CN107050469A - The purposes of people's NCAPH genes - Google Patents
The purposes of people's NCAPH genes Download PDFInfo
- Publication number
- CN107050469A CN107050469A CN201710034315.1A CN201710034315A CN107050469A CN 107050469 A CN107050469 A CN 107050469A CN 201710034315 A CN201710034315 A CN 201710034315A CN 107050469 A CN107050469 A CN 107050469A
- Authority
- CN
- China
- Prior art keywords
- ncaph
- cell
- genes
- colon cancer
- people
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is applied to prepare treatment colon cancer drug as the action target spot for cancer cell the invention discloses purposes of the people NCAPH genes in treatment colon cancer drug is prepared, i.e. people NCAPH genes, the action target spot for cancer cell is RNA interference effect targets;Compared with Normal Colon cell, the high expression in colon cancer cell of NCAPH genes, slow virus is disturbed for the RNA that NCAPH genes are designed, suppress NCAPH expression, the propagation of colon cancer cell can be significantly inhibited, tumour cell division is arrested in the G2/M phases, the apoptosis for promoting cell, the migration for suppressing cell, the formation of suppression nude mice model tumour, and then the purpose for the treatment of colon cancer can be reached, show people NCAPH genes can as treatment of colon cancer target spot, provide wide prospect for the exploitation of the treatment of colon cancer medicine based on NCAPH genes in the future.
Description
Technical field
The present invention relates to a kind of new application of gene, the especially new application of people NCAPH genes.
Background technology
Colon cancer is one of malignant tumour main in the world, wherein annual about 1,200,000 new cases and 600,000
People is dead, and the prognosis of colorectal cancer patients makes moderate progress during the past few decades, its attack and transfer be in clinical treatment most
It is the most common reason of Endodontic failure one of the problem of big, is related to tumor cell invasion, extracellular matrix degradation, epithelium-fill
Cell plastid conversion and angiogenesis etc..Lymphatic metastasis is main branch mode, determines colon tumor by stages, auxiliary treatment plan
And prognostic evaluation etc.;Multiple genes and/or the accumulation mutation regulation of many signal paths can induce colon cancer.
Contacted between chromosome instability and tumour in the presence of certain, there is two kinds of gene in human tumor cell
Group unstability, a kind of is the genetic instability of nucleotide level caused by mispairing is repaired, i.e. gene mutation.It is another be
The genetic instability that Chromosome level is produced, referred to as chromosome instability, during chromosome instability is human entity knurl
One of common phenomenon, plays the role of important in tumour develops.Condensins(Condensins)It is that polyprotein is answered
Compound, is closely related with the dynamic change of chromosome structure cell cycle, they participate in mitotic chromosomes collection contracting and
Separation.The processes such as dosage compensation effect, Genetic Recombination and the DNA reparations of sex chromosome, rise emphatically in tumour develops
The effect wanted.
NCAPH genes are the H subunits (complex of non-SMC condensin 1 of non-SMC condensins composite I
Subunit H), it is one of member of Ba Er protein families, is the regulation subunit of condensins compound, turns in interphase chromosome
Played an important role during the chromosome for becoming concentration.Up to the present, the report also without NCAPH in colon cancer.
RNA interference phenomenons are a conservative defense mechanisms during the intracellular biological evolution independently produced, it has also become a kind of
The powerful instrument of mammalian gene products function is studied by suppressing the expression of target gene.
The content of the invention
It is an object of the invention to provide the new application of people's NCAPH genes, i.e., people NCAPH genes are as thin for colon cancer
The action target spot of born of the same parents is applied to prepare treatment colon cancer drug, and the action target spot for colon cancer cell is that RNA interference is made
Use target.
The RNA interference effects target spot is selected from following nucleotide sequence:
SEQ ID NO:1 ︰ TCAGAGATTCTTAAACAGAAA;
SEQ ID NO:2 ︰ TCTCCTAAATTGATCTGTTAT.
The shRNA sequences for suppressing people's NCAPH gene expressions are cloned into after slow virus carrier and obtain RNA interference slow virus,
For preparing colon cancer gene therapeutic drug;The sequence for expressing shRNA targets the anti-of people's NCAPH gene codes DNA including two
It is middle to be separated by a stem ring sequence to repetitive sequence;Wherein, two inverted repeats are the shRNA of people's NCAPH genes respectively
Target sequence and its complementary series;The shRNA target spots nucleotide sequence of the people NCAPH genes is selected from following nucleotide sequence:
SEQ ID NO:1 ︰ TCAGAGATTCTTAAACAGAAA;
SEQ ID NO:2 ︰ TCTCCTAAATTGATCTGTTAT.
The sense strand sequence such as SEQ ID NO of the sequence of the expression shRNA:Shown in 3, antisense strand sequence such as SEQ
ID NO:Shown in 4;Or sense strand sequence such as SEQ ID NO:With antisense strand sequence such as SEQ ID NO shown in 5:Shown in 6.
Forward oligo: NCAPH FO1(SEQ ID NO:3)
CCGGTCAGAGATTCTTAAACAGAAACTCGAGTTTCTGTTTAAGAATCTCTGATTTTTG;
Reverse oligo: NCAPH RO1(SEQ ID NO:4)
AATTCAAAAATCAGAGATTCTTAAACAGAAACTCGAGTTTCTGTTTAAGAATCTCTGA;
Or
Forward oligo: NCAPH FO2(SEQ ID NO:5)
CCGGTCTCCTAAATTGATCTGTTATCTCGAGATAACAGATCAATTTAGGAGATTTTTG;
Reverse oligo: NCAPH RO2(SEQ ID NO:6)
AATTCAAAAATCTCCTAAATTGATCTGTTATCTCGAGATAACAGATCAATTTAGGAGA;
NCAPH genes are the H subunits (complex of non-SMC condensin 1 of non-SMC condensins composite I
Subunit H), it is one of member of Ba Er protein families, is the regulation subunit of condensins compound, turns in interphase chromosome
Played an important role during the chromosome for becoming concentration, our laboratories to its colon cancer generation it is developing act on into
Go parsing, detected by real-time PCR, it has been found that compared with control group normal colon epithelial cells, NCAPH's
Expression of the rna level in colon carcinoma cell line is substantially increased, and uses protein immunoblot(WB)Method detection find NCAPH
Protein level is high compared with normal epithelium cell in colon cancer.By the detection to clinical tissue sample, it was also found that NCAPH is in colon
It is in high expression trend in cancer patient, thus speculates, NCAPH plays an important role in colon cancer develops;Therefore, we
By ncbi database, the NCAPH of people sequence is found, the nucleotide sequence of people's NCAPH genes is shown in that gene is stepped in genebank
Record number is shown in 90-2315 in NM_015341.
The present invention substantially compares normal human colonic's epithelial cell based on NCAPH genes expression quantity in colon cancer cell
(HCoEpiC) it is high, and there is the discovery that many NCAPH are mutated in colorectal cancer patients, by the expression for reducing NCAPH
Colon Cancer Cells can be suppressed, migrate in vitro and internal xenograft tumours formed, show that people NCAPH genes can be made
For the target spot for the treatment of of cancer;Slow virus is disturbed for the RNA that people NCAPH genes are designed, NCAPH tables are reduced in cancer cell
Reach, can substantially suppress the propagation of colon cancer cell, make cell block in the G2/M phases, promote the apoptosis of cell, suppress moving for cell
Move, suppress the formation of xenograft tumours, and then the purpose for the treatment of colon cancer can be reached, while to be based on NCAPH genes in the future
Treatment of colon cancer medicine exploitation provide may, the present invention have larger application value and prospect.
Brief description of the drawings
Fig. 1 is mRNA expression of results schematic diagrames of the NCAPH in different colon cell lines;
Fig. 2 is the expression of results schematic diagram of NCAPH NCAPH albumen in different colon cell lines;
Fig. 3 is immunohistochemical experiment coloration result and colon tumor tissue chip (TMA) detects 90 pairs of colon cancers and adjacent
NCAPH expression result in normal or non-cancer tissue, wherein A figures multiplication factor 10 × lower NCAPH is in the normal tissue
Low expression;A ' figures multiplication factor 40 × lower NCAPH low expressions in the normal tissue;B figures multiplication factor 10 × lower NCAPH is in knot
High expression in phleboedesis tumor tissue;B ' figures multiplication factor 40 × lower NCAPH high expression in colon tumor tissue;C figures IHC quantifies number
According to(ACCT:Neighbouring colon tumor tissue -- non-cancerous normal colonic tissue, CCT:Colon tumor tissue);
Fig. 4 is to pass through real-time PCR(A schemes)NCAPH shRNA, which are demonstrated, with NCAPH, GAPDH antibody immunoblotting strikes poorly efficient
Rate(B schemes), wherein a-NCAPH is NCAPH antibody, and a-GAPDH is GAPDH antibody;
Fig. 5 is expressed to suppress NCAPH, is suppressed cell proliferation experiment result;A figures, which are that HCT116 is stable, strikes drop cell line, and B figures are
SW480 is stable to strike drop cell line;
Fig. 6 is BrdU loading test results, wherein A figures be in BrdU binding tests NCAPH strike it is low after, DNA synthesis is in HCT116
Result is suppressed in cell;B figures are HCT116 cell quantification results;C figures are the quantitative result of SW480 cells;*p<0.05,
**p<0.01, t-test;
Fig. 7 is cell cycle test experience result;A figures are cell flow cytometer showed testing result, and B figures are quantitative analysis.***p<
0.001, t-test;
Fig. 8 is Apoptosis test experience result;A figures are Apoptosis dyeing and flow cytomery;B figures are quantitative analysis
As a result, * p<0.05, **p<0.01, t-test;
Fig. 9 is Cell migration assay result;A figures are that different shRNAs strike low NCAPH cell migration results;B figures are quantitative point
Analyse result, * * * p<0.001, t-test;
Figure 10 is tumor formation in nude mice result;The HCT116 that A figures are stable expression Ctr or NCAPH shRNAs is transplanted to naked
The growing state of 7 weeks tumours after in mouse body;B figures are that NCAPH strikes and low significantly reduces male NOD SCID mouse subcutaneous transplantings
Knurl growth result, * * * p<0.001, t-test;C figures are that NCAPH strikes the low weight knot for significantly inhibiting xenograft tumours
Really, * * * p<0.001, t-test;
Ctr shRNA are the strain of scramble shRNA control cells in above-mentioned figure;NCAPH sh#1 are strike low shRNA #1 steady
Turn cell line;NCAPH sh #2 are the stable cell strain for striking low shRNA #2.
Embodiment
The essentiality content of the present invention is further illustrated below by embodiment, but present disclosure is not limited to
This, method is conventional method unless otherwise specified in the present embodiment, and agents useful for same sells examination unless otherwise specified, when being routine
Agent or the reagent prepared according to a conventional method.
Embodiment 1:Expressions of the RT-PCR experiment detections NCAPH in colon carcinoma cell line
1st, cell total rna is extracted
(1)When normal colon epithelial cells and Growth of Colon Cancer Cells are to 80% coverage, remove supernatant, PBS removes serum, plus
Enter 1mL TRizol, horizontal positioned 5 minutes, it is ensured that TRizol is uniformly distributed in cell surface and cell lysis, blow and beat cell, make
Cell is come off from culture dish, and all liq is transferred in centrifuge tube, and piping and druming is until heavy without obvious bulk in lysate repeatedly
Form sediment;It is stored at room temperature 5min;
(2)5min is centrifuged with 12,000g in 4 DEG C of centrifuges, supernatant is transferred in new 1.5mL centrifuge tubes;
(3)200 μ L chloroforms are added, the vibration of whirlpool instrument centrifuges 15min, hereafter liquid is divided into 4 DEG C of centrifuges with 12,000g
Three layers;
(4)Draw upper strata aqueous phase(It is careful not to encounter the protein layer of centre), it is transferred to new RNAase free centrifuge tube
In;
(5)Isometric isopropanol is added, gently turns upside down 5 times, is stored at room temperature 10min;
(6), now there is white precipitate in 12,000rpm rotating speeds, 4 DEG C of centrifugation 10min;
(7)Supernatant is abandoned, 75% ethanol that 1mL is handled through DEPC is added, turn upside down washing precipitation for several times;7500g is centrifuged 5 minutes,
Abandon supernatant and retain precipitation;
(8)RNA dries 10min at room temperature, then adds the water dissolving of no RNase;
(9)OD values are measured, to determine RNA concentration and quality, -80 DEG C of preservations are subsequently placed in.
2nd, reverse transcription reaction(Reverse Transcription, RT)
The RNA of said extracted takes 1 μ g to carry out reverse transcription with TAKARA kit.It is specific as follows:Genomic DNA reaction is removed by such as
Then lower composition is dispensed into each reaction tube in preparing reaction mixture on ice, is eventually adding RNA sample again;It is soft to mix,
According to 42 DEG C of 2 min(Or the min of room temperature 5)Reacted.
;
Sample is placed on ice after reaction, and according to the form below prepares mixing Mix, and 10 μ L are then dispensed again to each reaction tube:
Reverse transcription reaction is carried out immediately after soft mixing:37 DEG C of 15 min, 85 DEG C of 5s, 4 DEG C.
3、 qPCR
Each sample sets three repeating holes, is prepared by following component:
,
Above component is mixed, is added to after each hole of 96 orifice plates, sealer, centrifugation makes liquid accumulation to ttom of pipe.Entered according to following condition
Performing PCR reacts, and thermal circulation parameters are as follows:50 DEG C, 2 min;95 DEG C, 2 min;95 DEG C, 10 min;95 DEG C, 15 s, 60 DEG C 1
Min, 40X.
The primer is as follows:NCAPH_F: ACCTCAAACCAGGCACCA; NCAPH_R:
TCTTCATAATGCTCAGTCTCTACCC;GAPDH_F: ACCACAGTCCATGCCATCAC;GAPDH_R:
Wherein, GAPDH is used as internal reference to TCCACCACCCTGTTGCTGTA.
As a result the expression quantity of NCAPH mRNA in the different colon cell lines of Fig. 1, normal human colonic's epithelial cell are seen
And the carcinous cell line of colorectal cancer (HCoEpiC)(Colon cancer LoVo, SW480, SW620, HCT116), HCoEpiC is used as control;
Experimental result shows that compared with normal colon epithelial cells NCAPH mRNA expression is substantially raised in colon cancer cell.
Embodiment 2:Protein immunoblot detects NCAPH protein expression situations
1、WB(Western Blotting)Detection
The extraction of 1.1 total protein of cell
Cell after being handled according to particular experiment, supernatant discarding culture medium is washed 1 time with PBS;Added according to the amount of cell precipitation
Corresponding cell pyrolysis liquid, multigelation is cracked 3 times, and during which blow off is not beaten;4 DEG C, 12000 rpm, 10 min of centrifugation, take supernatant
Abandoning precipitation is used for subsequent experimental.
1.2 protein concentrations are detected and denaturation treatment
Protein concentration detection kit is green skies BCA determination of protein concentration kit (enhanced), article No.:P0010S.Method
It is as follows:
Standard items are added in the standard sample wells of 96 orifice plates by 0,1,2,4,8,12,16,20 μ L, plus standard dilutions are supplied
To 20 μ L so that standard concentration is respectively 0,0.025,0.05,0.1,0.2,0.3,0.4,0.5 mg/mL;Plus proper volume
Sample is into the sample well of 96 orifice plates;Each hole adds 200 μ LBCA working solutions, 37 DEG C of placement 20min;A562 is determined with ELIASA
The absorbance of wavelength;The protein concentration of sample is calculated according to standard curve and the sample volume used.
Appropriate protein sample is taken, 5 × sample-loading buffer is added, is placed in 100 DEG C of xeothermic instrument of metal and boils 10 min;Take
Cooled down after going out, packing, -80 DEG C preserve or directly carry out SDS-PAGE (polyacrylamide gel) electrophoresis.
1.3 SDS- polyacrylamide gel electrophoresises
(1)Clean electrophoresis and prepare gel glass plate, drying is fixed on on glue shelf;As required, 8%-12% is prepared different
The separation gel of concentration, adds concentration glue by formula after glue fully solidifies, inserts sample cell comb;After gelling is solid, glue is taken out,
Extract comb, distilled water cleaning surface glue;Glass plate and gel are together fixed on electrophoresis frame, the Tris- glycine of addition
Electrophoretic buffer, makes electrophoretic buffer in the cm of short glass plate about 0.5;Protein content 30-50 μ g are added per hole, first
Electrophoresis runs through concentration glue under 80V voltages, then uses 120V electrophoresis;Transferring film frame is placed in transferring film liquid, black plastic plate face to
Under, white is put above black side and puts two filter paper above one block of foam-rubber cushion, foam-rubber cushion upper;Gently gel from electrophoresis glass
It is put into after being taken off in glass plate on filter paper, PVDF films is put into above gel, then put two filter paper, one piece of sea is put in filter paper top
Silk floss pad, two pieces of plastic plate fixations of black and white, is put into pre-cooled transferring film buffer solution;Under condition of ice bath, 83 V voltages
The h of transferring film 3;Pvdf membrane is put into the TBST containing 5% skimmed milk power, slowly shaken on shaking table, room temperature closing 2h;Add
With the primary antibody of the TBST dilutions containing 5% skimmed milk power, it is incubated overnight in 4 DEG C of slow shakes;TBST washes film 10min × 3 time;Plus
Enter the secondary antibody of HRP marks(Anti- mouse: 1:20000, anti-rabbit 1:2000 dilutions), it is incubated at room temperature 1h;TBST washes film 10
Min × 3 time;In PVDF film transfers to luminescent screen, ECL reagents are added under the conditions of lucifuge(With preceding A, B liquid carries out equivalent
Mixing), it is developed, taken pictures after being fixed.
As a result the expression of Fig. 2 NCAPH albumen in different colon cell lines is seen;Cell lysate detects NCAPH respectively
With GAPDH expression, GAPDH is used as control;Experimental result is shown compared with normal colon epithelial cells, in colon cancer cell
The expression of NCAPH albumen is substantially raised.
Embodiment 3:Clinical trial
1st, immunohistochemical experiment
Colorectal Carcinoma chip surmounts biological Co., Ltd (Cat No. HRec-Ade180Sur-05) from Shanghai and obtained, will
90 clinical samples are placed in 80 DEG C of roasting pieces 2 hours, xylene soak dewaxing, gradient alcohol dehydration, are immersed in 0.3% hydrogen peroxide
(First alcohol and water is prepared)Solution is rinsed for 15 minutes with removing tissue peroxidase with Tris buffer saline (TBS),
20 minutes antigen retrievals of micro-wave oven 95 DEG C, room temperature is recovered 1 hour.Then TBS is washed three times, and 5% lowlenthal serum is incubated to be gone for 30 minutes
Except non-specific binding, primary antibody anti-NCAPH (Proteintech, 11515-1-AP) is diluted to 1 with confining liquid:200,4
Degree is incubated two hours, and TBS is washed three times, and the secondary antibody (Santa cruz, USA) of HRP marks is incubated 30 minutes;
Diaminobenzidine (DAB) is developed the color, and haematoxylin is further dyed, and is then dehydrated section, and dimethylbenzene is transparent,
Dibutylphthalate xylene (DPX) mounting;Microscope (Olympus, Tokyo, Japan) is taken pictures and analyzed;Adopt
OLFM1 expression is scored with H-scores methods, integrated in terms of tumour expression intensity and the positive expression rate two
Assess.It is divided into according to staining power:It is negative(0), weakly positive(1), moderate positive(2)And strong positive(3)Four grades.According to dye
Color positive cell ratio:It is negative(0), 1-25% (1), 26-50% (2), 51-75% (3), 76-100% (4).Judge every
The final index of individual specimen staining is intensity × positive rate.Scoring < 8 is set to NCAPH low expression groups, and >=8 are set to the high tables of NCAPH
Up to group, as a result see Fig. 3 A, A ', B, B ', C figure.
Table 1, the clinic and case feature of 90 patients
。
Embodiment 4:Plasmid construction and the foundation for surely turning cell line
Two shRNA target spots for being used to independently strike low expression are designed for people NCAPH, are respectively
TCAGAGATTCTTAAACAGAAA(shRNA #1)Or TCTCCTAAATTGATCTGTTAT(shRNA #2);Compare shRNA
For Scramble shRNA:GCACTACCAGAGCTAACTCA.
Synthesize after Oligo sequences, be diluted to 20 μM of concentration;Oligo sequences are as follows:
Forward oligo(Positive-sense strand): NCAPH FO1
CCGGTCAGAGATTCTTAAACAGAAACTCGAGTTTCTGTTTAAGAATCTCTGATTTTTG;
Reverse oligo(Antisense strand): NCAPH RO1
AATTCAAAAATCAGAGATTCTTAAACAGAAACTCGAGTTTCTGTTTAAGAATCTCTGA;
Or
Forward oligo(Positive-sense strand): NCAPH FO2
CCGGTCTCCTAAATTGATCTGTTATCTCGAGATAACAGATCAATTTAGGAGATTTTTG;
Reverse oligo(Antisense strand): NCAPH RO2
AATTCAAAAATCTCCTAAATTGATCTGTTATCTCGAGATAACAGATCAATTTAGGAGA;
Reacted according to following conditions:5 μL Forward oligo、5μLReverse oligo、5μL10×NEB
buffer、35μLddH2O;Boiling water bath 4 minutes in water-bath, slow cooling to room temperature;With EcoR I and the digestion pLKO.1 of Age I,
Electrophoresis simultaneously reclaims carrier segments;The carrier segments that Oligo reaction mixtures are reclaimed with digestion are taken under the catalysis of T4 ligases, 16
DEG C connection is stayed overnight;Take connection product to carry out heat-shock transformed into Stbl 3, be coated on the LB flat boards containing ampicillin, 37
DEG C be inverted overnight incubation;Picking monoclonal is in containing ampicillin liquid LB, 37 DEG C of h of shaken cultivation 18, extracts plasmid and enters
Row digestion is identified(EcoR I and Nco I), sequence verification is carried out to positive colony;The positive purpose plasmid of amplification.
Purpose plasmid is imported by HEK-293T by calcium phosphate transfection method and carries out viral preparation:Prepare transfection liquid:A liquid:
ddH2O 420μL、Cacl2(2 mol/L) 60μL、psPAX2 7.5 μg、pMD2.G 5μg、pLKO.1-shRNA 12.5μg;B
Liquid:2×HEPES 500μL.After fully mixing, A liquid is added dropwise in B liquid, vibration is mixed, reacts at room temperature 30 min, drop
Add in the HEK-293T that coverage rate is 70% or so, 5% CO2, cultivate in 37 DEG C of incubators;8h carries out changing liquid, 48 after transfection
Virus is received after h and 72 h, vial supernatant is obtained with 0.45 μM of membrane filtration;Fresh virus liquid is infected into aim cell
(HCT116、SW480), efficiency of infection is promoted with 4 μ g/mL polybrene;Infect after 72 h, with the puromycin of respective concentration
Screen positive cell, at least three times;What is expanded and identify target gene strikes poor efficiency, and obtained stable cell strain is through reai-
Found after time PCR identifications, NCAPH mRNA and protein level successfully strike low(See A, B in Fig. 4).
Embodiment 5:Cell growth inhibition assay
1st, to determine ability of cell proliferation, the stabilization for phase growth of taking the logarithm strikes drop cell line, into unicellular after pancreatin digestion, terminates
Cell suspension is made in digestion, carries out concentration mensuration;According to required cell number(SW480: 2.5×104/ hole, HCT116: 3×
104/ hole), corresponding cell suspension kind is prepared into 12 orifice plates with complete medium(1.5 mL/ holes), 37 DEG C, 5% CO2Culture 6
My god;Counted daily:Supernatant is abandoned, the digestion of 500 μ L pancreatin is counted;Cell number is calculated according to concentration respectively, growth is drawn
Curve.
Test result indicates that when NCAPH strikes low, the propagation of cell is inhibited(Fig. 5 A, B).
2nd, BrdU loading tests, are to replace thymidine to mix DNA by 10 μM of BrdU, utilize BrdU antibody test
The ratio of BrdU incorporations verifies the multiplication capacity of cell;
When HCT116 stabilizations strike drop cell growth to 80% coverage, remove supernatant, PBS removes serum, the mL of 0.25% pancreatin 1
Digestion 3 minutes, then adds the termination of 5 mL culture mediums, blows and beats into single cell suspension, counted with Countstar cell counters
Number, according to every μ L 8 × 10 of hole 5004Cell total amount, plant in 8 orifice plates, be placed in 37 DEG C, 5% CO2In CO2gas incubator
Overnight, after 24 hours, 10 μM of BrdU are added(Final concentration)It is incubated, is taken out after 20 min from incubator in incubator, goes training
Base is supported, PBS is rinsed once.Plus the paraformaldehydes of 200 μ L 4%(PFA)Fixed, after 20 minutes, PBS is washed once, adds 200 μ L2N
HCL-0.5%TrionX-100, incubation at room temperature adds 1M NaHCO after 30 minutes3Rinse once, is then discarded, and adds 200 μ
The tweens of LPBS+0.1% are rinsed twice, and 200 μ L10% Normal Goat Serums are added after removing residual liquid(NDS, uses PBS+0.1%
Polysorbas20 dilutes), room temperature shaker 1 hour, by BrdU primary antibodies PBS+0.1% polysorbas20s+NDS (final concentration 5%) dilution (antibody
Concentration is 1 according to antibody specification:500) 200 μ L, are added per hole, 4 degree of overnight incubations add 200 μ LPBS+0.1% per hole and told
Temperature 20 is washed three times, and 10 minutes every time, then with primary antibody diluted secondary antibody CY3-goat anti mouse, (kind was according to one
It is anti-), according to 1:500 ratio, and DAPI is according to 1:200 ratio is added together, room temperature shaker 2 hours, and 200 μ are added per hole
LPBS+0.1% polysorbas20s are washed three times, 10 minutes every time, are placed in PBS+NaN3In, 4 degree of preservations, fluorescence microscope is taken pictures simultaneously
Count.
The incorporation that the NCAPH surely turned strikes BrdU in low cell line is substantially reduced compared with control group(See Fig. 6 A, B, C).
Embodiment 6:Cell cycle test experience
1st, preparation of samples
HCT116 is stable when striking drop cell growth to 80% coverage, removes culture medium supernatant, PBS once, 0.25% pancreatin
1mL digests 3 minutes, then adds 5mL culture mediums and terminates, blows and beats into single cell suspension, counted with countstar, according to
Per hole 2mL culture volumes, cell total amount 4 × 105-6×105It is individual, plant in 6 orifice plates, each sample sets three repeating holes,
Gently mix to ensure that cell distribution is uniform, be subsequently placed in 37 DEG C, 5% CO2In CO2gas incubator overnight.After 24 hours,
Culture medium supernatant is removed, plus 2mL serum free mediums carry out starvation, are placed in 37 DEG C, 5% CO2In CO2gas incubator overnight.
Serum free medium is removed, the complete medium containing serum is added and carries out release 6-8 hours;Remove culture medium supernatant, PBS
Once, 0.25% pancreatin 0.5mL digests 3 minutes, then adds 2mL culture mediums and terminates, gently blows and beats into single cell suspension;Receive
Collect cell into centrifuge tube, 1500rpm is centrifuged 5 minutes.Add 5mL PBS to wash once, 1500rpm is centrifuged 5 minutes, repeat one
It is secondary;PBS liquid is removed, cell precipitation is resuspended with 500 μ LPBS, notes soft;75% ethanol of 4.5mL precoolings is added to newly
Centrifuge tube in, mark understand sample ID;The cell suspension being resuspended is added dropwise in 75% ethanol of precooling, noted
The pipe equipped with ethanol is shaken up in time after instillation, and to ensure abundant fixation, sample must be corresponded in addition;Centrifugation lid is covered tightly, on
In 4 DEG C of preservations before machine.
2nd, flow cytometer detection is tested
By sample from 4 DEG C of taking-ups, 1500rpm is centrifuged 5 minutes.Fixer is removed, 5mL PBS cleanings, 1500rpm centrifugations 5 is added
Minute, it is repeated once.500 μ L of often pipe addition contain RNAase(1:500)The μ LPI of PBS+0.1% Trion X-100+10 it is molten
Liquid is dyed.The change of detection cell cycle is carried out after 15-30 minutes using flow cytometer.Data carry out finishing analysis,
Draw cell cycle distribution figure and statistical chart.
Cell cycle experiment shows, NCAPH strike it is low it is steady turn strain, cell block is in the G2/M phases(See Fig. 7).
Embodiment 7:Apoptosis is detected
The stable cell strain of foundation, is inoculated in 6 centimetres of plates by identical density and cultivated, the recombined human that cell is marked with FITC
Annexin V appear in the phosphatidyl serine of cell membrane surface to detect during Apoptosis.Phosphatidyl serine is mainly distributed
On the inside of cell membrane, i.e., side adjacent with cytoplasm.Early stage apoptosis, different types of cell all can be phosphorus
Translated into outside ester acyl serine on the outside of cell surface, i.e. cell membrane.Phosphatidyl serine, which is exposed to after cell surface, can promote blood coagulation
And inflammatory reaction.With the Annexin V, i.e. Annexin V-FITC of the fluorescence probe FITC marks with green fluorescence, so that it may
Withered with this cell that turns up that phosphatidyl serine simply and is directly detected very much with flow cytometer or fluorescence microscope
The key character died.
HCT116 is stable when striking drop cell growth to 80% coverage, removes culture medium supernatant, PBS once, 0.25%
Pancreatin 1mL digests 3 minutes, then adds 5mL culture mediums and terminates, blows and beats into single cell suspension, counted with countstar,
According to every hole 2mL culture volumes, cell total amount 4X105-6X105It is individual, plant in 6 orifice plates, each sample sets three repetitions
Hole, gently mixes to ensure that cell distribution is uniform, is subsequently placed in 37 degree, 5% CO2In CO2gas incubator overnight.24 hours
Afterwards, culture medium supernatant is collected, once, 0.25% pancreatin 0.5mL digests 3 minutes PBS, then adds 2mL culture mediums and terminates,
Single cell suspension is blown and beaten into, soft piping and druming is noted, prevents because of the cellular damage apoptosis that mechanical force is brought.Cell is collected to centrifuge tube
In, 2000rpm is centrifuged 5 minutes, to collect the cell of the apoptosis swum in supernatant.Remove supernatant, add 5mL PBS and wash one
Secondary, 1500rpm is centrifuged 5 minutes, is repeated once.It is first according to Annexin V-FITC/PI cell apoptosis detection kit specifications
Add 1X binding buffer cell is resuspended, take out cell needed for three controls(Negative control, the mono- mark controls of FITC, PI
Single mark control), then often pipe sample adds each 5 μ L of FITC and PI into cell suspension(Control sample is:It is not added with dyestuff, plus 5 μ
LFITC, plus 5 μ LPI), it is soft to mix.37 degree of lucifuges are incubated 15-30 minutes.Utilize flow cytomery Apoptosis ratio
Change.Data carry out finishing analysis, draw Apoptosis distribution map and statistical chart.
Test result indicates that, what NCAPH struck low stable cell strain can promote the apoptosis of cell(Fig. 8).
Embodiment 8:Cell migration assay
Prepare Transwell cells:Take and 500 μ L complete mediums containing serum are firstly added in 24 orifice plates, Transwell
Cell is placed in the hole for adding good serum-containing media.When HCT116 stabilizations strike drop cell growth to 80% coverage, remove culture
Base, PBS removes serum, and 0.25% pancreatin 1mL digests 3 minutes, then adds 5mL culture mediums and terminates, blows and beats into single cell suspension,
Counted with countstar cell counters.Take 8 × 105Cell concentration is centrifuged, and is then cleaned with serum free medium,
Cell precipitation is collected by centrifugation, is repeated once.Serum free medium is removed, is resuspended with 1mL serum free mediums, then takes out 100 μ
L cell suspensions, are added in the ready Transwell cells of the first step.After 48 hours, Transwell cells are taken out, PBS is used
The cotton swab soaked wipes the cell not migrated above cell, is subsequently placed in the Kong Zhonggu for being previously added 600 μ L4%PFA
It is fixed 20 minutes.Fix after terminating, cell is placed in and is previously added the ethanol solution that 600 μ L contain 0.5% crystal violet, film is immersed in
In dyeing liquor, room temperature is dyed 1-2 hours, is taken out, and distilled water is cleaned about 5 times, and natural air drying.It is random to take the visual field of more than 5
Microscope is taken pictures and counted.Take pictures and finish, 500 μ L33% acetic acid is added per hole, shaking table shakes 10min, fully after vibration
Absorbance is determined at 570nm.
Experimental result shows that NCAPH strikes the migration that low energy significantly suppresses cell(Fig. 9).
Embodiment 9:Tumor formation in nude mice
4 week old male BALB/C nude mices are bought in Shanghai Si Laike Experimental Animal Centers(Animal credit number is SYXK (Guangdong)
2010-0102).Nude mice is raised in SPF grades of environment, adapts to 2-3 days.On the day of beating nude mice, HCT116 is stable to strike drop cell growth
To 80% coverage, remove culture medium supernatant, once, 0.25% pancreatin 1mL digests 3 minutes PBS, then adds 5mL cultures
Base is terminated, and is blown and beaten into single cell suspension, is counted with countstar cell counters, be diluted to 2 × 107/ ml density and standard
Standby 1.5mL cell suspensions, are placed on ice.Nude mice is randomly divided into 3 groups, every group 5, the number of finishing.With iodophor disinfection nude mice abdomen hind leg
After the skin of axillary fossa of left and right, single cell suspension NCAPH scramble, the NCAPH shRNA1# and NCAPH that pancreatin has been digested
ShRNA2# is inoculated in each group nude mice armpit subcutaneously respectively, every 100 μ L of inoculation(Containing 2.0 × 106Individual cell).It is inoculated with one week after
Start the ordinary circumstance of every 3 days observation nude mices, and with the maximum diameter of vernier caliper measurement gross tumor volume(L:Knurl is long)Most path
(W:Knurl is wide)And height(H), the approximate volumes of tumour are calculated by formula V=L × W × H/2.Electronic balance weighing knurl weight, draws simultaneously
Growth of transplanted human, body weight and the knurl weight curve of nude mice.Nude mice is put to death at 7 weeks, dissects and completely takes out tumor mass, and take pictures.Take out
- 80 DEG C of transplanting tumor tissue preserve or be placed in 4%PFA 4 and spend night, then put into PBS 4 DEG C of preservations.
The HCT116 cells for having struck NCAPH low can substantially suppress the growth of nude mice in-vivo tumour(Figure 10).
Sequence table
<110>Kunming Institute of Zoology, Chinese Academy of Sciences
<120>The purposes of people's NCAPH genes
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<400> 1
tcagagattc ttaaacagaa a 21
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<400> 2
tctcctaaat tgatctgtta t 21
<210> 3
<211> 58
<212> DNA
<213>Artificial sequence
<400> 3
ccggtcagag attcttaaac agaaactcga gtttctgttt aagaatctct gatttttg 58
<210> 4
<211> 58
<212> DNA
<213>Artificial sequence
<400> 4
aattcaaaaa tcagagattc ttaaacagaa actcgagttt ctgtttaaga atctctga 58
<210> 5
<211> 58
<212> DNA
<213>Artificial sequence
<400> 5
ccggtctcct aaattgatct gttatctcga gataacagat caatttagga gatttttg 58
<210> 6
<211> 58
<212> DNA
<213>Artificial sequence
<400> 6
aattcaaaaa tctcctaaat tgatctgtta tctcgagata acagatcaat ttaggaga 58
<210> 7
<211> 18
<212> DNA
<213>Artificial sequence
<400> 7
acctcaaacc aggcacca 18
<210> 8
<211> 25
<212> DNA
<213>Artificial sequence
<400> 8
tcttcataat gctcagtctc taccc 25
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence
<400> 9
accacagtcc atgccatcac 20
<210> 10
<211> 20
<212> DNA
<213>Artificial sequence
<400> 10
tccaccaccc tgttgctgta 20
Claims (3)
1. application of the people NCAPH genes in the medicine for preparing treatment colon cancer, it is characterised in that:The people NCAPH genes are made
To be applied to prepare treatment colon cancer drug, the effect target for colon cancer cell for the action target spot of colon cancer cell
Point is RNA interference effect targets.
2. application according to claim 1, it is characterised in that:The shRNA sequences clone of people's NCAPH gene expressions will be suppressed
Enter to obtain RNA interference slow virus after slow virus carrier, for preparing colon cancer gene therapeutic drug;Express shRNA sequence
Include two targeting people's NCAPH gene codes DNA inverted repeats, it is middle to be separated by a stem ring sequence;Wherein, two it is anti-
It is the shRNA target sequences and its complementary series of people's NCAPH genes respectively to repetitive sequence;The people NCAPH genes
ShRNA target spots nucleotide sequence is selected from following nucleotide sequence:
SEQ ID NO:1 ︰ TCAGAGATTCTTAAACAGAAA;
SEQ ID NO:2 ︰ TCTCCTAAATTGATCTGTTAT.
3. application according to claim 2, it is characterised in that:Express the sense strand sequence such as SEQ of shRNA sequence
ID NO:Shown in 3, antisense strand sequence such as SEQ ID NO:Shown in 4;Or sense strand sequence such as SEQ ID NO:Shown in 5,
Antisense strand sequence such as SEQ ID NO:Shown in 6.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710034315.1A CN107050469B (en) | 2017-01-18 | 2017-01-18 | The purposes of people's NCAPH gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710034315.1A CN107050469B (en) | 2017-01-18 | 2017-01-18 | The purposes of people's NCAPH gene |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107050469A true CN107050469A (en) | 2017-08-18 |
CN107050469B CN107050469B (en) | 2019-07-30 |
Family
ID=59599291
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710034315.1A Active CN107050469B (en) | 2017-01-18 | 2017-01-18 | The purposes of people's NCAPH gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107050469B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2021107097A1 (en) * | 2019-11-28 | 2021-06-03 | 株式会社ボナック | Nucleic acid molecule for hepatitis b treatment use |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104854247A (en) * | 2012-10-12 | 2015-08-19 | 新加坡科技研究局 | Method of prognosis and stratification of ovarian cancer |
-
2017
- 2017-01-18 CN CN201710034315.1A patent/CN107050469B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104854247A (en) * | 2012-10-12 | 2015-08-19 | 新加坡科技研究局 | Method of prognosis and stratification of ovarian cancer |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2021107097A1 (en) * | 2019-11-28 | 2021-06-03 | 株式会社ボナック | Nucleic acid molecule for hepatitis b treatment use |
Also Published As
Publication number | Publication date |
---|---|
CN107050469B (en) | 2019-07-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109337980A (en) | The purposes of people's YTHDF1 gene | |
CN108486060B (en) | Exosome for treating tumors and preparation method and application thereof | |
CN106591306B (en) | Application of the siRNA of targeting interference tumour PTN-PTPRZ1 access in immunotherapy of tumors | |
CN105039342B (en) | SiRNA and its application of MAT2A gene expressions can be suppressed | |
CN107050469B (en) | The purposes of people's NCAPH gene | |
CN108553478A (en) | A kind of application of septin genes shRNA in preparing septin gene activity inhibitor | |
CN107217071A (en) | A kind of adenovirus of recombinant rat phospholipase C γ 2, construction method and its application | |
CN110496222A (en) | The purposes of people's NCAPH gene | |
CN108245686B (en) | The purposes of people's GRK5 gene | |
CN103468733A (en) | Expression vector resisting porcine circovirus type 2 (PCV2) and transgenic pig, and construction methods thereof | |
CN108465108B (en) | Specific gene target for preventing or treating brain glioma | |
CN114225036B (en) | Application of ATXN1 protein as target in preparation of medicine or kit for treating, preventing or diagnosing medulloblastoma | |
CN113499440B (en) | Application of reagent for down regulating RBMS1 expression in preparation of medicine for treating lung cancer | |
CN110951880B (en) | Application of reagent for detecting lncRNA marker of hypopharynx cancer in preparation of product for diagnosing hypopharynx cancer | |
CN115851940A (en) | Osteosarcoma molecular marker and application thereof | |
CN111575384B (en) | Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor | |
CN107828789A (en) | Application of the inhibitor and its application and KAP1 of targeted therapy of lung cancer as drug targets in the medicine of screening anti-lung cancer | |
CN110129319A (en) | A kind of siRNA of PRALR and application thereof | |
CN114032236A (en) | shRNA of TMEM2 and application thereof | |
CN108949974A (en) | E3 ubiquitin ligase ASB3 is preparing the application in cancer treatment drug | |
CN108283722B (en) | Application of the SPECC1L in treatment liver cancer and/or the postoperative drug for preventing liver cancer recurrence | |
CN104388541B (en) | The purposes of miR 1914* and miR 1915 | |
CN109136225A (en) | A kind of shRNA, slow virus and its construction method and purposes inhibiting yak RXFP2 gene expression | |
CN107753956A (en) | A kind of targeted inhibition agent of RAX2 genes and application thereof | |
CN117643631A (en) | Use of inhibitors of CD151 and/or ITGB1 for the preparation of a formulation for inhibiting Porphyromonas gingivalis infection |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |