtacatagg attacctcat ttcctaatta tgttctggat ctttcagcgt tggtcatata 2100

aataattaaa ttcttttcaa gctttgaaga tgtttcaagc tcatcaacaa cagaatattt 2160

tagcttagca tgggctttag aaaaatcttt tgtggctatt tacttacttg tgtaccataa 2220

gttctgtaaa atctgattga gctggtcttc aaccattcat gaaagctgat gacattttc 2279

<210>2

<211>20

<212>DNA

<213>artificial sequence

<400>2

atcaggagca agatgggggt 20

<210>3

<211>20

<212>DNA

<213>artificial sequence

<400>3

ttctgatcgc acaaggcact 20

<210>4

<211>21

<212>RNA

<213>artificial sequence

<400>4

gcagauaacu cguuagcaau u 21

<210>5

<211>21

<212>RNA

<213>artificial sequence

<400>5

uugcuaacga guuaucugcu u 21

Claims

1. A long-chain non-coding RNA is named lncRNA-AFIAR, and the nucleotide sequence of the long-chain non-coding RNA is shown in SEQ ID NO. 1.

2. A reagent for detecting the long non-coding RNA of claim 1.

3. The reagent of claim 2, wherein the reagent is a primer, preferably wherein the primer sequence is as shown in SEQ ID No.2 and SEQ ID No. 3.

4. An agent for inhibiting the long non-coding RNA of claim 1.

5. The agent of claim 4, wherein the agent is an interfering RNA (siRNA), preferably wherein the sequence of the interfering RNA is as shown in SEQ ID No.4 and SEQ ID No. 5.

6. Use of the long non-coding RNA of claim 1 as a target for the preparation of a medicament for the diagnosis or treatment of atherosclerosis.

7. Use of an agent according to claim 2 or 3 for the manufacture of a medicament for the diagnosis of atherosclerosis.

8. Use of an agent according to claim 4 or 5 in the manufacture of a medicament for the treatment of atherosclerosis.