CN116059370A - Medical application of substance for knocking down or inhibiting long-chain non-coding RNA (ribonucleic acid) JPX - Google Patents

Abstract

The application provides medical application of a substance for knocking down or inhibiting long-chain non-coding RNA (ribonucleic acid) JCX, in particular to application of the substance for knocking down or inhibiting lncRNA JCX in preparing medicaments for preventing and treating cardiovascular diseases caused by aging; in the atherosclerosis patients caused by aging and atherosclerosis related cells and animal models, the inhibition of lncRNA JPX is found to inhibit aging and delay the process of atherosclerosis; the application provides a new target point for diagnosis and treatment of atherosclerosis related vascular diseases caused by aging and opens up a new direction for preparing prevention and treatment medicines.

Description

Medical application of substance for knocking down or inhibiting long-chain non-coding RNA (ribonucleic acid) JPX

Technical Field

The invention belongs to the technical field of biological medicines, relates to medical application of substances for knocking down or inhibiting long-chain non-coding RNA (ribonucleic acid) JPX, and in particular relates to application of substances for knocking down or inhibiting lncRNA JPX in preparation of medicines for preventing and treating atherosclerosis related vascular diseases caused by aging.

Background

With the development of society, cardiovascular diseases (Cardiovascular diseases, CVDs) are becoming a worldwide problem threatening human health due to their high prevalence, high disability rate and high mortality rate, and by 2030, CVDs are expected to continue to be the leading cause of death worldwide. Among them, atherosclerosis (AS) is a common pathophysiological basis for stroke, ischemic heart disease and peripheral vascular disease, and is caused by various risk factors such AS hypertension, hyperlipidemia and genetics, and bad lifestyle aggravates the occurrence and development of AS, such AS high-fat and high-cholesterol diet, obesity, smoking, lack of exercise, sedentary sitting, etc. Lesion development in AS is a typical age-dependent process. AS is a chronic vascular inflammatory disease, whose main pathological feature is vascular intimal lipid deposition, accompanied by smooth muscle cell and fibrous matrix proliferation, gradually developing into AS plaques. AS research is advanced, researchers find that a variety of senescent cells in blood vessels are closely related to AS pathophysiological changes, while SASP secreted by senescent cells also causes AS plaque to progress and become unbalanced. Senescent vascular smooth muscle cells (Human vascular smooth muscle cells, HVSMCs) can form multiple SASPs under pathogenic factor stimulation, promote monocyte chemotaxis, and can stimulate and affect the homeostasis of neighboring non-senescent HVSMCs cells and tissues; aging HVSMCs can also degrade protease by secreting matrix, so that cell proliferation is weakened, thinning of fibrous caps is promoted, and plaque stability is affected; at the same time, aging HVSMCs produce less collagen than normal HVSMCs, which can further affect plaque stability. Thus, cellular aging is increasingly being one of the major risk factors for AS cardiovascular disease.

With intensive research in epigenetic science, it is increasingly recognized that long non-coding RNAs (lncRNAs) exhibit a high degree of cell and tissue specificity and their role as modulators in cells. Many studies show that lncRNAs are closely related to embryo development, apoptosis, tissue growth and the like, and are a very wide-range regulatory factor expressed in human tissues. In recent years, the modification of lncRNA in the pathogenesis of AS has also attracted considerable attention. Studies prove that lncRNA H19, lncRNA MALAT1, lncRNA P21, lncRNA ANRIL and the like can participate in the processes of influencing cell proliferation, apoptosis and the like through two main regulation pathways of P53/P21 and P16/Rb, thereby participating in cell senescence and the occurrence and development of AS. Many lncRNAs have been reported to modulate activation of nuclear factor κB (NF- κB) and its downstream target genes, and these findings suggest that: in the aging process, lncRNAs may play a key role in SASP-induced AS. The lncRNA dppx gene is located at the 12-position on the long arm of the X chromosome, and is an activator of the XIST gene and a molecular switch for X chromosome inactivation. It can upregulate XIST expression and thus be involved in X chromosome inactivation. JPX as a lncRNA has been shown to target hundreds of autosomal genes, which prefer binding promoters, proximal regions of transcription initiation or transcription termination sites, exons and introns over their expression in the genome. JPX can regulate gene expression by expelling transcription factors or in conjunction with a number of important transcription factors. Related documents report that lncRNA JCX can promote proliferation, migration and invasion of tumor cells and participate in the occurrence and development processes of various cancers such AS lung cancer, gastric cancer and cervical cancer, but whether lncRNA JCX can participate in cell aging by regulating SASP genes or not, so that the relation of influencing AS has not been reported yet.

Disclosure of Invention

In view of the above problems, the present application provides a medical application of a knockdown lncRNA JPX substance.

The aim of the invention can be achieved by the following technical scheme:

the application of the substances for knocking down or inhibiting lncRNA (ribonucleic acid) JPX in preparing medicaments for preventing and treating cardiovascular diseases caused by aging. As a preferred aspect of the present invention, the substance for knocking down or inhibiting lncRNA JPX includes a small interfering RNA for knocking down lncRNA JPX or a gene editing system for knocking out lncRNA JPX, such as a CRISP/Cas9 gene editing system, which is currently known to be capable of knocking out or inhibiting a target gene.

As a further preferred aspect of the present invention, the siRNA sequence of the knockdown lncRNA JPX is shown in CCAGUUAAUAGUAUUGUGUTT (SEQ ID NO. 1) and ACACAAUACUAUUAACUGGTT (SEQ ID NO. 2). Preferably, the medicine for preventing and treating cardiovascular diseases caused by aging comprises medicines for preventing and treating atherosclerosis.

The application of lncRNA JPX as a target in screening medicaments for preventing and treating cardiovascular diseases caused by aging.

A method for screening and preventing and treating cardiovascular diseases caused by aging comprises the steps of administering candidate drugs to Ras-induced aging HVSMCs, detecting the expression level of lncRNA (ribonucleic acid) JCX, and if the lncRNA JCX is inhibited, indicating that the candidate drugs have in vitro activity for preventing and treating cardiovascular diseases caused by aging; or the candidate drug is given to an animal model of the cardiovascular disease caused by aging, the expression quantity of the lncRNA JPX is detected, and if the lncRNA JPX is inhibited, the candidate drug has the in vivo activity of preventing and treating the cardiovascular disease caused by aging.

Application of lncRNA (ribonucleic acid) JPX serving as a detection target in preparing auxiliary detection reagent for atherosclerosis caused by aging.

Application of substances for detecting lncRNA (ribonucleic acid) JPX in preparing auxiliary detection reagents for atherosclerosis caused by aging.

In a preferred embodiment of the present invention, the substance for detecting lncRNA JPX is a substance for quantitatively detecting lncRNA JPX.

As a further preferred aspect of the present invention, the substance for quantitatively detecting lncRNA JCX is a specific primer pair of lncRNA JCX.

The beneficial effects are that:

the application researches Apoe caused by aging by Western Blot, cell immunofluorescence and other methods ^-/- Expression of lncRNA JPX in mouse aortic tissue and human vascular smooth muscle. Constructing and synthesizing a knockout mouse of the specific interference lncRNA (ribonucleic acid) JPX; selecting Apoe of 8 weeks of age ^-/- Mice were randomly divided into a control group and a lncRNA JPX knockout group, and the control group and the lncRNA JPX knockout group mice were injected with a nonspecific control or lncRNA JPX gapmeRs (10 mg/kg per mouse) intravenously twice a week, continuously injected and fed with a high-fat diet for 16 weeks, to construct an AS mouse model. The invention defines the regulation mechanism of the lncRNA JPX on the HVSMCs for the first time, effectively prevents the aging of the HVSMCs and the AS caused by the aging, provides a new prevention and treatment drug development path and drug action target point for the diagnosis and treatment of the AS, and has very important medicinal value.

Drawings

FIG. 1 is a schematic representation of the expression level of lncRNA JPX in normal HVSMCs (represented by Con in the figure) and Ras-induced aging HVSMCs (represented by Ras in the figure);

the detection method was to detect their lncRNA dppx expression levels in normal and Ras-induced aged HVSMCs by real-time quantitative PCR (RT-qPCR).

FIG. 2 is a schematic diagram showing the detection of P16, P21 and P53 protein expression levels by Western Blot after knocking out lncRNA JPX from HVSMCs and applying Ras stimulation;

the detection method comprises the following steps: HVSMCs silncRNA JPX was stimulated to knock down lncRNA JPX for 24h, and then Ras was stimulated for 24h, and P16, P21, and P53 protein expression levels were detected by Western Blot.

FIG. 3 is a schematic representation of the detection of HVSMCs senescence by knocking out lncRNA JPX from HVSMCs, applying Ras stimulation, and staining with beta-galactosidase;

the detection method comprises the steps of giving HVSMCs silncRNA JPX stimulation for 24 hours to knock down lncRNA JPX, giving Ras stimulation for 24 hours, and detecting the aging condition of the HVSMCs by using a beta-galactosidase staining experiment.

FIG. 4 is a schematic diagram showing the detection of SASP gene expression levels of IL-6, IL-8, IL-1β, CCL2, ICAM-1, TNF- α, etc. by knocking out lncRNA JPX from HVSMCs, applying Ras stimulus, and real-time quantitative PCR (RT-qPCR); the detection method comprises the steps of knocking down lncRNA (JPX) after HVSMCs silncRNA JPX stimulation for 24 hours, then Ras stimulation for 24 hours, extracting cellular RNA, and detecting SASP gene expression levels of IL-6, IL-8, IL-1 beta, CCL2, ICAM-1, TNF-alpha and the like by qRT-PCR.

FIG. 5 shows Normal (NC) and High Fat (HFD) fed Apoe ^-/- Schematic representation of expression levels of lncRNA JPX in mouse vascular tissue.

The detection method comprises the following steps: selecting Apoe of 8 weeks of age ^-/- Mice were randomly divided into control and high fat fed groups and high fat diet fed for 16 weeks to construct AS mouse models. The mouse vascular tissue was then harvested and RNA was extracted for qRT-PCR experiments to detect expression levels of lncRNA JPX in normal diet and high fat feeding vessels.

FIG. 6 is a graph of the detection result of the oil red O staining of the mouse model;

the detection method comprises the following steps: selecting Apoe of 8 weeks of age ^-/- Mice were randomly divided into a control group and a lncRNA JPX knockout group, and the control group and the lncRNA JPX knockout group mice were injected with a nonspecific control or lncRNA JPX gapmeRs (10 mg/kg per mouse) twice weekly intravenously, continuously injected and fed with a high-fat diet for 16 weeks, to construct an AS mouse model. The aortic vessels were then harvested and plaque size was detected by oil red O staining.

FIG. 7 is a schematic diagram showing the detection of P16, P21 and P53 protein expression levels of mouse vascular tissues by Western Blot;

the detection method comprises the following steps: selecting Apoe of 8 weeks of age ^-/- Male mice were randomly divided into a control group and a lncRNA JPX knockout group, and the control group and the lncRNA JPX knockout group mice were given intravenous injection of nonspecific control or lncRNA JPX gapmeRs (10 mg/kg per mouse) twice a week, and fed with a high-fat diet for 16 weeks to construct an AS mouse model. The vascular tissue of the mice is then harvested and the mice are extractedVascular tissue proteins, P-STING, STING, P-TBK1, P-IRF3, P16, P21, P53 protein expression levels were detected by Western Blot.

FIG. 8 is a graph showing the result of immunofluorescence detection of a mouse model;

the detection method comprises the following steps: selecting Apoe of 8 weeks of age ^-/- Male mice were randomly divided into a control group and a lncRNA JPX knockout group, and the control group and the lncRNA JPX knockout group mice were given intravenous injection of nonspecific control or lncRNA JPX gapmeRs (10 mg/kg per mouse) twice a week, and fed with a high-fat diet for 16 weeks to construct an AS mouse model. Measurement of expression levels of P21 and α -SMA in rat aortic tissue sections: OCT embedding is performed after the aortic tissue of the mice is extracted, after frozen sections, the expression of P21 and alpha-SMA is detected by immunofluorescence, red (A) for P21, green (C) for alpha-SMA, blue (B) for nuclei, and white arrows indicate red and green co-localized yellow regions.

FIG. 9 is a schematic diagram showing the detection of SASP gene expression levels of IL-6, IL-8, IL-1β, CCL2, ICAM-1, TNF- α, etc. by real-time quantitative PCR (RT-qPCR) in vascular tissues of mice;

the detection method comprises the following steps: selecting Apoe of 8 weeks of age ^-/- Male mice were randomly divided into a control group and a lncRNA JPX knockout group, and the control group and the lncRNA JPX knockout group mice were given intravenous injection of nonspecific control or lncRNA JPX gapmeRs (10 mg/kg per mouse) twice a week, and fed with a high-fat diet for 16 weeks to construct an AS mouse model. Mouse aortic tissue RNA was extracted and the SASP gene expression levels of IL-6, IL-8, IL-1β, CCL2, ICAM-1, TNF- α, etc., were detected by qRT-PCR.

Detailed Description

The following examples will provide those skilled in the art with a thorough understanding of the present invention and are not intended to limit the present invention in any way.

The following examples relate to cell, reagent sources:

human Vascular Smooth Muscle Cells (HVSMCs): purchased from ScienCell.

Apoe ^-/- Mice: purchased from Vetolihua laboratory animal technologies Inc., 8 week old male mice.

The cell experiments described in the following examples were all approved by the ethical committee of the university of south Beijing medical science.

siJPX: synthesized by Shanghai Ji Ma Gene Inc. The nucleotide sequence of the sense strand is 5'-CCAGUUAAUAGUAUUGUGUTT-3' (SEQ ID NO. 1) and the nucleotide sequence of the antisense strand is 5'-ACACAAUACUAUUAACUGGTT-3' (SEQ ID NO. 2).

Example 1 lncRNA JPX and aging-induced AS-related assay

To explore the levels of lncRNA JPX in normal and Ras-induced senescent HVSMCs, it was verified whether lncRNA JPX was involved in AS, and this example used qRT-PCR to detect lncRNA JPX expression levels in normal and Ras-induced senescent HVSMCs.

Referring to Oncogenic ras Provokes Premature Cell Senescence Associated with Accumulation of p and p16INK4a, the experimental procedure for constructing senescent HVSMCs was as follows:

(1) Seed 5X10 in a 10cm dish ⁶ Culturing the Phoenix cells;

(2) Changing the liquid the next day, adding 6mL of fresh culture medium, and continuing culturing;

(3) Mu.g of the plasmid of interest (pBabe-H-Ras) ^V12 ) +0.4. Mu.g of VSV-G plasmid was dissolved in 1mL of Opti-MEM and gently mixed;

(4) mu.L lipo2000 was dissolved in 1mL Opti-MEM and gently mixed;

(5) Standing at room temperature for 5min;

(6) Mixing plasmid and lipo2000, and standing for 20min;

(7) Dripping the mixed solution into a culture dish for culturing the seeded cells, and gently shaking and uniformly mixing;

(8) Culturing at 37 ℃ for 15 hours, changing the liquid, discarding the culture medium, and adding 6mL of fresh culture medium into each dish of cells;

(9) Culturing for 48 hr, collecting cell first supernatant, filtering with 0.45 μm filter membrane, and preserving at 4deg.C;

(10) After further culturing the cells for 8 hours by adding 6mL of fresh medium, collecting a second supernatant, filtering with a 0.45 μm filter membrane, and preserving at 4 ℃):

(11) HVSMCs were cultured in six well plates;

(12) When in infection, mixing a proper amount of the first supernatant with a culture medium, and culturing for 12 hours at 37 ℃;

(13) The infection process was repeated with the second supernatant and screening was performed with 2. Mu.g/mL puromycin for 3 days.

The total RNA extraction experiment steps are as follows:

(1) The treated samples were collected and total RNA was extracted as described in Trizol kit. Using RNase gun head, DEPC water and wearing mask (preventing RNase and RNA degradation);

(2) Cells were washed with PBS and 1mL Trizol was added to each well;

(3) After 10s, transferring the cell lysate to EP, and standing on ice for 10min;

(4) Adding 200 μl of chloroform, shaking, mixing, and placing on ice for cracking for 10min;

(5) Centrifuging at 12000rpm at 4deg.C for 15min;

(6) Carefully sucking the supernatant to a new EP pipe, adding isopropanol, mixing the mixture upside down, and standing the mixture on ice for 10min;

(7) Centrifuging at 12000rpm and 4 ℃ for 15min, and discarding supernatant;

(8) Pouring the residual liquid on paper to suck, adding 75% ethanol diluted by DEPC water, and slightly blowing off by a gun to obtain white feather-like precipitate;

(9) And (3) centrifuging: 4 ℃,12000rpm,15min;

(10) Removing supernatant ethanol, sucking to dry, and air drying at vent hole of cell room super clean bench (5-10 min)

(11) Adding DEPC water to dissolve RNA;

(12) The NanoDrop is used for measuring the concentration of RNA, and the RNA is stored in a refrigerator at the temperature of minus 80 ℃ for standby.

The reverse transcription experiment steps are as follows:

(1) Using

II 1st Strand cDNA Synthesis Kit reverse transcription was carried out in a total reaction volume of 20. Mu.L, and the specific composition was as follows:

RNase free ddH ₂ O To 20μL

Total RNA 1μg

II Buffer plus 4μL

(2) After mixing evenly, reverse transcription is carried out by a PCR instrument:

25℃ 5min

42℃ 30min

85℃ 5min

(3) After the end of reverse transcription, the cDNA was quenched with DEPC water at 1:3 or 1:4, diluting in proportion, and storing at-80 ℃ for standby.

The Real-time PCR experiment steps are as follows:

(1) This experiment is carried out

qPCR SYBR Green Master Mix the target gene is detected relatively quantitatively, and the PCR reaction system is as follows:

cDNA template 1. Mu.L

qPCR SYBR Green Master Mix 5μL

An upstream primer: TGCAGTCAGAAGGGAGCAAT, 1. Mu.M and 1. Mu.L

A downstream primer: CACCGTCATCAGGCTGTCTT, 1. Mu.M and 1. Mu.L

2 mu L of ultrapure water

(2) Grouping, calculating a system (finally adding cDNA);

(3) Sealing the membrane, centrifuging the 384-hole plate, and then placing the membrane into a fluorescent quantitative PCR instrument;

(4) The reaction was performed on a Bio-Rad 480 type I quantitative PCR instrument.

The results of the assay are shown in FIG. 1, where the expression level of lncRNA JPX in Ras-induced aging HVSMCs is significantly increased compared to the normal group.

To further determine whether lncRNA JPX is involved in HVSMCs senescence, leading to AS, we constructed small interfering RNAs (sirnas) of lncRNA JPX. After siRNA is transfected into HVSMCs to knock out lncRNA JPX, ras is stimulated, cellular proteins are extracted, and expression of senescence markers such as P16, P21, P53 and the like is detected through Western Blot.

The Western Blot detection assay procedure was as follows:

(1) Preparing SDS polyacrylamide gel: preparing separating gel according to protein molecular weight, adding various reagents into 50mL centrifuge tubes according to different proportions to prepare separating gel, vortex oscillating for 30s, mixing, pouring into a vertical laminated glass plate to the upper middle part of the glass plate, and slowly adding ddH ₂ O is sealed with liquid, and is solidified for 45min at room temperature. Concentrated glue: and uniformly mixing the reagent according to the formula, pouring the reagent onto the separating gel to the top end of the glass plate, inserting a comb (avoiding mixing bubbles), and adding the rest liquid from two sides of the comb by using a liquid transfer device for standby after the gel is solidified.

(2) Sample loading and electrophoresis separation: loading electrophoresis, and instantaneous centrifuging the protein sample before loading, and then slightly shaking. The sample is generally applied in terms of the volume of the solution having a total mass of 30. Mu.g of protein. The gel plates are fixed in an electrophoresis tank of an electrophoresis device, after 1x electrophoresis buffer solution is filled between the two gel plates, the comb is pulled out for sample loading, and after sample loading is finished, the electrophoresis is started after the liquid is filled. The 80V constant pressure electrophoresis was run until bromophenol blue reached the junction of the concentrated gel and the separation gel and the protein samples of each lane were on substantially the same horizontal line, 120V was set, and the electrophoresis was terminated until bromophenol blue was near the bottom.

(3) Transferring: and (5) removing the glass plate and cutting the glue. Cutting PVDF film according to gel size, activating with methanol for 1min in advance, soaking with sponge, filter paper and gel in 1x film transfer buffer solution for 5-10min, sequentially arranging, and discharging bubbles during the placing process. The film transfer tank is placed in a box, the constant pressure is 120V, the film transfer time is selected according to the molecular weight of the protein (heat is generated in the film transfer process, and ice bags and water are placed around to simulate a low-temperature environment of 4 ℃).

(4) Closing: after the transfer, the membrane was removed and placed in 5% skim milk (TBS-T formulation) and blocked by shaking on a room temperature decolorizing shaker for 1h.

(5) Incubation resistance: after the sealing is finished, the milk is washed by TBS-T, the membrane is sealed in a plastic sealing membrane, the corresponding primary antibody is added, and a refrigerator shaker at 4 ℃ is used for overnight.

(6) Secondary antibody binding: washing the membrane with TBS-T for four times for 10min, 5min and 5min respectively, incubating with corresponding secondary antibody at room temperature on a decolorizing shaker for 1h, and washing the membrane with TBS-T for 10min, 5min and 5min sequentially.

(7) ECL color development: and (3) uniformly mixing ECL color development liquid A, B liquid in equal volume (in dark place) before color development, developing in a fluorescent chemiluminescence gel imaging system, photographing and storing records.

As shown in FIG. 2, the levels of P16, P21 and P53 protein expression in Ras-induced HVSMCs were reduced after interfering with lncRNA JPX, as compared to normal HVSMCs. Meaning that lncRNA JCX participates in the regulation of HVSMCs senescence, interference lncRNA JCX can reduce Ras-induced senescence, thereby inhibiting the occurrence and development of AS.

Meanwhile, the beta-galactosyltransferase staining experiment (beta-Gal staining experiment) is carried out, the detection result is shown in figure 3, and after interference of lncRNA JCX, the aged HVSMCs (blue) are obviously reduced.

The beta-galactosyltransferase staining experiment steps are as follows:

(1) The medium was aspirated and washed 3 times with 5min each with PBS.

(2) Adding appropriate volume of beta-galactosidase staining fixative to cover cells, and fixing at room temperature for no less than 15min.

(3) The fixative was aspirated and washed 3 times with PBS for 5min each.

(4) Adding a proper amount of dyeing working solution (1 mL is taken as an example of the preparation of the dyeing working solution)

(5) The cells are preferably immersed in the staining solution after incubation overnight at 37 ℃. And (3) injection: incubation at 37℃cannot be performed in a carbon dioxide incubator.

(6) The staining working solution was aspirated and washed 3 times with PBS for 5min each.

(7) The detection solution was added and observed under a normal optical microscope. Cells expressing the enzyme galactosidase which turned blue were readily observed under light microscopy.

At the same time, cell senescence can be further demonstrated by verifying the level of the SASP gene. As shown in FIG. 4, interfering lncRNA JPX was able to reduce the increase in SASP gene levels of IL-6, IL-8, IL-1β, ICAM-1, CCL2, TNF- α, etc., induced by Ras. The IL-6 upstream primer sequences used in this example were: 5'-CTCCAGAACAGATTTGAGAG-3', the downstream primer sequences are: 5'-GGGTCAGGGGTGGTTATTGC-3'; the IL-8 upstream primer sequence was 5'-CTGAGGTGCCAGTGCATTAG-3' and the downstream primer sequence was: 5'-AGCACACCTCTCTTCCATCC-3'; the IL-1 beta upstream primer sequence is 5'-TTGCCAGCCAGTGACACAAT-3', and the downstream primer sequence is: 5'-GAGAAGGTGGTTGTCTGGGAAT-3'; the ICAM-1 upstream primer sequence was 5'-AGGTTGAACCCCACAGTCAC-3' and the downstream primer sequence was: 5'-TCTGAGACCTCTGGCTTCGT-3'; the CCL2 upstream primer sequence is 5'-GATCTCAGTGCAGAGGCTCG-3', and the downstream primer sequence is: 5'-TCTGGGGAAAGCTAGGGGAA-3'; the TNF- α upstream primer sequence was 5'-TAACAAGCCGGTAGCCCACG-3' and the downstream primer sequence was: 5'-TCTTGATGGCAGACAGGATG-3'.

Example 2 mouse model test

To further verify the role of lncRNA JPX in aging-induced AS, this example constructed knockout mice that specifically interfere with lncRNA JPX. Antisense LNA GapmeRs, which is an antisense oligonucleotide capable of inhibiting functions of mRNA and lncRNA with high efficiency, is generally 14-16 nucleotides long, is completely phosphorothioated, can enter cells through mediation of cell membrane surface receptors to play a role, and specifically interferes with lncRNA. Selecting Apoe of 8 weeks of age ^-/- Male mice were randomly divided into a control group and a lncRNA JPX knockout group (construction method reference: A Smooth Muscle Cell-Enriched Long Noncoding RNA Regulates Cell Plasticity and Atherosclerosis by Interacting With Serum Response Factor), and the control group and the lncRNA JPX knockout group mice were given intravenous injection twice weekly of 10mg/kg of each mouse (sequence 5'-CCTTCCCTGAAGGTTCCTCC-3') or lncRNA JPX gapmeRs (sequence 5'-TTCTTGTCATTGCTCCCTTC-3'), and fed with a high-fat diet for 16 weeks to construct an AS mouse model. Subsequently, the mouse vascular tissue was harvested, and a mouse AS-related vascular disease model was constructed by the above.

Meanwhile, the vascular tissues of the mice were harvested and subjected to RT-qPCR assay, and the results of the assay are shown in fig. 5, which shows that lncRNA JPX was significantly activated after the mice were given a High Fat Diet (HFD).

The experimental procedure of RNA extraction from mouse tissue:

(1) After removing the tissue from the liquid nitrogen, it was quickly taken to an ultra clean bench, placed in a small dish, and Trizol reagent was added, (100 mg of tissue was put into 1.2mL of Trizol reagent), and the mixture was ground by syringe, taking care of the skill, and quickly ground.

(2) Centrifuge at 4℃for 5min at 12000rpm, discard the pellet. (ultra clean bench ready EP tube, after centrifugation, the supernatant was aspirated into the prepared EP tube)

(3) Chloroform was added to 200. Mu.L chloroform/mL Trizol, vigorously shaken for 15s (shaking by hand) and incubated at 15-30℃for 2-3min. And (3) injection: the vortex is disabled to avoid disruption of genomic DNA. (chloroform, also known as chloroform, is typically stored in a refrigerator at 4 ℃).

(4) Centrifuge at 4℃for 15min at 12000 rpm. The upper aqueous phase was aspirated into another centrifuge tube. And (3) injection: the water phase is carefully sucked, the middle interface is not sucked in tens of millions, and a small gun head can be adopted for sucking a plurality of times. If DNA and protein are extracted at the same time, the lower organic phase is preserved and stored in a refrigerator at 4 ℃ for standby, otherwise, the lower organic phase is discarded.

(5) Isopropanol was added in a ratio of 500. Mu.L isopropanol/mL Trizol, and incubated with shaking by hand at 15-30deg.C (room temperature) for 10min.

(6) Centrifuging at 2-8deg.C for 10min at 12000g, removing supernatant, and precipitating RNA at the bottom of the tube.

(7) 75% ethanol was added to 1mL of 75% ethanol/mL Trizol, mixed with vortexes, and suspended for precipitation. (Note: 75% ethanol in DEPC Water)

(8) Centrifuging at 4deg.C for 5min at 7500 r, discarding supernatant (after using power supply of centrifugal mechanism, opening the cover of centrifugal machine for 30min, cooling, and covering), air drying at room temperature or vacuum drying for 5-10min. ( And (3) injection: the RNA cannot be dried by centrifugation, and the RNA sample is not too dry or difficult to dissolve. )

(9) Adding DEPC water to dissolve RNA;

(10) The NanoDrop is used for measuring the concentration of RNA, and the RNA is stored in a refrigerator at the temperature of minus 80 ℃ for standby.

The reverse transcription experiment steps are as follows:

(1) Using

II 1st Strand cDNA Synthesis Kit reverse transcription was carried out in a total reaction volume of 20. Mu.L, and the specific composition was as follows:

RNase free ddH ₂ O To 20μL

Total RNA 1μg

II Buffer plus 4μL

(2) After mixing evenly, reverse transcription is carried out by a PCR instrument:

25℃ 5min

42℃ 30min

85℃ 5min

(3) After the end of reverse transcription, the cDNA was quenched with DEPC water at 1:3 or 1:4, diluting in proportion, and storing at-80 ℃ for standby.

The Real-time PCR experiment steps are as follows:

(1) This experiment is carried out

qPCR SYBR Green Master Mix the target gene is detected relatively quantitatively, and the PCR reaction system is as follows:

cDNA template 1. Mu.L

qPCR SYBR Green Master Mix 5μL

Upstream primer, 1. Mu.M 1. Mu.L

Downstream primer, 1. Mu.M 1. Mu.L

2 mu L of ultrapure water

(2) Grouping, calculating a system (finally adding cDNA);

(3) Sealing the membrane, centrifuging the 384-hole plate, and then placing the membrane into a fluorescent quantitative PCR instrument;

(4) The reaction was performed on a Bio-Rad 480 type I quantitative PCR instrument.

And the aortic blood vessels of the mice were harvested, and plaque size was detected by oil red O staining, and the detection picture is shown in fig. 6. Apoe ^-/- Blood vessel red plaque is obviously increased after HFD is given, and the plaque area can be obviously reduced by knocking out lncRNA JPX.

The aortic root vascular oil red O staining procedure is as follows:

(1) After aortic tree separation, the aortic tree was placed in a clean six-well plate and fixed with 4% paraformaldehyde.

(2) The aorta fixed by paraformaldehyde is taken by micro forceps and put into a new six-hole plate, and rinsed by three distilled water for about 10min.

(3) Three distilled water in the six-hole plate was sucked off by a pipette, 60% isopropyl alcohol solution was added, and the mixture was treated for 2 minutes.

(4) The isopropanol in the six-hole plate is sucked by a pipetting gun, the oil red O dye liquor filtered in advance is added, and the mixture is placed on a horizontal shaking table for dyeing for 1h.

(5) The oil red O dye solution in the six-hole plate is sucked by a pipette, and is rinsed for 1min by adding 60% isopropanol solution, and the steps are repeated for 3 times until the vascular background is not red.

(6) Residual vessel outer wall fat was carefully removed under a microscope with micro-scissors.

(7) And finally, tiling the dyed aortic tree on a black dissecting wax plate, and photographing.

Meanwhile, collecting mouse vascular tissue proteins, and detecting senescence markers such as P16, P21, P53 and the like by using Western Blot. As shown in fig. 7, it can be seen that after HFD administration, the aging markers such as P16, P21, and P53 were significantly activated in the mice of the control group; in contrast, P16, P21 and P53 protein expression levels were significantly reduced after HFD administration in the JPX gapmRs mice.

Further performing vascular immunofluorescence assay, extracting aortic tissue of different groups of mice after 16 weeks of high-fat feeding, embedding with frozen section embedding medium (optimal cutting temperature compound, OCT), and performing immunofluorescence assay for P21 and alpha-SMA expression after frozen section, as shown in FIG. 8, wherein red is substitutedTable P21, green for alpha-SMA, blue for nucleus, white arrow shows red and green co-localized yellow region. It can be seen that Apoe ^-/- After HFD administration, vascular endothelial P21 expression was significantly increased, and co-localization of P21 with α -SMA was yellow; whereas, upon HFD administration in the dppx gapmeRs mice, vascular smooth muscle P21 expression decreased, while co-localization of P21 with α -SMA decreased significantly in yellow.

Different groups of mouse aortic tissues were extracted, RT-qPCR experiments were performed, and SASP gene levels were detected to further demonstrate the effect of lncRNA JPX on senescence and AS. FIG. 9 shows that the levels of SASP genes such as IL-6, IL-8, IL-1β, ICAM-1, CCL2, TNF- α were significantly increased after HFD administration in control mice; in contrast, the increase in SASP gene levels such as IL-6, IL-8, IL-1β, ICAM-1, CCL2, TNF- α, etc. can be reversed in the case of HFD administration in the JPX gapmeRs mice.

As can be seen from the above examples: in the atherosclerosis patients caused by aging and atherosclerosis related cells and animal models, the lncRNA JPX is inhibited or knocked out, so that the aging can be inhibited, and the process of atherosclerosis can be delayed. Therefore, the substances inhibiting or knocking out the lncRNA JCX can be used for preparing medicaments for treating cardiovascular diseases caused by aging, especially medicaments for treating atherosclerosis caused by aging, and the lncRNA JCX can also be used as targets for screening medicaments for treating cardiovascular diseases caused by aging, especially medicaments for screening medicaments for treating atherosclerosis caused by aging.

The above examples are provided for illustrating the technical concept and features of the present invention and are intended to enable those skilled in the art to understand the contents of the present invention and to implement the same, and are not intended to limit the scope of the present invention. All equivalent changes or modifications made according to the spirit of the present invention should be included in the scope of the present invention.

Claims (10)

1. The application of the substances for knocking down or inhibiting lncRNA (ribonucleic acid) JPX in preparing medicaments for preventing and treating cardiovascular diseases caused by aging.

2. The use of claim 1, wherein the substance that knocks down or inhibits lncRNA JPX includes, but is not limited to, a small interfering RNA that knocks down lncRNA JPX or a gene editing system that knocks out lncRNA JPX.

3. The use according to claim 1, wherein the sequence of the small interfering RNA knocked down lncRNA dppx is shown in SEQ ID No.1 and SEQ ID No. 2.

4. The use according to any one of claims 1 to 3, wherein the medicament for preventing and treating cardiovascular diseases caused by aging includes, but is not limited to, medicaments for preventing and treating atherosclerosis.

Application of lncRNA JPX as target in screening medicaments for preventing and treating cardiovascular diseases caused by aging.

6. A method for screening a drug for preventing and treating cardiovascular diseases caused by aging is characterized in that a candidate drug is given to Ras-induced aging HVSMCs, and the expression quantity of lncRNA JPX is detected, if the lncRNA JPX is inhibited, the candidate drug has in vitro activity for preventing and treating cardiovascular diseases caused by aging; or the candidate drug is given to an animal model of the cardiovascular disease caused by aging, the expression quantity of the lncRNA JPX is detected, and if the lncRNA JPX is inhibited, the candidate drug has the in vivo activity of preventing and treating the cardiovascular disease caused by aging.

Application of lncRNA (ribonucleic acid) JPX as detection target in preparing auxiliary detection reagent for atherosclerosis caused by aging.

8. Application of substances for detecting lncRNA (ribonucleic acid) JPX in preparing auxiliary detection reagents for atherosclerosis caused by aging.

9. The use according to claim 8, wherein the substance for detecting lncRNA JPX is a substance for quantitatively detecting lncRNA JPX.

10. The use according to claim 8, wherein the substance for quantitatively detecting lncRNA JPX is a specific primer pair of lncRNA JPX.

Images