CN112370460A - Application of ginsenoside Rb1 in preparation of antidepressant drug - Google Patents

Abstract

The invention discloses application of ginsenoside Rb1 in preparation of antidepressant drugs, and belongs to the field of biological medicines. The invention discovers that the ginsenoside Rb1 can play an antidepressant role by regulating and controlling the synaptic plasticity of the hippocampus through a miR-134 target-mediated BDNF signal pathway for the first time, clarifies a molecular mechanism of the ginsenoside Rb1 for playing the antidepressant role for the first time, and has important significance for clarifying a pathophysiological mechanism of depression and developing antidepressant medicaments.

Description

Application of ginsenoside Rb1 in preparation of antidepressant drug

Technical Field

The invention belongs to the field of biological medicines, and particularly relates to application of ginsenoside Rb1 in preparation of an antidepressant drug.

Background

Depression is a group of mood disorders or affective disorders with depression as a major symptom due to various causes. Due to the problems of addiction, tolerance, various side effects and the like, about 40 to 60 percent of depression patients clinically have no sensitive reaction to first-line drugs (Gerhard DM, Wohleb ES, Duman RS. operating treatment mechanisms for depression: focus on phosphate and 690 synthetic compliance. drug Discov Today,2016,21: 454464.) and cause serious burden to families and society, and how to control the development of the condition of depression patients is a problem to be solved.

The occurrence of depression is influenced by many factors, and different signal pathways, pathophysiology and other processes among the factors can cause the change of synaptic structure and function, damage synaptic plasticity and induce the occurrence of depression (Ledford H. psychopharmacology drugs target of depression. Nature,2016,530(7588): 17). Restoration of synaptic structure and function can play an important role in the treatment and prognosis of depression. Antidepressant effects of classical antidepressants such as Selective 5-hydroxytryptamine (5-HT) reuptake inhibitors (SSRIs) and Tricyclic antidepressants (TCAs) are associated with improved synaptic plasticity (Castren E, Hen R. neural plasticity and anti-depressive actions. trends Neurosci,2013,36(5):259 267). Therefore, synaptic plasticity can be used as an entry point for treating depression, and the research on molecular mechanism of synaptic plasticity provides good idea and support for the elucidation of pathophysiological mechanism of depression and the development of antidepressant drugs.

Brain-derived neurotrophic factor (BDNF) is a key indicator for assessing neural plasticity (Autry AE, Montegria LM. Brain-derived neurotrophic factor and neuropsychiatric disorders. pharmacological Reviews,2012,64(2): 238.). BDNF belongs to a neurotrophic family, is widely distributed in brain tissues, can be massively expressed at or near an active synaptic site to regulate the survival and differentiation of neurons, and is also a main target point of most clinical first-line medicaments, electroconvulsive therapy and the like. Tropomyosin-related kinase B (TrkB) is a functional receptor for BDNF, is widely distributed on presynaptic and postsynaptic membranes, and is activated by BDNF to regulate neurotransmitter release and post-synaptic responses. BDNF, via TrkB, may initiate at least two intracellular signal transduction pathways that play key roles in regulating synaptic structure remodeling and enhancing synaptic transmission efficacy, such as Mitogen-activated Protein kinase (MAPK)/Extracellular regulatory Protein kinase (ERK) and Phosphatidylinositol 3-kinase (phophatidylinositol 3-kinase, PI 3K)/Protein kinase B (AKT) pathways, which ultimately regulate transcription and expression of a variety of genes, including synaptic related Protein factors and BDNF itself, by activating the nuclear transcription factor cyclic adenosine monophosphate response element binding Protein (CREB).

MicroRNAs (miRNAs) are non-coding small RNAs with endogenous regulation function, have regulation function on synapse generation and function and also have important influence on stress diseases related to remodeling in the pathophysiology process (Hu Z, Li Z. miRNAs in hormone level and synthetic pathology. curr Optin Neurobiol,2017,45: 24-31.).

Ginseng (Panax ginseng c.a. meyer) is a perennial herbaceous plant of araliaceae in our country. The traditional treatment of central nervous system diseases by ginseng has been for thousands of years, mainly learning and memory disorders, mood disorders, etc. The treatment of depression by the ginseng preparation dates back to the treatise on the typhoid fever written by Zhang Zhongjing (150-219A.D.) in the eastern Han dynasty more than two thousand years ago, and the ginseng is an important component in the traditional formula of Xiaochaihu decoction, and the formula is clinically used for treating the depression. Kennedy and Scholey in 2003 reported that one of the clinical indications for ginseng is antidepressant (Kennedy DO, Scholey AB. Ginseng: positional for the enhancement of cognitive performance and mood. Pharmacology Biochemistry & Behavior,2003,75(3): 687-700). Ginsenoside is the main effective component of ginseng, more than 40 monomers are separated from total ginsenoside at present and mainly divided into protopanaxadiol and protopanaxatriol, wherein ginsenoside Rb1 is the representative component of protopanaxadiol.

Disclosure of Invention

In order to overcome the defects in the prior art, the invention aims to provide the application of the ginsenoside Rb1 in preparing antidepressant drugs.

The purpose of the invention is realized by the following technical scheme:

application of ginsenoside Rb1 in preparing antidepressant is provided.

Application of ginsenoside Rb1 in preparing medicine for improving hippocampal synaptic plasticity is provided.

Application of ginsenoside Rb1 in preparing miR-134 targeting mediated BDNF signal pathway regulator. Chronic, unpredictable, mild stress for a long period of time increases miR-134 expression in the hippocampus of mice. The high-expression miR-134 inhibits the activity of the BDNF gene by targeting combination with 3' UTR, and further inhibits the expression of the receptor TrkB and downstream PI3K-AKT and MAPK-ERK thereof. Inhibition of both pathways can reduce phosphorylation at Ser9 site of Glycogen synthase kinase (GSK-3 beta), which promotes activation of GSK-3 beta. After activation, GSK-3 beta can reduce the stability of beta-catenin, influence the combination of beta-catenin and CREB in nucleus and regulate the transcription and expression of genes, such as BDNF, Postsynaptic compact protein-95 (PSD-95), Growth related protein-43 (grown associated protein-43, GAP-43), Microtubule-associated protein-2 (Microtube-associated protein-2, MAP-2) and the like. In the application, the ginsenoside Rb1 can save the negative regulation and control of miR-134 on a BDNF cascade signal pathway in the chronic stress process, promote the gene transcription and expression related to synaptic plasticity, increase the hippocampal synaptic plasticity and play the role of anti-depression.

The nucleotide sequence of the miR-134 is shown as follows:

5’-AGGGTGTGTGACTGGTTGACCAGAGGGGCGTGCACTCTGTTCACCCTGTGGGCC ACCTAGTCACCAACCCT-3’。

ginsenoside Rb1 in preparation of protein PSD-95, GAP-43, MAP-2, N-methyl-D-aspartate receptor (NMDAR) subunits NR2A and NR2B, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor, AMPAR) subunit GluR1, calcium/calmodulin dependent protein kinase II (Ca-A-D-aspartic acid receptor)²⁺Application of calmodulin-dependent protein kinase II, CaMKII) in expressing medicine.

Application of ginsenoside Rb1 and miR-134 inhibitor in preparation of antidepressant is provided.

The application is to use the miR-134 inhibitor when using the ginsenoside Rb 1.

An antidepressant drug comprises ginsenoside Rb1 and miR-134 inhibitor.

The invention has the following beneficial effects:

the invention discovers that the ginsenoside Rb1 regulates and controls the synaptic plasticity of the hippocampus through a miR-134 mediated BDNF signal channel for the first time to play an antidepressant role, and clarifies a molecular mechanism that the ginsenoside Rb1 regulates and controls the synaptic plasticity of the hippocampus to play an antidepressant-like role for the first time.

Drawings

FIG. 1 is a graph of the results of a dual-luciferase reporter system validation assay for miR-134 binding to BDNF; wherein A is a binding site prediction map of the two; b is a graph of the relative activity change of the luciferases in each group.

FIG. 2 is a graph of experimental results of the effect of ginsenoside Rb1 and miR-134 intervention on the behaviours of Chronic Unpredictable Mild Stress (CUMS) mice; wherein, A and B are Open-field test (OFT) result graphs; c is a Tail Suspension Test (TST) result chart; d is a Forced Swim Test (FST) result graph; and E is a plot of the results of the sugar water preference test (SPT).

FIG. 3 is a graph showing the results of experiments on the effect of ginsenoside Rb1 and miR-134 intervention on mouse hippocampal neuron specific DNA binding nucleoprotein (NeuN); wherein A is a photograph of immunohistochemical observation results; b is a statistical chart of the test results.

FIG. 4 is a graph of experimental results showing the effect of ginsenoside Rb1 and miR-134 intervention on the density of mouse hippocampal dendritic spines CA1, CA3 and DG region; wherein A is a test result chart of a CA1 area; b is a graph of the test results in the CA3 region; c is a graph of the test results of DG region.

FIG. 5 is a graph showing the experimental results of the effects of ginsenoside Rb1 and miR-134 intervention on synaptic ultrastructure of vertebral body cells in mouse hippocampus CA1 and CA3 regions; wherein A is a test result chart of a CA1 area; b is a graph of the test results in the CA3 region.

FIG. 6 is a graph showing the results of experiments on the effects of ginsenoside Rb1 and miR-134 intervention on the induction of Long-term potentiation (LTP) in the Schaffer collatierale-CA 1 pathway in the mouse hippocampus CA3 region.

FIG. 7 is a graph showing the experimental results of the effects of ginsenoside Rb1 and miR-134 intervention on mouse hippocampal synapse-associated protein expression; wherein A is Synaptophysin (Syn); b is PSD-95; c is GAP-43; d is MAP-2; e is NR 2A; f is NR 2B; g is GluR 1; h is CaMKII.

FIG. 8 is a graph of the results of experiments on the effects of ginsenoside Rb1 and miR-134 intervention on the BDNF cascade signal pathway; wherein A is BNDF; b is TrkB; c is AKT; d is ERK 1/2; e is GSK-3 beta; f is beta-catenin; g is CREB.

FIG. 9 is a schematic diagram of the antidepressant action mechanism of ginsenoside Rb1 in regulating hippocampal synaptic plasticity through a miR-134 mediated BDNF signaling pathway.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the embodiments of the present invention are not limited thereto.

Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. The test methods in the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, reagents and starting materials for use in the present invention are commercially available.

The antibodies referred to in the examples are as follows: BDNF (batch ab226843), p-TrkB (batch ab228507), p-NR2B (batch ab81271) were purchased from Abcam; TrkB (batch 4603), AKT (batch 4691), p-AKT (batch 9275), ERK1/2 (batch 4695), p-ERK1/2 (batch 9102), CREB (batch 9197), Syn (batch 36406), PSD-95 (batch 3450), p-PSD-95 (batch 45737), GAP-43 (batch 8945), beta-catenin (batch 8480), GSK-3 beta (batch 9315), p-GSK-3 beta (batch 9323), NR2A (batch 4205) purchased from Cell Signaling Technology; p-CREB (batch YP0075), CaMKII (batch YT0623), p-CaMKII (batch YP0279), NR2B (batch YN1212), GluR1 (batch YM3492) were purchased from Immunoway. AA V-vehicle, AAV-miR-134-up and AAV-miR-134-down are synthesized in Shanghai Jikai Gene science and technology Limited (the nucleotide sequence of miR-134 is 5'-AGGGTGTGTGACTGGTTGACCAGAGGGGCGTGCACTCTGTTCA CCCTGTGGGCCACCTAGTCACCAACCCT-3'); FD Rapid gold Stain Kit purchased from Biotech, Inc., Bobei Boleid;

the Reporter Assay System is purchased from Abcam corporation; RIP A lysate was purchased from Biyuntian Biotechnology Ltd; the Color Prestained Protein Marker is purchased from Biotech, Inc. of Cunninghui Chengcheng industries, Beijing; protein Loading Buffer (5 ×) was purchased from Bilun sky biotechnology, Inc.; 10% or 12% of the pre-fabricated glue was purchased from the Hangzhou Fried Biotechnology Ltd; BCA protein concentration assay kit was purchased from thermo fisher, usa; miRNA (tailing method) reverse transcription kit bio-engineering (shanghai) gmbh; i anti-diluent purchased from Biyuntian Biotechnology Limited; HRP-labeled goat anti-rabbit II antibody was purchased from Cell Signaling technology; the hypersensitive luminous liquid is purchased from Beijing prilley gene technology company Limited; the primer is synthesized in Guangzhou Ongke Biotechnology GmbH; skimmed milk powder was purchased from BD corporation, usa; 4% Paraformaldehyde was purchased from Shanghai Youning vitamin science and technology Co., Ltd; glutaraldehyde was purchased from Sigma-Aldrich; absolute ethanol, absolute methanol, isopropanol, xylene, chloroform, concentrated hydrochloric acid were purchased from Guangzhou chemical laboratories.

Example 1: double-luciferase reporter gene system for verifying combination of miR-134 and BDNF

1. BDNF-3'UTR-WT and BDNF-3' UTR-Mut primers are designed and synthesized, and the primer sequences are as follows:

F-BDNF-3’UTR-WT：5’-TGTTTCCTCATGACTGCCCC-3’(SEQ ID NO.1)；

R-BDNF-3’UTR-WT：5’-CGATCCGGGTTTCCGTGTTA-3’(SEQ ID NO.2)；

F-BDNF-3’UTR-Mut：5’-GCTTCGGCAGCACATATACTAAAAT-3’(SEQ ID NO.3)；

R-BDNF-3’UTR-Mut：5’-CGCTTCACGAATTTGCGTGTCAT-3’(SEQ ID NO.4)；

2. the method is characterized in that a Shanghai Yubo biotechnology limited company is entrusted to synthesize BDNF-3'UTR-WT and BDNF-3' UTR-Mut sequences, enzyme cutting sites Sac I and Xho I and protective bases (the underlined parts are enzyme cutting sites) are respectively added at two ends of a fragment, and the sequences of the BDNF-3'UTR-WT and the BDNF-3' UTR-Mut sequences are as follows:

BDNF-3’UTR-WT：

CGAGCTCCCACCCGGAGTAGGGATGGAGAAAATTTCTTCACTATCCATTCTGGTTGATAAAGCGTTACATTTGTATGTTGTAAAGATGTTTGCAAAATCCAATCAGATGACTGGAAAACAAATAAAAATTAAGGCAACTGAATAAAATGCTCACACTCCACTGCCCATGATGTATCTCCCTGGTCCCCCTCAGCTCACTCTTCTGGCATGGGTCAGGGAAAATTGCTTTTATTGGAAAGACCAGCATTTGTTCAAAGCATACTCTTTCCCTCCCTCCTCCCATTTTGGTCCCTTCTTTTTGTTTTGTTTTAAGAAAGAAAATTAAGTTGCGCGCTTTAAAATATTTTACTACTGCTACAAACAGATGCTCGA GGG(SEQ ID NO.5)；

BDNF-3’UTR-Mut：

CGAGCTCCCACCCGGAGTAGGGATGGAGAAAATTTCTTCACTATCCATTCTGGTTGATAAAGCGTTACATTTGTATGTTGTAAAGATGTTTGCAAAATCCAATCAGATGACTGGAAAACAAATAAAAATTAAGGCAACTGAATAAAATGCTCACACTCCACTGCCCATGATGTATGTGGGTGGTGCCCCTGTGCTGTGTCTTCTGGCATGGGTCAGGGAAAATTGCTTTTATTGGAAAGACCAGCATTTGTTCAAAGCATACTCTTTCCCTCCCTCCTCCCATTTTGGTCCCTTCTTTTTGTTTTGTTTTAAGAAAGAAAATTAAGTTGCGCGCTTTAAAATATTTTACTACTGCTACAAACAGATGCTCGA GGG(SEQ ID NO.6)；

3. construction of a Dual-luciferase reporter vector with 3' UTR of a target Gene

(1) The two fragments BDNF-3'UTR-WT and BDNF-3' UTR-Mut (the synthesized fragment was diluted to 500 ng/. mu.L) and the vector pmirGLO (commercially available, diluted to 100 ng/. mu.L) were digested with restriction enzymes Sac I and Xho I as follows: 10 × Cutsmart buffer, 1 μ L; xho I, 0.5. mu.L; sac I, 0.5. mu.L; fragment of interest, 4 μ L (pmirGLO vector, 1 μ L); RNAse free water 4 (added 7 in the vector digestion system) uL.

(2) Placing the enzyme digestion system in a water bath kettle at 37 ℃ for enzyme digestion for 1h, and then carrying out gel recovery.

(3) Carrying out homologous recombination on the recovered gene fragment and the vector according to the following system: 5 × CE II Buffer, 2 μ L; recovered target fragment, 4 μ L; recovered pmirGLO vector, 1. mu.L; exnase II, 1. mu.L; RNAse free water, 2. mu.L.

(4) After 30min of water bath at 37 ℃, 3.5. mu.L of transformed E.coli competent DH 5. alpha. was plated and cultured overnight.

(5) And selecting a single clone for PCR identification, and sequencing the positive colony.

(6) And shaking the bacterial colony with correct sequencing, extracting plasmids, and obtaining two recombinant vectors of a target gene wild type and a mutant type, which are named as pmirGLO-BDNF-3 'UTR-WT and pmirGLO-BDNF-3' UTR-Mut respectively.

4. Cell transfection

miR-134 mix (synthesized by Shanghai Yubo Biotechnology Co., Ltd.) (mmu-miR-134-5p) or miR-134 negative control (mix NC) and two recombinant vectors, namely pmirGLO-BDNF-3 'UTR-WT and pmirGLO-BDNF-3' UTR-Mut, are co-transfected into 293T tool cells cultured in vitro by using a transfection reagent Fu Gene HD, and the transfection condition is observed under a fluorescence microscope after 24-48 h. The morphology of cells in a 96-well plate was observed, transfection was started when the degree of fusion reached about 60%, and cells were washed 1 time with PBS. ② adding 4 mu g of BDNF-3' UTR into 200 mu L of neuron serum-free culture medium added with B-27 for dilution so as to lead the final concentration to be 2 mu g/mu L.

5. Fluorescence detection of Luciferase

(1) For the first time use

When the Reporter Assay System is used, the Luciferase Assay Buffer II needs to be dissolved and balanced at room temperature in advance; completely adding Luciferase Assay Buffer II into a Luciferase Assay Substrate bottle, completely dissolving a Substrate to form Luciferase Assay Reagent, subpackaging and storing at-80 ℃, and being effective within one year.

(2) Before cell Lysis, Passive lysine Buffer 5 is diluted by D-Hanks to prepare Passive lysine Buffer1 x; absorbing the culture medium in the 24-well plate, adding 300 mu L of Passive Lysis Buffer1 x, placing in a refrigerator at 4 ℃ for reaction for about 20min to fully lyse the cells, blowing and uniformly mixing, and placing in a refrigerator at-80 ℃ and ultralow temperature overnight to ensure that the cells are lysed more thoroughly.

(3) Before the detection on the computer, Stop is detected in advance&

Buffer is placed at room temperature for dissolution and equilibration, Stop is obtained&

Substrate 50X addition to Stop&

In Buffer, fully dissolving it, diluting to Stop&

Substrate1×Reagent。Stop&

Subsystem 1 × Reagent requires a prepared Stop for an on-site use&

Substrate1 × Reagent is effective within 48h at room temperature.

(4) And (3) dissolving the cell lysate in the step (2) at normal temperature, sucking 20 mu L of the cell lysate into a Lockwell maxisorp detection plate, adding 40uL of Luciferase Assay Reagent, shaking and uniformly mixing, immediately detecting Firefo luminescences (fluorescence value of Firefly Luciferase) by using a microplate reader, and paying attention to the fact that the time of the step is not more than 20 min.

(5) After detection of Firefly luminescences, 40. mu.L of Stop was added to each well&

Reagent, after shaking and mixing, detecting Renilla luminescences (fluorescence value of Renilla luciferase) by using a microplate reader.

(6) Data collection and analysis.

The above experimental results are shown in FIG. 1, and a binding site exists between mmu-miR-134-5p and the 3' UTR of BDNF; compared with the BDNF-3' UTR-WT + miR-control group, the luciferase activity of the BDNF-3' UTR-WT + mmu-miR-134-5p group is obviously reduced, and the fact that miR-134 can be targeted to combine with the 3' UTR of the BDNF gene is suggested.

Example 2: establishment and administration of CUMS model of depression

1. Establishment of depression CUMS model

Building a CUMS model after the mouse adapts to the environment for 7 d: continuously illuminating for 36 h; fasting for 12 h; water is forbidden for 12 hours; the cage is inclined for 12 hours at an angle of 45 degrees; swimming for 5min at 4 deg.C in cold water; 24h for wet padding; suspending tail for 2 min; electrically stimulating sole for 10 min; white noise 12 h; and (5) stimulating the LED stroboscopic for 2 h. Except for the placebo group, mice received chronic stress for 35d continuously, with each source of stress being discontinuous and irregular.

2. Animal grouping and administration

After the mice were acclimated to the environment for 7 days, the mice were randomly divided into 8 groups, namely (1) Control group, (2) CUMS-vehicle group, (3) ginsenoside Rb1 group, (4) AAV-vehicle group, (5) AAV-miR-134-down group, (6) AAV-miR-134-up group, (7) Rb1+ AAV-miR-134-down group, and (8) Rb1+ AAV-miR-134-up group, wherein 16 mice in each group were used.

Ginsenoside Rb1 was formulated in advance as a suspension with 0.5% sodium carboxymethylcellulose (CMC-Na). At the 7 th day of chronic stress, the single dry preparation group (3), the compound dry preparation group (7) and the group (8) of the ginsenoside Rb1 are subjected to intragastric administration for 20mg/kg of ginsenoside Rb1, and the other groups are subjected to intragastric administration for 35 days with the same volume of 0.5% CMC-Na. In addition, 160 min after 7d administration of ginsenoside Rb, single bilateral hippocampal microinjection of AAV-vehicle, AAV-miR-134-up and AAV-miR-134-down was performed on Adeno-associated virus (AAV) single stem pre-group (4), group (5), group (6), compound stem pre-group (7), and group (8), respectively. The behavioristics were tested 60min after the last administration.

3. Stereotactic injection of AAV

With 5% isoflurane and 30% O₂Anesthetized mice were mixed and then mounted on a stereotactic frame. The scalp at the top of the brain was cut, the brain skin was wiped with 75% alcohol, and the brain skin was cut open to expose the skull. Anesthesia was maintained with 1.4% isoflurane throughout the procedure. Guiding a hippocampal locus by using a stereo brain positioning instrument, drilling a hole on a roof by a high-speed cranial drill, inserting a 10 mu L Hamilton microsyringe needle at the speed of 0.2mm/s according to coordinates (Bregma: 2.3 mm; media/Lateral (ML): +/-1.8 mm; Dorsal/Ventral (DV): 2.0mm), respectively injecting AAV-vehicle, AAV-miR-134-up and AAV-miR-134-down (the virus titer is 1012v.g./mL) into bilateral hippocampus at a micro-injection volume of 1.0 mu L and an injection rate of 0.2 mu L/min, remaining the needle for 5min after injection, withdrawing the needle for 1mm per minute, finally suturing an incision and carrying out iodophor disinfection. Injecting 50000U/kg of penicillin into abdominal cavity after operation, and supplementing 0.5mL of solution, and mixing the solution with the micePlacing in a heated cage, placing humidified food at the bottom of the cage, and returning to the original feeding room after anesthesia and recovery.

Example 3: behavioural testing

1. Open Field Test (OFT)

In order to eliminate abnormal mouse activities, the mice were screened for autonomic activity before behavioral studies, and the mouse OFT device consisted of a wooden square box (40 cm. times.60 cm. times.50 cm) with 12 equal squares on the bottom. The mouse was placed in one corner of the device and the number of squares passed by all the paws of the mouse over 6min was counted.

2. Tail Suspension Test (TST)

After each group of mice is administrated for 60min at the last time, the adhesive tape is adhered to the position 1cm away from the tail end of each mouse, the length of the adhesive tape is 10cm, the adhesive tape is hung on a rack 50cm above the ground, the mice are in an upside-down hanging position, and every two mice are separated by a baffle plate to prevent mutual interference. Each mouse was observed for 6min and the cumulative tail suspension immobility time 4min after observation was recorded using a stopwatch. In the immobile state, the struggle of the mouse is stopped, and the body is in a static vertical suspension state. To avoid subjective awareness, dosing and behavioral experiments were performed by two people, respectively.

3. Forced Swimming Test (FST)

The pre-swimming experiment is carried out on each group of mice 24h before the formal experiment, the mice are put into a circular container with the height of 25cm, the diameter of 25cm and the water depth of 10cm, the water temperature is 23-25 ℃, and the swimming time is 15 min. On the day of the experiment, 30min after administration, the mice were placed in a round container (same as the pre-swim environment), forced swim for 6min, and the cumulative immobility time was recorded for 4 min. The criteria for immobility was that the mouse stopped struggling in the water, was floating or had only minor limb movements to keep the head floating on the water.

4. Sweet water preference test (SPT)

The interest loss of mice is simulated by a sugar water consumption experiment to investigate the improvement effect of ginsenoside Rb1 on the interest loss mice. The first 48h mice were given two bottles of the same volume of 1% sucrose solution, immediately after fasting and water deprivation for 24h, the mice were exposed to the same weight of tap water and 1% sucrose solution at the same time, and the sucrose consumption percentage was calculated by counting the sucrose intake and drinking water amounts of the mice for 1 h. Sucrose consumption (%) (% sucrose solution intake/(sucrose solution intake + drinking water intake) × 100%.

The results of the above experiments are shown in fig. 2, and the independent activities of the mice in OFT have no significant difference, suggesting that the mice have no abnormal activities before performing TST, FST and SPT. Compared with the CUMS model group, the ginsenoside Rb1 administration group, the miR-134 low expression group and the ginsenoside Rb1+ miR-134 low expression group not only remarkably reduce the immobility time of mice in TST and FST, but also remarkably increase the sugar water preference degree of the mice. However, compared to the ginsenoside Rb1 administration group, the over-expressed miR-134 can significantly reverse this positive role of ginsenoside Rb1 in TST, FST and SPT.

Example 4: immunohistochemical observation of mouse hippocampal neuron specific NeuN expression

After mice were anesthetized by 2.5% sodium pentobarbital peritoneal anesthesia (0.1mL/10g), the peritoneal cavity was opened, the pleura was incised, and the heart was fully exposed. The heart was held with forceps held in the left hand and a 20mL syringe (1mL syringe needle) was passed through the apex into the left ventricle, the right auricle was immediately cut open and the systemic circulation (approximately 20mL) was flushed by rapid infusion of saline. After the fluid from the right auricle became clear and the liver tissue became white, about 40mL of 4% paraformaldehyde was perfused. Then the skull is lifted by holding scissors, the brain is taken out, the hippocampus is carefully separated out and immediately put into 4% paraformaldehyde for fixation for 24 h. After dehydration, transparency and infiltration, paraffin embedding is carried out. The staining procedure was performed with a paraffin section thickness of 5 μm. Baking the slices in an oven at 78 ℃ for 4h, adding the slices into dimethylbenzene after the wax is completely melted, and hydrating and dyeing, wherein the method comprises the following specific steps: (1) dewaxing and washing xylene for 30min for 2 times; (2) gradient of alcohol 100%, 95%, 80% each for 5 min; (3) washing with distilled water for 2 times and 3 min; (4) placing the tissue slices into a repair box, adding appropriate amount of 0.01M citric acid buffer solution (pH 6.0), and performing microwave medium-grade repair for 10 min; (5) cooling at room temperature, washing with 1% PBS for 3min, 3 times, and wiping to dry; (6) dropwise adding 3% hydrogen peroxide, and incubating at room temperature for 10 min; (7) washing with 1% PBS for 3min, 3 times, and wiping to dry; (8) dropwise adding 5% BSA (PBS), and sealing at 37 deg.C for 30 min; (9) washing with 1% PBS for 3min, 3 times, and wiping to dry; (10) adding NeuN antibody (1:100) diluted by 1% PBS dropwise, and standing overnight at 4 ℃; (11) washing with 1% PBS for 3min, 3 times, and wiping to dry; (12) dripping horseradish peroxidase-labeled secondary antibody (1:200), and incubating at 37 ℃ for 30 min; (13) washing with 1% PBS for 3min, 3 times, and wiping to dry; (14) dropwise adding a DAB developing solution which is prepared freshly, observing under a microscope, and placing the DAB developing solution into a PBS box to terminate the color development, wherein a positive signal is tan or tan for about 1 min; (15) harris hematoxylin counterstain for about 5 min; (16) washing with water for 2 times, and differentiating with 1% hydrochloric acid alcohol for 10-30s (observing under microscope); (17) washing with flowing water for 15min to turn blue; (18) gradient of alcohol 80%, 95%, 100% each for 5 min; (19) xylene is transparent for 10min, twice; (20) neutral gum was mounted and the hippocampal CA1, CA3 and DG regions were observed under a microscope for neuronal changes and photographed.

The above experimental results are shown in fig. 3, compared with the CUMS model group, the positive expressions of the ginsenoside Rb1 administration group, the miR-134 low expression group, and the ginsenoside Rb1+ miR-134 low expression group in hippocampal CA1 region, CA3 region, and DG region NeuN are significantly increased; compared with a ginsenoside Rb1 administration group, the over-expressed miR-134 can obviously inhibit the increase of the ginsenoside Rb1 in the expression of NeuN in CA1 region, CA3 region and DG region of hippocampus of depressed CUMS mice.

Example 5: golgi staining mouse hippocampal CA1, CA3 and DG region dendritic spine density

After mice were anesthetized by intraperitoneal injection of 2.5% sodium pentobarbital, the telencephalon (fresh brain tissue, no perfusion) was rapidly removed, the hippocampus was separated on ice and stained according to the FD Rapid Golgi Stain Kit. Mixing the solution A and the solution B in the kit in equal volume, immediately putting the hippocampal tissue into the mixed solution, and fixing the hippocampal tissue at room temperature in a dark place; after two weeks the tissue was transferred to solution C and protected from light at room temperature for 3-7 days, embedded with OCT and stained by freezing 120 μm sections. (1) dH₂O washing for 3min and 2 times; (2) solution D, solution E and dH₂Mixing O at a ratio of 1:1:2, and dyeing for 10 min; (3) dH₂O washing for 3min and 2 times; (4) gradient of alcohol 50%, 75%, 95%, 100% for 5min respectively; (5) xylene is transparent for 10min for 2 times; (6) neutral gum seals were observed under a 100 x optical microscope for changes in the dendritic spines in CA1, CA3 and DG areas and photographed.

The above experimental results are shown in fig. 4, compared with the CUMS model group, the density of dendritic spines of the hippocampal CA1 region, CA3 region and DG region of the ginsenoside Rb1 administration group, the miR-134 low expression group and the ginsenoside Rb1+ miR-134 low expression group is significantly increased; compared with a ginsenoside Rb1 administration group, the over-expressed miR-134 can remarkably antagonize the positive effect of the ginsenoside Rb1 on the density of the hippocampus CA1 region, CA3 region and DG region dendritic spines of the depressed CUMS mice.

Example 6: transmission electron microscope observation mouse hippocampal centrum cell synapse ultrastructure in CA1 and CA3 regions

After the mice were anesthetized by intraperitoneal injection of 2.5% pentobarbital sodium, the telencephalon (fresh brain tissue, no perfusion) was rapidly removed, the hippocampus was isolated on ice, fixed for about 10h with 2.5% pentanediol, washed with PBS, 0.1M citrate buffer for 3 times (15 min; 7 times), treated with 1% osmic acid for 2h, and washed with 0.1M citrate buffer for 2 times (15 min; 7 times). And (3) dehydrating: sequentially treating with 50% ethanol for 15min, 70% ethanol for 15min, 90% ethanol for 15min, equal volume of 90% ethanol and 90% acetone mixed solution for 15min, 90% acetone for 15min, and 100% acetone for 15 min. Embedded with epoxy Epon 812. The LKB ultrathin slicer cuts the slices at 80nm, the slices are placed on a copper net for carrying out double staining (20 min of 4% uranium acetate; 5min of 0.5% lead citrate), and synaptic ultrastructural changes of hippocampal CA1, CA3 and DG areas are observed under a transmission electron microscope.

The above experimental results are shown in fig. 5, compared with the CUMS model group, the lengths and thicknesses of synaptic PSDs of pyramidal cells in hippocampal CA1 region and CA3 region of ginsenoside Rb1 administration group, miR-134 low expression group and ginsenoside Rb1+ miR-134 low expression group are obviously increased, and the width of synaptic cleft is obviously reduced; compared with a ginsenoside Rb1 administration group, the over-expressed miR-134 can remarkably reduce the positive effect of the ginsenoside Rb1 on synaptic ultrastructures of a CA1 region and a CA3 region of hippocampus of depressed CUMS mice.

Example 7: brain slice electrophysiological observation of the effects of long-term induction enhancement on the Schaffer collatoral-CA 1 pathway in the mouse hippocampus CA3 region

After anaesthetizing (2.5% sodium pentobarbital), the mouse is killed by cutting off the head, cutting off the scalp and skull, taking out the whole brain quickly, submerging the head into saturated frozen Artificial cerebrospinal fluid (ACSF) (0 ℃), introducing mixed gas (95% O) into the ACSF half an hour in advance₂+5％CO₂) Washing away watchBlood of face. Cutting into left and right halves along the middle seam of brain, lightly transferring into another saturated frozen ACSF, and freezing for 4min to make the brain texture slightly hard for stripping hippocampus. Using an ophthalmic surgical instrument, the hippocampus was separated from the cerebral cortex and the excess tissue around the hippocampus and blood filaments on the surface were removed. Transferring intact hippocampal tissue to pre-trimmed agar block, and collecting residual ACSF around dry hippocampus with filter paper to form a vacuum state between hippocampi and agar block, wherein the tissue of hippocampi is tightly adhered to the agar surface. Vertically cutting off Hippocampus and its corresponding agar to form a flat section, fixing the section on a specimen base with 502% glue, and placing in a continuous 95% O channel₂+5％CO₂In the slicing tank of frozen ACSF. The blade angle of the vibrating microtome is adjusted, and the hippocampal brain slices are continuously cut and taken, and the thickness is 350 mu m. The hippocampal slices were transferred to an incubation tank continuously aerated with mixed gas, incubated for 1h at 32 ℃ with ACSF and then incubated at room temperature.

After the brain slice incubation is finished, selecting a faint yellow brain slice with good health activity, transferring the faint yellow brain slice to a glass slide of a perfusion groove, fixing the faint yellow brain slice by using a cover net, continuously perfusing the faint yellow brain slice at 1-2mL/min, and continuously supplying mixed gas (95% O)₂+5％CO₂) The temperature was controlled at 30 ℃. A nickel-chromium electrode was used to stimulate the Schaffer collateral channels, and a glass recording electrode filled with ACSF was placed in the CA1 region to record the excitatory postsynaptic potential (fEPSP). A Multi Clamp 700B amplifier was connected, the fEPSP amplitude was adjusted to 40% of the maximal response, and a stable baseline maintained for 30min (stimulation frequency 0.033Hz, stimulation interval 30s) was recorded. After the end of basal baseline recordings, LTP was induced by HFS administration on the schafer collateral pathway (stimulation frequency 100Hz, stimulation interval 30s), and the amplitude change of fEPSP was recorded 60min after HFS administration. The field potential data was collected by pClamp 9.2 and analyzed. The ratio of the mean fEPSP slope at the last 30min after HFS administration to the mean fEPSP slope at 30min basal stimulation was counted.

The above experimental results are shown in fig. 6, compared with the CUMS model group, the slope percentage of fEPSP in hippocampal CA1 region of ginsenoside Rb1 administration group, miR-134 low expression group and ginsenoside Rb1+ miR-134 low expression group is obviously increased; compared with the ginsenoside Rb1 administration group, the over-expressed miR-134 can obviously inhibit the increase of the ginsenoside Rb1 on the percentage of fEPSP slope of the hippocampal CA1 region of depressed CUMS mice.

Example 8: western blot technology for detecting mouse hippocampal synapse-associated protein and expression of protein in BDNF cascade signal channel

1. Total tissue protein extraction

Frozen hippocampal tissue at-80 ℃ was removed and 1mL of ice-cold lysate mixture was added to 20mg of tissue: RIPA lysate (strong) phosphatase inhibitor mixture (50 x) PMSF 100:1:1, refiner grinding for 1min, and centrifuging at 12000 rpm at 4 ℃ for 15 min. The supernatant was collected and the precipitate was discarded. Taking a proper amount of supernatant, measuring the protein concentration according to a BCA method, adding a loading buffer according to the proportion of 5:1, boiling for 7min at 100 ℃, and storing for later use in a Western blot or a refrigerator at-80 ℃.

2. SDS-polyacrylamide gel electrophoresis (SDS-PAGE)

(1) Cleaning glass sheets

(2) Pouring and sampling

Preparing 10% separation gel according to the formula, and finally adding TEMED and mixing the mixture evenly to avoid generating bubbles. Adding 10% separation glue 1cm below comb teeth, and sealing with 75% alcohol or water. When there is a clear boundary between the water and the gel, the gel is gelled, the water on the gel side is poured off, and the excess water is sucked off with filter paper. Adding 4% concentrated gel to fill the rest space, immediately inserting the sample comb, and coagulating the gel for about 30 min. The solidified gel is clamped and placed into an electrophoresis tank, and an appropriate amount of electrophoresis buffer (1 x) is added. When loading, the comb is vertically pulled out, the marker is added on two sides, and the sample loading amount is 20 mu L.

(3) Electrophoresis

And after the electrification, setting the voltage to be 80V, changing the voltage to be 120V when the electrophoresis is carried out to the interface surface of the concentrated gel and the separation gel, and stopping the electrophoresis when the bromophenol blue just runs out of the lower edge of the separation gel for about 120 min.

3. Western blot reaction

(1) Rotary film

Prying the electrophoresis glass plate, taking out the solidified gel, cutting off the concentrated gel part and unnecessary separation gel, and then putting the gel into electrotransformation liquid for balancing for 10 min. In a tray with electrotransfer, 1 sponge pad, 2 filter papers, PVDF membrane (4.5 cm. times.8.0 cm), gel, 2 filter papers and 1 sponge pad were stacked in order on an anode electrotransfer clamp. During which time air bubbles between the membrane and the gel are driven off. And (3) placing the electric rotary clamp into an electric rotary groove, wherein the anode and the cathode are in correspondence, ice and ice bags are placed around the groove, and timely cooling preparation is carried out. Pouring enough membrane transferring liquid, adjusting the current to 300mA, and electrically transferring for 1-1.5 h.

(2) Sealing of

Taking out the electrically transferred PVDF membrane, placing the PVDF membrane with the front surface facing upwards (the front surface facing the rubber surface), sealing in 5% skimmed milk powder, and shaking for 90min at room temperature.

(3) Primary antibody incubation

The closed membrane was removed and washed 3 times with TBST, 10min each time until no foam was present. The primary anti-rabbit antibody diluted in TBST was added. After shaking for 1h on a shaker, the cells were incubated overnight at 4 ℃.

(4) Incubation with secondary antibody

The overnight PVDF membrane incubated with the primary antibody was removed and washed 3 times with TBST, 10min each time. Adding horseradish peroxidase (HRP) -conjugated secondary antibody diluted with 5% skimmed milk powder, incubating for 1h on a shaker at room temperature, washing with TBST for 3 times, each for 10min, and developing.

(5) Exposure method

Exposure liquid A and B were 1: 1. And (4) the film is placed with the right side facing upwards, and the prepared exposure liquid is dripped for exposure.

(6) Gel image analysis

The film was scanned and photographed, and the molecular weight and net optical density values of the target bands were analyzed using a gel image processing system.

The results of the above experiments are shown in fig. 7, and there is no significant difference in Syn protein expression in hippocampal tissues of each group of mice. In addition, compared with the CUMS model group, the expression content of hippocampal synapse-associated proteins such as PSD-95, GAP-43 and MAP-2, and synaptic function proteins NR2A, NR2B, GluR1 and CaMKII of the ginsenoside Rb1 administration group, the miR-134 low expression group and the ginsenoside Rb1+ miR-134 low expression group is obviously increased; compared with the ginsenoside Rb1 administration group, the over-expressed miR-134 can obviously inhibit the positive regulation effect of the ginsenoside Rb1 on the synapse-associated proteins. The research on the antidepressant-like effect and the molecular mechanism of ginsenoside Rb1 may be through the mechanism shown in FIG. 8, that is, miR-134 can target and bind and negatively regulate the expression of BDNF, and ginsenoside Rb1 regulates the antidepressant effect of hippocampal synaptic plasticity through a miR-134 mediated BDNF signal pathway: compared with the CUMS model group, the expression levels of BDNF, TrkB, AKT, ERK1/2, GSK-3 beta, beta-catenin and CREB of the ginsenoside Rb1 administration group, the miR-134 low expression group and the ginsenoside Rb1+ miR-134 low expression group are obviously increased; compared with the ginsenoside Rb1 administration group, the over-expressed miR-134 can obviously inhibit the positive regulation and control effect of the ginsenoside Rb1 on the BDNF signal pathway.

Overexpression of hippocampal targeting miR-134 remarkably blocks antidepressant-like effects of ginsenoside Rb1 on mouse behaviours, hippocampal synaptic ultrastructure, LTP induction, synaptic associated protein expression and BDNF-TrkB signaling. These effects appear as: increasing immobility time in TST and FST, decreasing sucrose preference in SPT, decreasing hippocampal dendritic spine density and PSD length, PSD thickness, increasing synaptic cleft width, and furthermore, inhibiting the induction of LTP, inhibiting the expression of synapse-associated proteins including PSD-95, GAP-43, MAP-2, NR2A, NR2B, GluR1, CaMKII, and BDNF and its downstream proteins including TrkB, AKT, ERK1/2, GSK-3 beta, beta-catenin and CREB. The ginsenoside Rb1 can save the negative regulation and control of miR-134 on BDNF cascade signal path in the process of chronic stress, promote the gene transcription and expression related to synaptic plasticity and increase the synaptic plasticity of hippocampus.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> river-south university

Application of <120> ginsenoside Rb1 in preparation of antidepressant drugs

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> F-BDNF-3’UTR-WT

<400> 1

tgtttcctca tgactgcccc 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> R-BDNF-3’UTR-WT

<400> 2

cgatccgggt ttccgtgtta 20

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> F-BDNF-3’UTR-Mut

<400> 3

gcttcggcag cacatatact aaaat 25

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> R-BDNF-3’UTR-Mut

<400> 4

cgcttcacga atttgcgtgt cat 23

<210> 5

<211> 375

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BDNF-3' UTR-WT nucleotide sequence

<400> 5

cgagctccca cccggagtag ggatggagaa aatttcttca ctatccattc tggttgataa 60

agcgttacat ttgtatgttg taaagatgtt tgcaaaatcc aatcagatga ctggaaaaca 120

aataaaaatt aaggcaactg aataaaatgc tcacactcca ctgcccatga tgtatctccc 180

tggtccccct cagctcactc ttctggcatg ggtcagggaa aattgctttt attggaaaga 240

ccagcatttg ttcaaagcat actctttccc tccctcctcc cattttggtc ccttcttttt 300

gttttgtttt aagaaagaaa attaagttgc gcgctttaaa atattttact actgctacaa 360

acagatgctc gaggg 375

<210> 6

<211> 375

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> BDNF-3' UTR-Mut nucleotide sequence

<400> 6

cgagctccca cccggagtag ggatggagaa aatttcttca ctatccattc tggttgataa 60

agcgttacat ttgtatgttg taaagatgtt tgcaaaatcc aatcagatga ctggaaaaca 120

aataaaaatt aaggcaactg aataaaatgc tcacactcca ctgcccatga tgtatgtggg 180

tggtgcccct gtgctgtgtc ttctggcatg ggtcagggaa aattgctttt attggaaaga 240

ccagcatttg ttcaaagcat actctttccc tccctcctcc cattttggtc ccttcttttt 300

gttttgtttt aagaaagaaa attaagttgc gcgctttaaa atattttact actgctacaa 360

acagatgctc gaggg 375

<210> 7

<211> 71

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> miR-134 nucleotide sequence

<400> 7

agggtgtgtg actggttgac cagaggggcg tgcactctgt tcaccctgtg ggccacctag 60

tcaccaaccc t 71

Claims (10)

1. Application of ginsenoside Rb1 in preparing antidepressant is provided.

2. Application of ginsenoside Rb1 in preparing medicine for improving hippocampal synaptic plasticity is provided.

3. Application of ginsenoside Rb1 in preparing miR-134 targeting mediated BDNF signal pathway regulator.

4. Use according to claim 3, characterized in that: the nucleotide sequence of the miR-134 is shown as follows:

5’-AGGGTGTGTGACTGGTTGACCAGAGGGGCGTGCACTCTGTTCACCCTGTGGGCCACCTAGTCACCAACCCT-3’。

5. use according to claim 3, characterized in that: the miR-134 negatively regulates the expression of BDNF and downstream proteins thereof by targeting combination with the 3' UTR of the BDNF gene.

6. Use according to claim 3, characterized in that: the ginsenoside Rb1 realizes regulation by reversing the negative regulation.

7. Application of ginsenoside Rb1 in preparing medicines for promoting expression of hippocampal synaptic plasticity associated proteins PSD-95, GAP-43, MAP-2, NR2A, NR2B, GluR1 and CaMKII is provided.

8. Application of ginsenoside Rb1 and miR-134 inhibitor in preparation of antidepressant is provided.

9. Use according to claim 8, characterized in that: the application is to use the miR-134 inhibitor when using the ginsenoside Rb 1.

10. An antidepressant drug characterized by: comprises ginsenoside Rb1 and miR-134 inhibitor.

Images