CN109706241B - Medicine for treating dilated cardiomyopathy and screening and preparation method thereof - Google Patents
Medicine for treating dilated cardiomyopathy and screening and preparation method thereof Download PDFInfo
- Publication number
- CN109706241B CN109706241B CN201910062918.1A CN201910062918A CN109706241B CN 109706241 B CN109706241 B CN 109706241B CN 201910062918 A CN201910062918 A CN 201910062918A CN 109706241 B CN109706241 B CN 109706241B
- Authority
- CN
- China
- Prior art keywords
- kshv
- mir
- dilated cardiomyopathy
- drug
- inhibitor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses a drug for treating dilated cardiomyopathy and a screening and preparation method thereof, belonging to the field of medical bioengineering, wherein the drug effect component of the drug comprises a substance which takes kshv-miR-K12-1-5p as a drug target point and expresses the kshv-miR-K12-1-5p through combination, degradation and/or down-regulation; the invention can remarkably improve the endothelial cell intercellular junction dysfunction and barrier function damage caused by KSHV infection by taking KSHV-miR-K12-1-5p as a drug action target and down-regulating expressed KSHV-miR-K12-1-5p molecules, thereby potentially improving the cardiac function.
Description
Technical Field
The invention relates to a medicine for treating dilated cardiomyopathy and a screening and preparation method thereof, in particular to a new medical application of an antisense complementary sequence of acquired virus non-coding small RNA, more specifically to an application of a non-coding kshv-miR-K12-1-5p antisense complementary sequence in treating dilated cardiomyopathy and a screening and preparation method of a medicine containing the non-coding kshv-miR-K12-1-5p antisense complementary sequence, and belongs to the field of medical bioengineering.
Background
The chronic dilated cardiomyopathy is a clinical syndrome of different cardiovascular diseases developing to the terminal stage, has the main pathophysiological characteristics of impaired ventricular filling and ejection capacity, finally leads to low ventricular blood pumping function, poor prognosis and high mortality, is one of the most main causes threatening human health and causing increase of medical burden, and is particularly important for China with increasingly-aging population. Dilated cardiomyopathy is the third cause of various cardiovascular diseases causing chronic dilated cardiomyopathy and is the first cause of heart transplantation operation, dilated cardiomyopathy is a cardiac muscle disease with unknown reasons which are mainly characterized by cardiac cavity enlargement and myocardial contraction dysfunction, a specific treatment method is not available so far, the prognosis is extremely poor, the 1-year fatality rate is 25-30%, and the 5-year fatality rate is about 50%. Viral infection plays an important role in the pathogenesis of dilated cardiomyopathy, which is mainly based on the detection of nucleic acid fragments of certain viruses, such as coxsackie B virus (CVB), in the heart tissue of dilated cardiomyopathy patients, but the pathogenesis of which has not yet been elucidated. To date, no solution for viral infection is available for the diagnosis and treatment of dilated cardiomyopathy, so that the risk assessment and treatment methods for dilated cardiomyopathy including viral infection factors are urgently needed to be searched.
microRNAs (miRNAs) are newly discovered non-coding RNAs with important regulation and control functions in various biological processes, and are derived from single-stranded RNAs with the length of about 22 nucleotides in transcripts of endogenous hairpin structures. Usually, miRNA is used as a guide molecule, and complementarily binds to 3' UTR base of target mRNA, mediating post-transcriptional regulation of genes. Compared with the traditional single-target drug therapy, miRNA therapy can regulate and control the pathophysiological state of diseases from multiple levels under the condition of single nucleotide molecule target therapy, and achieve more effective therapeutic effect.
A large number of studies have shown that miRNAs participate in the regulation of a wide variety of physiological and pathophysiological processes, but most focus on the study of the effects of endogenous miRNAs in the body, and relatively few studies on exogenous miRNAs. Exogenous miRNAs mainly refer to miRNAs expressed in vivo after infection by pathogens, and most commonly miRNAs expressed by viruses. It has now been found that herpes viruses, polyomaviruses, retroviruses, and the like are capable of expressing miRNAs, and that virally encoded miRNAs can target mRNA from a host and regulate expression of host genes. However, it is still unknown whether mirnas expressed by viruses are involved in the viral-induced disease process, and in particular by what mechanisms they act. In studies related to chronic dilated cardiomyopathy, although expression profiles of patient peripheral blood miRNAs have been examined (circulation.2014; 129(9): 1009-21; Proc Natl Acadsi U S A.2014; 111(30):11151-6), the relationship between viral miRNAs and dilated cardiomyopathy has not been reported, and there are no therapeutic drugs using viral miRNAs as drug targets.
In the invention, the applicant accidentally discovers the expression of miRNA-KSHV-miR-K12-1-5p expressed by Kaposi's sarcoma-associated virus (KSHV) in peripheral blood and heart tissues of patients with dilated cardiomyopathy, proves that the KSHV infection and the expression quantity of KSHV-miR-K12-1-5p are related to the occurrence of dilated cardiomyopathy by an epidemiological statistical method, develops a drug for treating dilated cardiomyopathy by taking KSHV-miR-K12-1-5p as a target point, and then proves that the function of improving the endothelial intercellular junction dysfunction caused by the KSHV infection and potentially improving the heart function by down-regulating KSHV-miR-K12-1-5p by a cell experiment.
Disclosure of Invention
Aiming at the problems and the defects objectively existing in the prior art, the applicant accidentally discovers that the KSHV infection and the expression quantity of virus miRNA (KSHV-miR-K12-1-5p) are related to the occurrence of dilated cardiomyopathy, develops an anti-dilated cardiomyopathy medicament taking KSHV-miR-K12-1-5p as a medicament target point, and simultaneously proves that the KSHV-miR-K12-1-5p as the medicament action target point and the reduction and expression of KSHV-miR-K12-1-5p molecules can obviously improve the endothelial cell-cell junction dysfunction and the barrier function damage caused by the KSHV infection and potentially improve the heart function.
The technical purpose of the invention is realized by the following technical scheme:
the invention aims to provide a medicine for treating dilated cardiomyopathy, wherein the medicine effective component of the medicine comprises a medicine target of kshv-miR-K12-1-5p, and the medicine has the effect of treating dilated cardiomyopathy by combining, degrading and/or down-regulating a substance expressing the kshv-miR-K12-1-5 p.
Combining: the expression can be reduced by combining a certain substance with kshv-miR-K12-1-5p, such as microRNAscope, miRNA antagomir, anti-miRNA oligonucleotides, circular RNA, morpholino and aptamer;
and (3) degradation: the kshv-miR-K12-1-5p can be induced to be degraded by nuclease through a certain substance, such as microRNAscope, anti-miRNA oligonucleotides and the like, and the kshv-miR-K12-1-5p single strand are combined in a base pairing mode to form a double-strand structure, so that the double-strand structure is easy to be identified and degraded by the nuclease;
Down-Regulation: namely, the generation amount of kshv-miR-K12-1-5p is regulated down by a certain substance, such as circular RNA, kshv-miR-K12-1-5 p-inhibitor;
any one of the three ways can play a role in reducing the expression quantity of kshv-miR-K12-1-5 p. The act of loading each of the above-described substances into commercial packaging labeled for anti-dilated cardiomyopathy use on any scale falls within the scope of the claimed invention.
Furthermore, the drug effect component of the drug comprises a substance for down-regulating expression of kshv-miR-K12-1-5 p.
Further, the substance for down-regulating expression of kshv-miR-K12-1-5p comprises a sequence segment kshv-miR-K12-1-5p-inhibitor which is antisense complementary to kshv-miR-K12-1-5p, and the sequence segment of kshv-miR-K12-1-5p-inhibitor is shown as SEQ ID NO. 2.
Further, the medicine also comprises pharmaceutically acceptable auxiliary materials and/or reagents for buffering, synthesizing and/or purifying the antisense complementary sequence segment kshv-miR-K12-1-5 p-inhibitor. The anti-dilated cardiomyopathy medicament can be added with various pharmaceutically acceptable auxiliary agents/auxiliary materials to prepare various dosage forms according to objective requirements by a person skilled in the art, and the medicament is convenient to sell or popularize.
The invention also aims to provide a screening method of a medicine for treating dilated cardiomyopathy, which is used for detecting whether a candidate substance can be combined, degraded and/or down-regulated to express kshv-miR-K12-1-5 p; therefore, a substance capable of inhibiting expression of kshv-miR-K12-1-5p is screened.
The third object of the present invention is to provide a method for preparing a medicament for treating dilated cardiomyopathy, comprising: and (3) a substance capable of binding, degrading and/or down-regulating the expression of the kshv-miR-K12-1-5p is used as an active ingredient of the drug for treating dilated cardiomyopathy.
Further, the substance for down-regulating expression of kshv-miR-K12-1-5p comprises a sequence segment kshv-miR-K12-1-5p-inhibitor which is antisense complementary to kshv-miR-K12-1-5p, and the sequence segment of antisense complementary is shown as SEQ ID NO. 2.
Because KSHV infection is species and tissue specific, it only infects humans, not animals, and therefore animal models of this viral infection cannot be prepared. In order to realize the treatment purpose of dilated cardiomyopathy, the invention respectively uses kshv-miR-K12-1-5p and kshv-miR-K12-1-5p-inhibitor for cell experiments, in endothelial cell experiments, it is proved that the stimulation of KSHV-miR-K12-1-5p composition or the direct infection of human endothelial cell line by KSHV can cause the dysfunction of the connection between endothelial cells and the damage of barrier function, and the combination, and/or degradation, and/or down-regulation of expression of KSHV-miR-K12-1-5p (for example, antisense complementation) can obviously improve the endothelial cell-cell connection dysfunction and the damage of barrier function thereof caused by KSHV infection, thereby inhibiting the function of KSHV infection in the occurrence and development of the dilated cardiomyopathy and achieving the aim of adjuvant therapy of the dilated cardiomyopathy. Therefore, based on the findings and results, the invention provides a medicine for treating clinical dilated cardiomyopathy, which takes kshv-miR-K12-1-5p as a treatment target.
Based on the base sequence of kshv-miR-K12-1-5p, kshv-miR-K12-1-5p and antisense complementary kshv-miR-K12-1-5p-inhibitor sequences are respectively synthesized. The KSHV-miR-K12-1-5p composition is used for stimulation or KSHV is used for directly infecting a human endothelial cell line, so that endothelial cell connection dysfunction and barrier function damage can be caused, the antisense complementary KSHV-miR-K12-1-5-inhibitor composition can inhibit the toxic effect of KSHV infection and improve the vascular endothelial cell connection function and barrier function, and therefore the KSHV-miR-K12-1-5-inhibitor has the potential effect of improving dilated cardiomyopathy.
The invention has the beneficial effects that:
1. as a new tool for gene expression regulation, miRNAs are novel targeted molecular therapeutic drugs, are different from the traditional therapeutic drugs, have the advantages of easy synthesis, easy detection, accurate quantification, capability of enhancing the stability and improving the affinity of the miRNAs after chemical modification, capability of being effectively positioned to target organs through a special drug delivery system and the like, take kshv-miR-K12-1-5p as a therapeutic target, play a role in improving the connection function and barrier function between vascular endothelial cells by transfecting kshv-miR-K12-1-5-inhibitor to a human endothelial cell line, and greatly improve the specificity and targeting of the treatment of the dilated cardiomyopathy caused by the Kaposi sarcoma related virus infection; the successful development of the miRNA medicament creates a new situation for the treatment of the dilated cardiomyopathy and provides reference for the development of medicaments for treating other diseases.
2. The expression level of kshv-miR-K12-1-5p is reduced by kshv-miR-K12-1-5-inhibitor, so that the treatment effect is achieved, and the problem of drug resistance to drugs for treating dilated cardiomyopathy is solved.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.
FIG. 1 expression levels of KSHV-miR-K12-1-5p and KSHV infection rates in heart tissues of dilated cardiomyopathy patients and control populations; wherein, A, the expression quantity of kshv-miR-K12-1-5p in heart tissues of dilated cardiomyopathy and control population; b, positive rate of KSHV DNA in heart tissue of dilated cardiomyopathy and control population; c, representative pictures of KSHV protein co-stained with cardiomyocyte marker (alpha-actin), fibroblast marker (P4HB) and endothelial marker (CD31), respectively, in heart tissue of patients with dilated cardiomyopathy;
FIG. 2 effect of kshv-miR-K12-1-5p on human endothelial cell line HCMECs; wherein, A, HCMECs transfects kshv-miR-K12-1-5p or VE-Cadherin staining representation pictures after control thereof; b, HCMECs transfect kshv-miR-K12-1-5p or a control thereof to form a single cell layer, and the fluorescence intensity of dextron permeating the cell layer; denotes p <0.05 compared to miR-con; representative pictures of VE-Cadherin staining after infection of KSHV with HCMECs and transfection of KSHV-miR-K12-1-5p inhibitor or its control; d, HCMECs infect KSHV and infect KSHV-miR-K12-1-5p inhibitor or a control thereof to form a single cell layer, and the fluorescence intensity of dextron permeating the cell layer; denotes p <0.05 compared to Control group; # denotes p <0.05 compared to the KSHV + inhibitor-con group.
Detailed Description
The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It is to be understood that the described embodiments are merely a few embodiments of the invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments of the present invention without any inventive step, are within the scope of the present invention.
First, an embodiment
The examples relate to the following sources of instrumentation, reagents and consumables and biomaterials:
1) instrumentation and equipment
2) reagent and consumable
RNasey Mini Kit (from Qiagen), TRIZOL LS (from Invitrogen), miRNA detection Kit (from Rugby, Guangzhou), TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (Agarose Gel DNA recovery Kit, from TaKaRa),
Endo-Free Plasmid Maxi Kit (Plasmid extraction Kit, available from OMEGA), EasyPure Plasmid MiniPrep Kit (Plasmid extraction Kit, available from beijing sumikagai);
3) sources of biological material
Peripheral blood of patients with dilated cardiomyopathy and peripheral blood of normal population come from hospitalized patients in Wuhan Tongji hospital in 2012 and 2018, and are signed with informed consent;
HCMECs (human endothelial) cells were obtained from ScienCell.
Example 1
The drug effective component of the drug for treating dilated cardiomyopathy comprises a substance which takes kshv-miR-K12-1-5p as a drug target and expresses kshv-miR-K12-1-5p through combination, degradation and/or down-regulation, so that the drug has the effect of treating dilated cardiomyopathy. Experiments in experimental example 1 show that KSHV-miR-K12-1-5p can be used as a drug target, but KSHV infection has species and tissue specificity, only infects human, and does not infect animals, so that an animal model infected by the virus cannot be prepared. In order to realize the treatment purpose of the dilated cardiomyopathy, experiments are further carried out by using a human endothelial cell line, the endothelial cell connection dysfunction and barrier function damage can be caused by stimulating the human endothelial cell line by using a KSHV-miR-K12-1-5p composition or directly infecting the human endothelial cell line by KSHV, and the endothelial cell connection dysfunction and the barrier function damage caused by KSHV infection can be obviously improved by degrading the KSHV-miR-K12-1-5p and/or reducing the expression of KSHV-miR-K12-1-5p (for example, antisense complementation), so that the effect of the KSHV infection in the occurrence and development of the dilated cardiomyopathy is inhibited, and the aim of auxiliary treatment of the dilated cardiomyopathy is fulfilled. Therefore, based on the findings and results, the medicine for treating the clinical dilated cardiomyopathy with kshv-miR-K12-1-5p as a medicine target is provided. The sequence of kshv-miR-K12-1-5p (MIMAT0002182) is shown in SEQ ID NO. 1: 5'-AUUACAGGAAACUGGGUGUAAGC-3' are provided.
In a preferred embodiment, the drug-effect component of the drug comprises a substance which can down-regulate expression of kshv-miR-K12-1-5 p; as is well known to those skilled in the art, kshv-miR-K12-1-5p is used as a section of micro RNA obtained from an animal body, the expression of the micro RNA can be reduced or inhibited through a molecular biological means, so that the level of the micro RNA can be reduced, and then the therapeutic effect can be achieved, other means can also be adopted, for example, molecules such as microRNA sponge, miRNA antagoiragomerapir, Anti-miRNA oligonucleotides, Circular RNA, Morpholino and Aptamer can be used for inducing the degradation of kshv-miR-K12-1-5p, and the purpose of reducing the level of the micro RNA can also be achieved.
In a further preferred embodiment, the agent for down-regulating expression of kshv-miR-K12-1-5p comprises a sequence segment kshv-miR-K12-1-5p-inhibitor which is antisense complementary to kshv-miR-K12-1-5p, and the sequence segment of kshv-miR-K12-1-5p-inhibitor is shown in SEQ ID NO. 2: 5'-GCUUACACCCAGUUUCCUGUAAU-3' are provided. The most convenient and simple way in molecular biology is to combine the antisense complementary strand with the target sequence fragment, so that the number of the target fragment is reduced, and the expression level of the target fragment is reduced.
In other embodiments, the medicament further comprises pharmaceutically acceptable excipients, and/or reagents for buffering, synthesizing, and/or purifying the antisense complementary sequence segment kshv-miR-K12-1-5 p-inhibitor. The anti-dilated cardiomyopathy medicament can be added with various pharmaceutically acceptable auxiliary agents/auxiliary materials to prepare various dosage forms according to objective requirements by a person skilled in the art, and the medicament is convenient to sell or popularize.
Example 2
A screening method of a drug for treating dilated cardiomyopathy comprises the steps of detecting whether a substance to be selected can be combined with, degraded and/or down-regulated to express kshv-miR-K12-1-5 p; therefore, a substance capable of inhibiting expression of kshv-miR-K12-1-5p is screened.
The specific experimental procedures of this set of examples can be seen in experimental example 2.
Example 3
A method of preparing a medicament for treating dilated cardiomyopathy, comprising: and (3) a substance capable of binding, degrading and/or down-regulating the expression of the kshv-miR-K12-1-5p is used as an active ingredient of the drug for treating dilated cardiomyopathy.
In a preferred embodiment, the substance for down-regulating expression of kshv-miR-K12-1-5p comprises a sequence segment kshv-miR-K12-1-5p-inhibitor which is antisense complementary to kshv-miR-K12-1-5p, and the sequence segment of antisense complementary is shown as SEQ ID NO. 2.
Second, test example
Experimental example 1
Virus miRNA and DNA detection of peripheral blood and myocardial tissue of dilated cardiomyopathy patient
1) Extracting a gene sample: peripheral blood was collected from 115 patients with dilated cardiomyopathy and 930 normal control populations. Collecting materials, centrifuging at room temperature 3500rpm for 6min, collecting upper layer plasma, and storing in refrigerator at-80 deg.C. Adding 1mL of TRIZOL LS into 0.25mL of peripheral blood plasma, extracting RNA, treating a sample with an RNasey Mini Kit, and extracting DNA according to the TRIZOL LS operating manual; use of
ND-1000 measures RNA and DNA quality. 14 cases of the expanded form were collectedCardiac tissue from patients with cardiomyopathy and 14 healthy heart transplant donors (healthy people who die unexpectedly, or patients who declared dead to have a disease that does not cause heart damage) were extracted for RNA and DNA.
2) Real-time quantitative PCR (real-time PCR) for detecting the expression of kshv-miR-K12-1-5 p: the miRNA detection kit of Guangzhou Ruibo company is adopted, and the experimental result is shown in table 1;
the reverse transcription reaction system of miRNAs is as follows: RNA template2 μ g, RT Primer Mix 4 μ L, and finally RNaseFERE H2O to a total volume of 19 μ L; wherein RT Primer Mix (reverse transcription Primer) configuration: miRNA RT Primer 1 μ L, U6 RT Primer 1 μ L, RNase free H2O 78 μ L; mixing the above systems, centrifuging instantly, incubating at 70 deg.C for 10min, incubating with ice for 2min, and adding the following reagents: 25 mu.L of 2 multiplied by TS reaction buffer, 2.5 mu.L of TS enzyme and 3.5 mu.L of RNase freeH2O 3.5;
the reverse transcription reaction procedure was: 60min at 42 ℃, 10min at 70 ℃, and 4 ℃ for standby after stopping, and storing the product at-20 ℃.
The miRNAs real-time PCR reaction system is as follows: 2 × SYBR Green Mix 9 μ L, RT product 2 μ L, miRNA Forward Primer 2 μ L, miRNA Reverse Primer 2 μ L, RNase-free H2O 5 μ L;
the miRNAs real-time PCR reaction program is as follows: 30sec at 95 deg.C- (denaturation 10sec at 95 deg.C-annealing at 60 deg.C for 20 sec-extension 1sec at 70 deg.C). times.40 cycles-Multi dark.
And after the real-time fluorescence reaction is finished, directly analyzing the result according to the data.
3) KSHV DNA detection: the results of the experiment using the TaqMan GeneExpression Master Mix kit from ThermoFisher scientific are shown in Table 1;
reaction system: mix 5. mu.L, KSHV Forward Primer (100uM) 0.09. mu.L, KSHV Reverse Primer (100uM) 0.09. mu.L, Probe (100uM) 0.02. mu.L, DNA 2. mu.L, H2O3 mu L; wherein the primer sequence is as follows:
KSHV Forward Primer：5'-CCGAGGACGAAATGGAAGTG-3'；
KSHV Reverse Primer：5'-GGTGATGTTCTGAGTACATAGCGG-3'；
Probe：5'-(6FAM)ACAAATTGCCAGTAGCCCACCAGGAGA(TAMRA)-3'；
reaction procedure: 30sec at 95 deg.C- (denaturation 10sec at 95 deg.C-annealing 30sec-72 deg.C-extension 301sec) x 40 cycles-Multi dark.
Data processing: analyzing the data by adopting statistical software SPSS 23.0, wherein the difference is significant when p is less than 0.05; the expression quantity of KSHV-miR-K12-1-5p is tested by adopting an independent sample t, and the infection rate of KSHV is tested by adopting a chi-square method.
4) Correlation analysis of KSHV infection with dilated cardiomyopathy
The data were analyzed using statistical software SPSS 23.0, with p <0.05 as the difference being significant, using logistic regression analysis.
TABLE 1 expression levels of KSHV-miR-K12-1-5p and KSHV infection rates in plasma of dilated cardiomyopathy patients and control populations
TABLE 2 correlation analysis of KSHV infection with dilated cardiomyopathy
As can be seen from tables 1 and 2, KSHV-miR-K12-1-5p expression was elevated in heart tissue and peripheral blood of patients with dilated cardiomyopathy (FIG. 1A, Table 1), and infection rate of KSHV was significantly higher than that of control group (FIG. 1B, Table 1), and KSHV infection was an independent risk factor for dilated cardiomyopathy (Table 2); KSHV primarily infects endothelial cells in heart tissue (FIG. 1C), suggesting that KSHV-miR-K12-1-5p plays a destructive role in the pathophysiological processes of dilated cardiomyopathy and can serve as a drug target.
Experimental example 2
kshv-miR-K12-1-5p-inhibitor is taken as an example to detect the treatment effect of the medicine on dilated cardiomyopathy
1) Effect of kshv-miR-K12-1-5p on human endothelial cell line HCMECs:
after transfection of HCMECs, a human endothelial cell line, with kshv-miR-K12-1-5p analog, the barrier effect of FITC-labeled Dextran by the endothelial cell-to-cell connexin and the monolayer formed by endothelial cells was examined by immunofluorescence, and the results are shown in FIGS. 2A and B.
2) Effect of KSHV-miR-K12-1-5p-inhibitor on KSHV infection damaging human endothelial cell line HCMECs:
after KSHV was used to directly infect human endothelial cell line, KSHV-miR-K12-1-5p-inhibitor was transfected, and then barrier effect of endothelial cell junction protein and endothelial cell formed single cell layer on FITC-labeled Dextran was detected by immunofluorescence, and the results are shown in fig. 2C and D.
The kshv-miR-K12-1-5p-inhibitor reverse complement sequence was purchased from Ruibo, Guangzhou and used RNase-free H2And dissolving the O. The sequence segment is shown as SEQ ID NO. 2: 5'-GCUUACACCCAGUUUCCUGUAAU-3' are provided.
As shown in FIG. 2, KSHV infection can cause endothelial cell-cell junction dysfunction and barrier function damage (FIGS. 2A and B), while the KSHV infection can significantly improve the endothelial cell-cell junction dysfunction and barrier function damage (FIGS. 2C and D) caused by the KSHV infection by combining the inhibitor with KSHV-miR-K12-1-5 p.
Sequence listing
<110> Wanwang text
<120> a medicine for treating dilated cardiomyopathy and screening and preparation method thereof
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>23
<212>RNA
<213> Kaposi's sarcoma-associated virus (Kaposi's sarcoma-associated virus)
<220>
<221>misc_feature
<222>(1)..(23)
<400>1
auuacaggaa acugggugua agc 23
<210>2
<211>23
<212>RNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221>misc_feature
<222>(1)..(23)
<223> sequence fragment antisense complementary to kshv-miR-K12-1-5p for reducing expression level of kshv-miR-K12-1-5p
<400>2
gcuuacaccc aguuuccugu aau 23
Claims (2)
1. The drug for treating dilated cardiomyopathy is characterized in that the drug effective components of the drug comprise a substance which takes kshv-miR-K12-1-5p as a drug target and expresses kshv-miR-K12-1-5p through combination, degradation and down-regulation, the drug effective components comprise a substance which expresses kshv-miR-K12-1-5p in a down-regulation manner, the substance which expresses kshv-miR-K12-1-5p in a down-regulation manner comprises a sequence segment kshv-miR-K12-1-5p-inhibitor which is antisense complementary to kshv-miR-K12-1-5p, and the sequence segment of kshv-miR-K12-1-5p-inhibitor is shown in SEQ ID NO. 2.
2. The medicament of claim 1, further comprising pharmaceutically acceptable excipients, and/or reagents for buffering, synthesizing, and/or purifying the antisense complementary sequence fragment kshv-miR-K12-1-5 p-inhibitor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910062918.1A CN109706241B (en) | 2019-01-23 | 2019-01-23 | Medicine for treating dilated cardiomyopathy and screening and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910062918.1A CN109706241B (en) | 2019-01-23 | 2019-01-23 | Medicine for treating dilated cardiomyopathy and screening and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109706241A CN109706241A (en) | 2019-05-03 |
| CN109706241B true CN109706241B (en) | 2020-09-25 |
Family
ID=66261606
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910062918.1A Active CN109706241B (en) | 2019-01-23 | 2019-01-23 | Medicine for treating dilated cardiomyopathy and screening and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706241B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112691193B (en) * | 2021-01-08 | 2022-06-24 | 华中科技大学同济医学院附属同济医院 | Drug for treating dilated cardiomyopathy and screening method and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107252491B (en) * | 2017-06-09 | 2021-06-29 | 汪道文 | Medicine for treating heart failure and screening method and preparation method thereof |
-
2019
- 2019-01-23 CN CN201910062918.1A patent/CN109706241B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109706241A (en) | 2019-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Greco et al. | Common micro‐RNA signature in skeletal muscle damage and regeneration induced by Duchenne muscular dystrophy and acute ischemia | |
| Van Rooij et al. | Toward microrna–based therapeutics for heart disease: The sense in antisense | |
| Chen et al. | Loss of long non-coding RNA CRRL promotes cardiomyocyte regeneration and improves cardiac repair by functioning as a competing endogenous RNA | |
| Tang et al. | microRNA inhibitors: Natural and artificial sequestration of microRNA | |
| EP2374884A2 (en) | Human miRNAs isolated from mesenchymal stem cells | |
| Zhuang et al. | LncRNA-H19 drives cardiomyocyte senescence by targeting miR-19a/socs1/p53 axis | |
| CN110791501A (en) | Long-chain non-coding RNA and application of interference RNA thereof in treatment of atherosclerosis | |
| CN104548134A (en) | Application of miR-144 and inhibitor thereof | |
| Ma et al. | Cardiac over-expression of microRNA-1 induces impairment of cognition in mice | |
| CN110546261B (en) | Small RNAs and use thereof for preventing and/or treating fibroproliferative disorders and/or syndromes | |
| Xuan et al. | Up‐regulation of miR‐195 contributes to cardiac hypertrophy‐induced arrhythmia by targeting calcium and potassium channels | |
| CN109706241B (en) | Medicine for treating dilated cardiomyopathy and screening and preparation method thereof | |
| CN110295227B (en) | Preparation method of diabetes early warning and/or diagnosis kit based on hsa-miR-320a | |
| CN111110691A (en) | Application of ginsenoside Rb2 in preparing medicament for preventing and/or treating atherosclerosis | |
| Dai et al. | miR-129 attenuates myocardial ischemia reperfusion injury by regulating the expression of PTEN in rats | |
| CN107447019A (en) | The application of piRNA 12 and the inhibitor of piRNA 12 and apply its product | |
| CN107252491B (en) | Medicine for treating heart failure and screening method and preparation method thereof | |
| CN115181797B (en) | Application of MicroRNA in dilated cardiomyopathy treatment | |
| Wang et al. | MicroRNA screening and functional study of obliterative bronchiolitis in a rat model simulating lung transplantation | |
| CN105779576A (en) | Use of human TNFRSF12A gene and related drugs | |
| CN111118139B (en) | Molecular target for osteoporosis and application thereof | |
| CN112691193B (en) | Drug for treating dilated cardiomyopathy and screening method and application | |
| CN105779575A (en) | Application of human EIF3A gene and related drugs | |
| CN111763735B (en) | Tumor differential expression gene and application thereof | |
| CN104031987B (en) | MiRNA application in myocardial fibrosis disease treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |