CN116042409A

CN116042409A - Aspergillus niger HY4-25 and application thereof in extracting lotus leaf total flavonoids

Info

Publication number: CN116042409A
Application number: CN202211388318.2A
Authority: CN
Inventors: 陈虹; 张建芬; 雷超; 邵波; 柯薇
Original assignee: Zhejiang Shuren University
Current assignee: Zhejiang Shuren University
Priority date: 2022-11-08
Filing date: 2022-11-08
Publication date: 2023-05-02

Abstract

The invention discloses HY4-25 and application thereof in lotus leaf total flavone extraction, and the enzymolysis of a crude enzyme solution prepared by microbial fermentation is added before lotus leaf ethanol ultrasonic extraction of total flavone. The enzyme-producing microorganism Aspergillus niger HY4-25 is purposefully screened aiming at hydrolyzing the cell wall of lotus leaves, and the fermentation broth cultured by the enzyme production contains various hydrolases, so that the fermentation broth can cooperatively hydrolyze substances such as cellulose, pectin and the like in the lotus leaves, so that the cell wall is damaged, the dissolution of flavonoid substances is facilitated, and the extraction yield of total flavonoids is remarkably improved. Compared with the method directly adopting ethanol ultrasonic extraction, the method for microbial enzymatic hydrolysis of lotus leaves provided by the invention has the advantage that the yield of extracting total flavonoids from lotus leaves can be improved by 36.3%.

Description

Aspergillus niger HY4-25 and application thereof in extracting lotus leaf total flavonoids

Field of the art

The invention belongs to the technical field of bioengineering, and particularly relates to aspergillus niger HY4-25 and application thereof in lotus leaf total flavone extraction.

(II) background art

Lotus leaf is a leaf of lotus (Nelumbo nucifera gaertn.) belonging to the family nelumbinis. Lotus, etc. grows in ponds and lakes, and most areas of China are distributed and mainly produced in Hunan, zhejiang, jiangsu and other places. For a long time, lotus leaves have wide application in both eating and medicinal aspects. Lotus leaves are carried by medicinal materials and decoction pieces in the first part of the pharmacopoeia of the people's republic of China, and the Chinese medicinal materials and decoction pieces have the functions of clearing summer-heat and resolving dampness, raising clear yang, cooling blood and stopping bleeding, and are mainly used for treating summer-heat polydipsia, summer-heat and damp diarrhea, spleen deficiency diarrhea, blood heat hematemesis and epistaxis, hematochezia metrorrhagia and the like. Lotus leaves have remarkable dietetic efficacy due to the fact that the lotus leaves contain a plurality of active ingredients, and are listed in the list of "food and medicine" of group 2, as early as Wei Jian (1991) No. 45 of the ministry of health of the people's republic of China, 11 th 1991. The lotus leaf contains common chemical components such as carbohydrate, lipid, protein, tannin and the like which are common to common plants, and also contains rich flavone, alkaloid and polysaccharide. Among the chemical components of lotus leaf, flavonoid compounds have outstanding biological activity and obvious functions in the aspects of resisting oxidation and aging, treating cardiovascular and cerebrovascular diseases, reducing blood fat and other medical health care. The lotus leaf resources in China are rich, and the total flavone is extracted from the lotus leaf, so that the economic efficiency of agricultural planting of lotus roots can be improved.

The extraction method of total flavonoids mainly comprises water extraction, alkaline water extraction, organic solvent extraction and CO extraction ₂ Supercritical extraction and the like, and on the basis of the first 3 methods, the method of strengthening extraction by assisting ultrasonic wave, high pressure, microwave, enzymolysis and the like is also adopted. The different extraction methods have respective advantages and disadvantages, such as low cost of water extraction method, but low total flavone yield, and the extract contains a large amount of polysaccharide and protein; ethanol extraction is commonly used for the organic solvent extraction method, and has the advantages of improving the extraction yield and the product purity; ultrasonic or microwave assisted extraction method is added with ultrasonic or microwave treatment based on water extraction or ethanol extraction method,the flavone is promoted to be dissolved out, and the extraction yield is improved to a certain extent; CO ₂ The purity of the total flavone extracted by the supercritical extraction method is higher, but the extraction yield is often not high, and the equipment requirement is higher. The most widely used method is an ultrasonic-assisted ethanol extraction method, and the ultrasonic waves have lower use cost, and can be recycled although the ethanol consumption is larger.

In recent years, enzymolysis auxiliary plant active ingredient extraction has more application, which pretreats plant raw materials with one or more of cellulase, hemicellulase, pectase or protease, etc., can hydrolyze plant cell wall ingredients (cellulose, hemicellulose, lignin, pectin, protein, etc.), and is beneficial to release of active ingredient during extraction, thereby improving the extraction yield of the product. The extraction of lotus leaf total flavonoids by enzymolysis is also reported, for example, zhang Shengbang, and the yield of lotus leaf total flavonoids by cellulose and pectase is 3.74 percent, which is greatly improved compared with 1.59 percent of the non-enzymatic extraction method [ Zhang Shengbang, she Jing, chen Cong ], the process optimization of the complex enzymatic extraction of lotus leaf flavonoids by the enzyme method, food science, 2012,33 (22): 149-153]. The plant raw material is pretreated by pure enzyme, the enzyme consumption is usually large, the cost is not neglected, the plant cell wall is composed of a plurality of components, and the ideal effect is difficult to obtain by using a single enzyme for hydrolysis, and the extraction cost is increased by the complex enzyme method of combining a plurality of enzymes.

Microorganisms have a strong enzyme-producing ability, and in particular some actinomycetes and molds can produce various hydrolytic enzymes which decompose plant tissues, including cellulases, hemicellulases, ligninases, pectinases, proteases, and the like. Therefore, if a certain microorganism is used for culturing under proper conditions, a large amount of hydrolytic enzymes are contained in the fermentation broth, and the fermentation broth (crude enzyme liquid) is used for directly hydrolyzing the plant raw material, and the enzymes can synergistically decompose cell wall components, so that the release of active ingredients is facilitated, and the extraction yield can be remarkably improved; in addition, the crude enzyme solution which is not separated and purified is used, so that the preparation cost is lower.

In order to improve the extraction yield of the lotus leaf total flavonoids, the invention uses the crude enzyme liquid prepared by mould fermentation to carry out enzymolysis on the lotus leaf, and then uses an ethanol ultrasonic method to extract the total flavonoids, thereby greatly improving the extraction yield of the total flavonoids.

(III) summary of the invention

The invention aims to provide a novel microorganism strain, namely aspergillus niger (Aspergillus niger) HY4-25, and application thereof in extracting lotus leaf total flavonoids. After the lotus leaf is subjected to enzymolysis by the crude enzyme liquid prepared by fermenting the strain, the extraction yield of the total flavonoids can be greatly improved.

The technical scheme adopted by the invention is as follows:

the invention provides a new microorganism strain, namely aspergillus niger (Aspergillus niger) HY4-25, which is preserved in the Guangdong province microorganism strain collection center, with the preservation number: GDMCC No. 62851, storage date 2022, 9 months 25 days, address: building 5 of No. 59 of Qinghui No. 100 college in Guangzhou City of Guangdong; postal code 510070.

The aspergillus niger HY4-25 is an excellent strain obtained by separating from a microbial enrichment culture of lotus leaves, screening and mutation breeding. Colony morphology characteristics of the aspergillus niger HY4-25 are as follows: culturing on Potato Dextrose Agar (PDA) plate culture medium at 28deg.C for 48 hr, wherein the front surface of colony is black, there are a large number of black particles on the surface, the center of the reverse colony is yellow brown, no exudates and no soluble pigment are present in the culture medium; conidiophores occur in the matrix with a diameter of 10-15 μm; the top sac is nearly spherical, double layers of small conidium stems are planted on the periphery of the top sac, the lengths of the two layers of small conidium stems are different, conidium is generated on the outer layer of small stems, and the conidium head shape is typical chrysanthemum shape; conidium has brown sphere shape with diameter of 3.0-4.0 μm and rough surface. A photograph of a colony of Aspergillus niger HY4-25 cultured on PDA plate medium at 28℃for 48h is shown in FIG. 1.

The nucleotide sequence of a transcription spacer (Ribosomal DNA internal transcribed spacer, rDNA-ITS) in the ribosomal DNA of the Aspergillus niger HY4-25 is shown in SEQ ID NO. 1.

The invention also provides an application of the aspergillus niger HY4-25 in extracting lotus leaf total flavonoids, and the application method comprises the following steps: (1) Filtering a fermentation broth obtained by culturing Aspergillus niger HY4-25, and collecting filtrate, namely crude enzyme solution; (2) Mixing the crude enzyme solution with lotus leaf powder, performing enzymolysis at 35-40deg.C for 4-6 hr, adding anhydrous ethanol with volume 1.5-2.0 times of that of the crude enzyme solution into the enzymolysis system, performing ultrasonic extraction, and vacuum filtering to obtain total flavone extractive solution; (3) Evaporating the total flavone extract under reduced pressure, dissolving in ethanol, concentrating, and vacuum drying to obtain total flavone extract.

Further, the preparation method of the crude enzyme solution in the step (1) comprises the following steps: inoculating Aspergillus niger HY4-25 spores into an enzyme-producing culture medium, performing shaking culture at 30 ℃ and 200-250r/min for 64-72h, filtering fermentation liquor, and obtaining filtrate as crude enzyme liquor; the final concentration composition of the enzyme-producing culture medium is as follows: wheat bran 30-40g/L, (NH) ₄ ) ₂ SO ₄ 5-6g/L, peptone 3-4g/L, KH ₂ PO ₄ 3–5g/L，MgSO ₄ ·7H ₂ O 0.5–1.0g/L，CaCl ₂ 0.3–0.5g/L，FeSO ₄ ·7H ₂ 0.1-0.2g of O, tap water as solvent and pH of 6.0-6.5.

Further, it is preferable that the enzyme-producing medium has the composition: 40g/L wheat bran, (NH) ₄ ) ₂ SO ₄ 5g/L peptone 4g/L KH ₂ PO ₄ 3g/L，MgSO ₄ ·7H ₂ O 0.5g/L，CaCl ₂ 0.5g/L，FeSO ₄ ·7H ₂ O0.1 g, tap water as solvent, pH 6.0.

Before enzyme production culture, the aspergillus niger HY4-25 needs to be cultured by a flat plate culture medium to generate spores, then the spores are suspended in normal saline and are inoculated into the enzyme production culture medium for culture according to the volume fraction of 4% -6%, and the specific enzyme production culture method comprises the following steps:

(1) spore liquid preparation: inoculating Aspergillus niger HY4-25 into Potato Dextrose Agar (PDA) plate culture medium, and culturing at 28-30deg.C for 54-60 hr to obtain plate culture; adding sterile physiological saline into the plate culture, and stirring with an inoculating loop to suspend spores to obtain Aspergillus niger HY4-25 spore liquid; the final concentration composition of the PDA plate culture medium is as follows: 200g/L of potato (cut into small pieces, boiled in water for 20min, deslagged to leave juice), 20g/L of glucose, 20g/L of agar, tap water as a solvent and natural pH (actually measured 6.5).

(2) Enzyme production culture: inoculating the inoculated Aspergillus niger HY4-25 spore liquid with the volume fraction of 4% -6% after the activation culture in the step (1) into an enzyme production culture medium, and carrying out shake culture for 64-72h at the temperature of 30 ℃ and the speed of 200-250r/min to obtain a fermentation broth with the dry thallus concentration of 5.17-5.36g/L and the cellulase activity of 119-127U/mL.

Further, the volume of the crude enzyme liquid in the step (2) is 6-10mL/g (namely, the feed enzyme ratio (g: mL) is 1:6-1:10) calculated by the mass of lotus leaf powder, and the lotus leaf powder is fine powder obtained by drying fresh lotus leaves at 85 ℃, crushing and sieving the dried lotus leaf powder with a 40-mesh sieve.

Further, the preparation method of the total flavone extract in the step (2) comprises the following steps: and after the enzymolysis of the lotus leaves is finished, adding absolute ethyl alcohol with the volume of 1.5-2.0 times of the volume of the crude enzyme solution into the system to ensure that the volume fraction of the ethyl alcohol in the system reaches 60% -66.7%, and the feed-liquid ratio (g: mL) is 1:18-1:25. Stirring uniformly, placing in an ultrasonic cleaner with water bath temperature of 70-75deg.C, extracting at 100-200W for 40-60min; and after the ultrasonic alcohol extraction is finished, carrying out suction filtration while the solution is hot to obtain a total flavone extracting solution.

Further, the method for recovering the total flavonoids from the total flavonoids extract in the step (3) comprises the following steps: distilling the total flavone extract at 45 deg.C and-0.1 MPa until no liquid flows out, adding anhydrous ethanol with volume of 4-8mL/g of the mass of lotus leaf as raw material, centrifuging at 8000r/min for 5-10min after full shaking, distilling supernatant at 45 deg.C and-0.1 MPa to 1/10 of the original volume, transferring into 1 clean culture dish, and vacuum drying at 50 deg.C and-0.1 MPa to obtain total flavone extract.

Compared with the prior art, the invention has the beneficial effects that: before the lotus leaf ethanol is ultrasonically extracted to obtain total flavone, the enzymolysis of the crude enzyme liquid prepared by microbial fermentation is added. The enzyme-producing microorganism Aspergillus niger HY4-25 is purposefully screened aiming at hydrolyzing the cell wall of lotus leaves, and the fermentation broth cultured by the enzyme production contains various hydrolases, so that the fermentation broth can cooperatively hydrolyze substances such as cellulose, pectin and the like in the lotus leaves, so that the cell wall is damaged, the dissolution of flavonoid substances is facilitated, and the extraction yield of total flavonoids is remarkably improved. Compared with the method directly adopting ethanol ultrasonic extraction, the method for microbial enzymatic hydrolysis of lotus leaves provided by the invention has the advantage that the yield of extracting total flavonoids from lotus leaves can be improved by 36.3%.

(IV) description of the drawings

FIG. 1 is a photograph of a colony of Aspergillus niger HY4-25 cultured on PDA at 28℃for 48 h.

FIG. 2 is a standard curve of spectrophotometry for total flavonoids.

FIG. 3 is a standard curve of the determination of glucose by the DNS method.

(fifth) detailed description of the invention

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:

the lotus leaf of the invention is the leaf of lotus (Nelumbo nucifera Gaertn.) belonging to the family Nelumbo, and is produced in Deqing county of Zhejiang province. The lotus leaf powder is fine powder obtained by drying fresh mature lotus leaf at 85deg.C, pulverizing, and sieving with 40 mesh sieve.

Example 1: isolation and screening of enzyme producing microbial strains

The microbial strain for fermenting and producing enzyme and enzymolysis lotus leaves is obtained by separating and screening the following steps:

(1) 10g of lotus leaf powder is added into a 250-mL Erlenmeyer flask, 20mL of sterile physiological saline is added, stirring is uniform, and culturing is carried out at 28 ℃ for 72h. Diluting the enriched culture of the grown mould with sterile physiological saline for 1×10 respectively ^-6 、1×10 ^-7 、1×10 ^-8 After doubling, 0.1mL of the diluent is respectively absorbed and coated on a potato dextrose agar flat plate culture medium (PDA), the potato dextrose agar flat plate culture medium is cultured for 48 hours at the temperature of 28 ℃, mould colonies with different colors and forms are picked up and transferred to a fresh PDA flat plate culture medium, and the fresh PDA flat plate culture medium is cultured for 60 hours at the temperature of 28 ℃, so that 9 strains of pure culture strains are obtained, and the serial numbers of all strains are shown in the table 1.

(2) 10mL of sterile physiological saline is added to the fresh plate cultures of 9 strains respectively, and spores are suspended by stirring with an inoculating loop, so that spore liquid of each strain is obtained.

(3) Taking 2mL of spore liquid of each strain prepared in the step (2), inoculating the spore liquid into 50mL of enzyme-producing culture medium (the inoculum size is 4% by volume fraction), carrying out enzyme-producing culture for 72 hours at 30 ℃ under the shaking condition of 200r/min, and carrying out suction filtration on all fermentation liquor by using a Buchner funnel, wherein the collected filtrate is crude enzyme liquid.

(4) Adding 1g of lotus leaf powder into 9 50-mL centrifuge tubes respectively, adding 10mL of crude enzyme solution of each strain prepared in the step (3) (the ratio of feed enzyme is 1:10), stirring uniformly, and carrying out enzymolysis at 35 ℃ for 6h to obtain lotus leaf enzymatic hydrolysate.

(5) And (4) respectively adding 15mL of absolute ethyl alcohol (1.5 times the volume of crude enzyme liquid, and the volume fraction of system ethyl alcohol is 60 percent, the feed liquid ratio is 1:25) into all lotus leaf enzymatic hydrolysate subjected to enzymolysis by the crude enzyme liquid of each strain, shaking uniformly, placing into an ultrasonic cleaner with water bath at 70 ℃, performing ultrasonic extraction at 100W for 60min, filtering by a hot Buchner funnel, collecting filtrate, and measuring the total flavone content in the filtrate by a spectrophotometry.

Starting from the step (4), replacing crude enzyme liquid with 10mL of enzyme-producing culture medium without inoculating microorganisms to make non-enzymolysis control; a cellulase enzymolysis control was prepared by replacing the crude enzyme solution with 10mL of cellulase phosphate buffer (pH 6.0,0.2 mol/L) with a viability of 2000U/mL. The extraction rate of lotus leaf subjected to enzymolysis by crude enzyme solution of different strains and total flavonoids of comparison are shown in table 1.

TABLE 1 extraction yield of lotus leaves and comparative total flavonoids by enzymatic hydrolysis of crude enzyme solutions of different strains

As can be seen from the data in Table 1, after the lotus leaf is subjected to enzymolysis by the crude enzyme solution prepared by fermenting the HY4 strain, the total flavone extraction yield is 5.64%, and is improved by 19.2% compared with the control without enzymolysis by 4.73%. The extraction yield of total flavonoids can be obviously improved by using cellulase to treat lotus leaves, and is improved by 9.51% compared with a control without enzymolysis, but is far inferior to a crude enzyme solution prepared by fermenting an HY4 strain. After the lotus leaves are subjected to enzymolysis by the crude enzyme solution of the microbial strains, the extraction yield of the total flavonoids is not improved, and even is reduced, such as HY3 and HY8 strains. The results demonstrate that the selectivity of the microbial enzyme-producing strain used for the enzymatic hydrolysis of lotus leaves to increase the extraction yield of total flavonoids requires not only the enzymatic hydrolysis of the cell wall components of lotus leaves, but also the inability to enzymatically degrade flavonoids. The HY4 strain is selected as an enzyme-producing strain for improving the extraction rate of lotus leaf total flavonoids.

The PDA plate culture medium is prepared according to the following composition and method: cleaning potato, peeling, cutting into small blocks with side length of about 1cm, weighing 200g, adding 1000mL of tap water, boiling for 20min, filtering with 4 layers of gauze, removing residues, supplementing the filtrate to 1000mL, adding 20g of glucose and 20g of agar, naturally measuring pH (about 6.5), heating to dissolve agar, packaging in a triangular flask, sterilizing at 121deg.C for 20min by high pressure steam, pouring into sterile culture dishes with diameter of 9cm before solidification, and 15-20mL each dish.

The final concentration composition and preparation method of the enzyme-producing culture medium are as follows: 40g/L wheat bran, (NH) ₄ ) ₂ SO ₄ 5g/L peptone 4g/L KH ₂ PO ₄ 3g/L，MgSO ₄ ·7H ₂ O 0.5g/L，CaCl ₂ 0.5g/L，FeSO ₄ ·7H ₂ O0.1 g, tap water as solvent, pH 6.0. 50mL enzyme-producing culture medium is bottled by 250-mL triangular flask, 8 layers of gauze are tied up, and high-pressure steam is used for sterilization at 121 ℃ for 20min.

The total flavone content is determined by spectrophotometry, and the specific method comprises the following steps: 2.5mL of total flavone sample solution to be detected (the sampling amount is properly adjusted according to the concentration of the total flavone in the sample, and the detection A is controlled) ₅₁₀ Between 0.2 and 0.8, dissolving the solid total flavone crude extract with 60% ethanol water solution by volume fraction, adding sodium nitrite (NaNO) with mass concentration of 5% into 10-mL graduated tube ₂ ) 0.4mL of aqueous solution, standing for 6min, adding 10% aluminum nitrate [ Al (NO) ₃ ) ₃ ]0.6mL of aqueous solution, standing for 6min, adding 2mL of 20% aqueous solution of sodium hydroxide (NaOH), fixing volume to 10mL with 60% aqueous solution of ethanol, shaking, standing for 15min, and measuring absorbance (A) at wavelength of 510nm with spectrophotometer ₅₁₀ ) The total flavone concentration in the sample is calculated by a rutin standard curve (figure 2), and the total flavone mass is obtained by multiplying the concentration by the volume of the measured sample.

Drawing a rutin standard curve: and preparing a rutin standard substance solution with the concentration of 0.25g/L by using a 60% ethanol water solution by volume fraction. Respectively taking rutin standard substance solutions 0, 0.5, 1.0, 1.5, 2.0 and 2.5mL in a 10-mL graduated test tube, supplementing the rutin standard substance solutions to 2.5mL by using a volume fraction of 60% ethanol aqueous solution, adding 0.4mL of a mass concentration 5% sodium nitrite aqueous solution, standing for 6min, adding 0.6mL of a mass concentration 10% aluminum nitrate aqueous solution, standing for 6min, adding 2mL of a mass concentration 20% sodium hydroxide aqueous solution, and fixing the volume of the rutin standard substance solution to the volume fraction 60% ethanol aqueous solution10mL, shaking up, standing for 15min, and measuring absorbance at wavelength of 510nm with a spectrophotometer (A ₅₁₀ ). Rutin concentration is taken as an abscissa, A ₅₁₀ A standard curve is plotted for the ordinate (fig. 2).

The yield of the total flavone extracted from the lotus leaves is calculated according to the following formula:

example 2: mutagenesis breeding of enzyme-producing strain HY4

The strain HY4 is subjected to mutation breeding, and the strain with better enzyme production performance is screened, and the specific method comprises the following steps:

(1) Preparation of spore liquid: after the strain HY4 was subjected to activation culture at 28℃for 48 hours in PDA plate medium, 5mL of sterile physiological saline was added, and spores were suspended by stirring with an inoculating loop. 1mL of the spore liquid was transferred to a Erlenmeyer flask (containing 20-30 glass beads) filled with 50mL of sterile physiological saline, and the mixture was shaken at room temperature for 15min. Filtering spore liquid to remove mycelium (filling small absorbent cotton at bottom of triangular funnel), counting spores in filtrate under microscope with blood cell counting plate, diluting with sterile physiological saline, and adjusting spore amount to 1.46×10 ⁷ And each mL.

(2) Mutagenesis: under the illumination of red light, 1.0mL of the spore liquid and a piece of sterile paperclip are respectively taken in 5 culture dishes with the diameter of 6cm, the culture dishes are respectively placed on a magnetic stirrer, and the positions, which are preheated for 30min and are 30cm away from a 15W ultraviolet lamp, are respectively irradiated for 1, 2,3, 4 and 5min. 0.5mL of the spore liquid after the irradiation treatment was diluted by a proper factor, and 0.1mL of the PDA-coated plate medium was removed. In the same manner, a spore liquid dilution plating plate without ultraviolet irradiation was used as a control to calculate the mortality rate. The inoculated PDA plates were wrapped with black cloth, incubated for 36h at 28℃upside down, colonies on the plates were counted and mortality was calculated.

(3) Screening: colonies on PDA plates with mortality of more than 90% were picked up and transferred to fresh PDA plate medium to obtain 38 strains. Each strain was cultured at 28℃for 60 hours in fresh plate cultures, 10mL of sterile physiological saline was added, and spores were suspended by stirring with an inoculating loop to obtain spore solutions of each strain. Taking 2mL of spore liquid of each strain, inoculating the spore liquid into 50mL of enzyme-producing culture medium, carrying out shaking culture at 30 ℃ for 72h at 200r/min, carrying out suction filtration on fermentation liquor by using a Buchner funnel, collecting filtrate, and measuring cellulase activity of fermentation filtrate of each strain. And selecting 10 strains with relatively higher enzyme activity than the wild strains. The lotus leaf is subjected to enzymolysis by using the crude enzyme fermented by the 10 strains according to the method of example 1, the total flavone is extracted by ethanol ultrasonic, and the total flavone extraction rate after the lotus leaf is subjected to enzymolysis by using the crude enzyme of the re-screened mutant strain is shown in Table 2.

TABLE 2 Total flavonoid extraction yield after enzymatic hydrolysis of lotus leaves with crude enzyme solution of rescreened mutant strains

As can be seen from the data in Table 2, the activity of cellulase produced by fermentation of 10 strains with the number of HY4-25 is 122U/mL, which is improved by 47.5% compared with 83.4U/mL of the wild strain HY4, the total flavone extraction rate is 6.37% after the lotus leaf is subjected to enzymolysis by using the crude enzyme liquid prepared by fermentation of the strain, which is improved by 12.9% compared with 4.73% of the wild strain HY4, and is improved by 34.7% compared with the control 4.73% without enzymolysis. Therefore, the HY4-25 strain is selected as an enzyme-producing strain for improving the extraction rate of lotus leaf total flavonoids.

And the cellulase activity is determined: adding 1.5mL of 1% sodium carboxymethylcellulose solution (pH 6.0,0.2mol/L phosphate buffer solution) and 0.5mL of crude enzyme solution into 10-mL graduated test tube, respectively, maintaining the temperature in 50 ℃ water bath for 30min, adding 3mL of DNS reagent, boiling for 5min, cooling with running water, adding deionized water to constant volume of 10mL, shaking, taking the inactivated crude enzyme solution after boiling for 10min at 100deg.C as reference, measuring absorbance at 540nm (A ₅₄₀ ) The glucose concentration in the sample was calculated from the glucose standard curve (FIG. 3), and cellulase activity (U/mL) was calculated. Definition of cellulase activity: the amount of enzyme required for hydrolyzing sodium carboxymethylcellulose to 1 μg glucose per minute at pH 6.0 and 50deg.C is 1 enzyme activityForce unit (U).

Cellulase activity was calculated according to the following formula (1).

In the formula (1), C: glucose concentration (mg/mL) calculated from the standard curve; v (V) ₁ : the volume of the enzyme reaction system is 2mL; t: the reaction time is 30min; v (V) ₂ : the crude enzyme solution volume, i.e., 0.5mL.

Drawing a glucose standard curve: to 6 10-mL graduated test tubes, 0,0.2, 0.4, 0.6, 0.8, 1.0 and 1.2mL of a standard glucose aqueous solution having a concentration of 1mg/mL were added, respectively, followed by adding 2.0, 1.8, 1.6, 1.4, 1.2, 1.0 and 0.8mL of a phosphate buffer having a pH of 6.0,0.2mol/L, and 3.0mL of a DNS solution, respectively. Boiling the mixture in boiling water bath for 5min, cooling with running water, adding deionized water to volume of 10mL, shaking, and measuring A with spectrophotometer ₅₄₀ On the abscissa, the glucose concentration, A ₅₄₀ A standard curve is plotted for the ordinate (fig. 3).

Preparing a DNS reagent: 6.3g of 3, 5-dinitrosalicylic acid and 262mL of 2mol/L NaOH aqueous solution are added into 500mL of hot aqueous solution containing 182g of sodium tartrate, 5g of distilled phenol and 5g of sodium sulfite are added, stirred and dissolved, cooled, added with deionized water to a volume of 1L, stored in a brown bottle and used after 7 d.

Example 3: classification and identification of strain HY4-25

Bacterial strain HY4-25 is streaked and inoculated on a PDA plate culture medium, after culturing for 48 hours at 28 ℃, the front surface of a bacterial colony is black, a large amount of black particles are arranged on the surface, the center of a reverse bacterial colony is yellow brown, no exudates exist, and no soluble pigment exists in the culture medium; conidiophores occur in the matrix with a diameter of 10-15 μm; the top sac is nearly spherical and has a diameter of 50-70 mu m; the periphery of the apical sac is provided with double layers of small conidium stems with different lengths, conidium is generated on the outer small stems, and the conidium head shape is typical chrysanthemum shape; conidium has brown sphere shape with diameter of 3.0-4.0 μm and rough surface. A photograph of a colony of Aspergillus niger HY4-25 cultured on PDA plate medium at 28℃for 48h is shown in FIG. 1.

The rDNA-ITS nucleotide sequence of strain HY4-25 was determined to be shown as SEQ ID NO.1, and this sequence was subjected to BLAST alignment at NCBI (National Center for Biotechnology Information, https:// www.ncbi.nlm.nih.gov) with 100% homology to the rDNA-ITS sequences of the typical strains Aspergillus niger (Aspergillus niger) ATCC16888, aspergillus foetidus (Aspergillus foetidus) CBS 121.28 and Aspergillus glaucus (Aspergillus welwitschiae) CBS 139.54. However, the morphological characteristics of the bacterial strain HY4-25 better conform to the characteristics of Aspergillus niger, so that the biological classification position of the bacterial strain HY4-25 is determined as (refer to Mycobank, http:// www.mycobank.org): fungi kingdom (Fungi), ascomycota (Ascomycota), ascomycota (pezizomycetina), ascomycota (Eurotiomycetes), eurotiomycetes (Eurotiomycetidae), ascomycota (Eurotiales), aspergillus (Aspergillus), aspergillus (Aspergillus niger).

The ITS region rDNA sequence is as follows:

CCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATAC。

in summary, the strain HY4 is separated from the lotus leaf powder microorganism concentrate, and after ultraviolet mutagenesis, the strain HY4-25, namely Aspergillus niger (Aspergillus niger) HY4-25, is obtained by screening, and is preserved in the Guangdong province microorganism strain collection center, with the preservation number: GDMCC No. 62851, storage date 2022, 9 months 25 days, address: building 5 of No. 59 of Qinghui No. 100 college in Guangzhou City of Guangdong; postal code 510070.

Example 4: application of aspergillus niger HY4-25 enzymolysis auxiliary extraction of lotus leaf total flavonoids

The method for extracting the total flavonoids from the lotus leaves by the aid of enzymolysis of the aspergillus niger HY4-25 can be operated according to the following steps:

(1) The Aspergillus niger HY4-25 spore powder stored in the freeze-drying tube is inoculated in a fresh PDA flat-plate culture medium, cultured for 60 hours at 30 ℃,10 mL of sterile physiological saline is added into the flat-plate culture, and spores are suspended by stirring with an inoculating loop, so that the spore liquid of the Aspergillus niger HY4-25 is obtained. The PDA plate medium composition and formulation method are the same as in example 1.

(2) Inoculating 50mL of enzyme-producing culture medium (the volume fraction of the inoculum size is 4%) with 2mL of the spore liquid prepared in the step (1), and culturing for 72h at 30 ℃ under the shaking condition of 200r/min to obtain fermentation liquor with the dry thallus concentration of 5.22 g/L. And (3) carrying out suction filtration on all fermentation liquor by using a Buchner funnel, wherein the collected filtrate is crude enzyme solution, and the cellulase activity of the filtrate is 119U/mL. The final concentration composition and preparation method of the enzyme-producing medium are the same as those of example 1.

(3) And (3) adding 5g of lotus leaf powder into a 250-mL triangular flask, adding 50mL of the crude enzyme solution prepared in the step (2) (the ratio of the materials to the enzyme is 1:10), uniformly stirring, and then carrying out enzymolysis at 35 ℃ for 6 hours to obtain a lotus leaf enzymolysis product.

(4) And (3) adding 75mL of absolute ethyl alcohol (1.5 times the volume of crude enzyme liquid, 60% of system ethyl alcohol volume fraction and 1:25) into all lotus leaf zymolyte in the step (3), shaking uniformly, placing in an ultrasonic cleaner with a water bath at 70 ℃, performing ultrasonic extraction for 60min at the power of 100W, and performing suction filtration by using a Buchner funnel to obtain a total flavone extract.

(5) Distilling the total flavone extract prepared in the step (4) under reduced pressure at 45 ℃ and minus 0.1MPa until no liquid flows out, adding 40mL of absolute ethyl alcohol (8 mL/g based on the mass of raw material lotus leaf powder), fully oscillating, transferring into a centrifuge tube, centrifuging for 5min at 8000r/min, distilling the supernatant at 45 ℃ and minus 0.1MPa to about 4mL, transferring into 1 clean culture dish, and vacuum drying at 50 ℃ and minus 0.1MPa to obtain the total flavone extract.

According to the steps, 0.815g of total flavone extract is obtained, the total flavone content is 37.5%, and 0.306g of total flavone is obtained, and the extraction yield is 6.12%.

Comparative example 1: conventional ethanol ultrasonic extraction of lotus leaf total flavonoids (compare with example 4)

(1) 5g of lotus leaf powder is put into a 250-mL triangular flask, 125mL of 60% ethanol water solution (the ratio of feed to liquid is 1:25) is added, the mixture is uniformly shaken, and then the mixture is put into an ultrasonic cleaner with water bath at 70 ℃ for ultrasonic extraction at power of 100W for 60min, and a Buchner funnel is used for suction filtration, so that the total flavone extract is obtained.

(2) Distilling the total flavone extract prepared in the step (1) under reduced pressure at 45 ℃ and minus 0.1MPa until no liquid flows out, adding 40mL of absolute ethyl alcohol (8 mL/g based on the mass of raw material lotus leaf powder), fully oscillating, transferring into a centrifuge tube, centrifuging for 5min at 8000r/min, distilling the supernatant at 45 ℃ and minus 0.1MPa to about 4mL, transferring into 1 clean culture dish, and vacuum drying at 50 ℃ and minus 0.1MPa to obtain the total flavone extract.

According to the steps, 0.645g of total flavone extract is obtained, the total flavone content is 35.4%, and 0.228g of total flavone is obtained, and the extraction yield is 4.56%.

The results of comparative example 4 and comparative example 1 can be seen: before extracting the lotus leaf total flavone, the enzymolysis treatment of the crude enzyme solution prepared by fermenting Aspergillus niger HY4-25 is added, the extraction yield of the total flavone is improved from 4.56% to 6.12%, and 34.2%.

Example 5: application of aspergillus niger HY4-25 enzymolysis auxiliary extraction of lotus leaf total flavonoids

(1) Inoculating colony spores of Aspergillus niger HY4-25 PDA preserved at 4deg.C into fresh PDA plate culture medium, culturing at 30deg.C for 54 hr, adding 10mL sterile physiological saline into the plate culture, and stirring with inoculating loop to suspend spores to obtain spore liquid of Aspergillus niger HY 4-25. The PDA plate medium composition and formulation method are the same as in example 1.

(2) Inoculating 100mL of enzyme-producing culture medium (the volume fraction of the inoculum size is 5%) with 5mL of the spore liquid prepared in the step (1), and culturing for 68h at 30 ℃ under the shaking condition of 250r/min to obtain fermentation liquor with the dry thallus concentration of 5.36 g/L. And (3) carrying out suction filtration on all fermentation liquor by using a Buchner funnel, wherein the collected filtrate is crude enzyme solution, and the cellulase activity of the filtrate is 127U/mL. The final concentration composition of the enzyme-producing culture medium is the same as that of example 1, 100mL of enzyme-producing culture medium is bottled by 250-mL triangle flask, 8 layers of gauze are tied up, and high-pressure steam is used for sterilization at 121 ℃ for 20min.

(3) Adding 10g of lotus leaf powder into a 500-mL Erlenmeyer flask, adding 80mL of the crude enzyme solution prepared in the step (2) (the ratio of the materials to the enzyme is 1:8), uniformly stirring, and then carrying out enzymolysis for 5h at 40 ℃ to obtain a lotus leaf enzymolysis product.

(4) And (3) adding 160mL of absolute ethyl alcohol (the volume of the crude enzyme liquid is 2 times that of the system ethyl alcohol, the volume fraction of the system ethyl alcohol is 66.7 percent, the feed-liquid ratio is 1:24) into all lotus leaf zymolytes in the step (3), shaking uniformly, placing into an ultrasonic cleaner with a water bath at 75 ℃, performing ultrasonic extraction for 50 minutes at the power of 150W, and performing suction filtration by a Buchner funnel to obtain a total flavone extracting solution.

(5) Distilling the total flavone extract prepared in the step (4) under reduced pressure at 45 ℃ and minus 0.1MPa until no liquid flows out, adding 60mL of absolute ethyl alcohol (6 mL/g based on the mass of raw material lotus leaf powder), fully oscillating, transferring into a centrifuge tube, centrifuging for 10min at 8000r/min, distilling the supernatant at 45 ℃ and minus 0.1MPa to about 6mL, transferring into 1 clean culture dish, and vacuum drying at 50 ℃ and minus 0.1MPa to obtain the total flavone extract.

According to the steps, 1.66g of total flavone extract is obtained, the total flavone content is 38.2%, and 0.634g of total flavone is obtained, and the extraction yield is 6.34%.

Comparative example 2: conventional ethanol ultrasonic extraction of lotus leaf total flavonoids (compare with example 5)

(1) 10g of lotus leaf powder is put into a 500-mL Erlenmeyer flask, 240mL of 66.7% ethanol water solution (feed-liquid ratio is 1:24) is added, the mixture is uniformly shaken, and then the mixture is put into an ultrasonic cleaner with 75 ℃ water bath, ultrasonic extraction is carried out for 50min at power of 150W, and suction filtration is carried out through a Buchner funnel, thus obtaining the total flavone extract.

(2) Distilling the total flavone extract prepared in the step (1) under reduced pressure at 45 ℃ and minus 0.1MPa until no liquid flows out, adding 60mL of absolute ethyl alcohol (6 mL/g based on the mass of raw material lotus leaf powder), fully oscillating, transferring into a centrifuge tube, centrifuging for 10min at 8000r/min, distilling the supernatant at 45 ℃ and minus 0.1MPa to about 6mL, transferring into 1 clean culture dish, and vacuum drying at 50 ℃ and minus 0.1MPa to obtain the total flavone extract.

According to the steps, 1.27g of total flavone extract is obtained, the total flavone content is 36.6%, and 0.465g of total flavone is obtained, and the extraction yield is 4.65%.

The results of comparative example 5 and comparative example 2 can be seen: before extracting the lotus leaf total flavonoids, the enzymolysis treatment of the crude enzyme liquid prepared by fermenting Aspergillus niger HY4-25 is added, and the extraction yield of the total flavonoids is improved from 4.65% to 6.34%, and is improved by 36.3%.

Example 6: application of aspergillus niger HY4-25 enzymolysis auxiliary extraction of lotus leaf total flavonoids

(2) Inoculating 300mL of enzyme-producing culture medium (the volume fraction of the inoculum size is 6%) with 18mL of the spore liquid prepared in the step (1), and culturing for 64h at 30 ℃ under the shaking condition of 250r/min to obtain fermentation liquor with the dry thallus concentration of 5.17 g/L. And (3) carrying out suction filtration on all fermentation liquor by using a Buchner funnel, wherein the collected filtrate is crude enzyme solution, and the cellulase activity of the filtrate is 116U/mL. The final concentration composition of the enzyme-producing culture medium is the same as that of 300mL enzyme-producing culture medium in a triangular flask of example 1,1-L, 8 layers of gauze are tied, and high-pressure steam is used for sterilization at 121 ℃ for 20min.

(3) 50g of lotus leaf powder is put into a 1-L triangular flask, 300mL of crude enzyme solution prepared in the step (2) (the ratio of materials to enzyme is 1:6) is added, and the mixture is stirred uniformly and then subjected to enzymolysis for 4 hours at 40 ℃ to obtain lotus leaf enzymatic hydrolysate.

(4) Adding 600mL of absolute ethyl alcohol (2 times of the volume of crude enzyme liquid, the volume fraction of system ethanol is 66.7 percent, and the feed-liquid ratio is 1:18) into all lotus leaf zymolytes in the step (3), shaking uniformly, placing into an ultrasonic cleaner with 75 ℃ water bath, performing ultrasonic extraction with power of 200W for 40min, and performing suction filtration by using a Buchner funnel to obtain total flavone extract.

(5) Distilling the total flavone extract prepared in the step (4) under reduced pressure at 45 ℃ and minus 0.1MPa until no liquid flows out, adding 200mL of ethanol (4 mL/g based on the mass of raw material lotus leaf powder), fully oscillating, transferring into a centrifuge tube, centrifuging for 10min at 8000r/min, distilling the supernatant at 45 ℃ and minus 0.1MPa until about 20mL, evenly distributing into 2 clean culture dishes, and vacuum drying at 50 ℃ and minus 0.1MPa to obtain the total flavone extract.

According to the steps, 8.25g of total flavone extract is obtained, the total flavone content is 38.3%, and 3.16g of total flavone is obtained, and the extraction yield is 6.32%.

Comparative example 3: general ethanol ultrasonic extraction of lotus leaf total flavonoids (compare with example 6)

(1) 50g of lotus leaf powder is put into a 1-L triangular flask, 900mL of 66.7% ethanol water solution (feed-liquid ratio is 1:18) is added, the mixture is uniformly shaken, and then the mixture is put into an ultrasonic cleaner with 75 ℃ water bath, ultrasonic extraction is carried out for 40min under the power of 200W, and a Buchner funnel is used for suction filtration, thus obtaining the total flavone extract.

(2) Distilling the total flavone extract prepared in the step (1) under reduced pressure at 45 ℃ and minus 0.1MPa until no liquid flows out, adding 200mL of ethanol (4 mL/g based on the mass of raw material lotus leaf powder), fully oscillating, transferring into a centrifuge tube, centrifuging for 10min at 8000r/min, distilling the supernatant at 45 ℃ and minus 0.1MPa until about 20mL, uniformly distributing into 2 clean culture dishes, and vacuum drying at 50 ℃ and minus 0.1MPa to obtain the total flavone extract.

According to the steps, 6.31g of total flavone extract is obtained, the total flavone content is 37.1%, 2.34g of total flavone is obtained, and the extraction yield is 4.68%.

The results of comparative example 6 and comparative example 3 can be seen: before extracting the lotus leaf total flavonoids, the enzymolysis treatment of the crude enzyme liquid prepared by fermenting Aspergillus niger HY4-25 is added, and the extraction yield of the total flavonoids is improved from 4.68% to 6.32%, and is improved by 35.0%.

Claims

1. Aspergillus niger (Aspergillus niger) HY4-25, deposited at the Guangdong province microorganism strain collection center, accession number: GDMCC No. 62851, storage date 2022, 9 months 25 days, address: building 5 of No. 59 of Qinghui No. 100 college in Guangzhou City of Guangdong; postal code 510070.

2. An application of aspergillus niger HY4-25 as claimed in claim 1 in extracting lotus leaf total flavonoids.

3. The application according to claim 2, wherein the method of application is: (1) Filtering a fermentation broth obtained by culturing Aspergillus niger HY4-25, and collecting filtrate, namely crude enzyme solution; (2) Mixing the crude enzyme solution with lotus leaf powder, performing enzymolysis at 35-40deg.C for 4-6 hr, adding anhydrous ethanol with volume 1.5-2.0 times of that of the crude enzyme solution into the enzymolysis system, performing ultrasonic extraction, and vacuum filtering to obtain total flavone extractive solution; (3) Evaporating the total flavone extract under reduced pressure, dissolving in ethanol, concentrating, and vacuum drying to obtain total flavone extract.

4. The use according to claim 3, wherein the crude enzyme solution of step (1) is prepared by the following steps: inoculating Aspergillus niger HY4-25 spores into an enzyme-producing culture medium, performing shaking culture at 30 ℃ and 200-250r/min for 64-72h, filtering fermentation liquor, and obtaining filtrate as crude enzyme liquor; the final concentration composition of the enzyme-producing culture medium is as follows: wheat bran 30-40g/L, (NH) ₄ ) ₂ SO ₄ 5-6g/L, peptone 3-4g/L, KH ₂ PO ₄ 3–5g/L，MgSO ₄ ·7H ₂ O 0.5–1.0g/L，CaCl ₂ 0.3–0.5g/L，FeSO ₄ ·7H ₂ 0.1-0.2g of O, tap water as solvent and pH of 6.0-6.5.

5. The use of claim 4, wherein the enzyme-producing medium consists of: 40g/L wheat bran, (NH) ₄ ) ₂ SO ₄ 5g/L peptone 4g/L KH ₂ PO ₄ 3 g/L，MgSO ₄ ·7H ₂ O 0.5g/L，CaCl ₂ 0.5g/L，FeSO ₄ ·7H ₂ O0.1 g, tap water as solvent, pH 6.0.

6. The use according to claim 4, wherein the aspergillus niger HY4-25 is cultured in a plate medium to produce spores before enzyme production culture, and the spores are suspended in physiological saline and are inoculated into the enzyme production medium for culture according to the volume fraction of 4% -6%, and the specific enzyme production culture method comprises the following steps:

(1) spore liquid preparation: inoculating Aspergillus niger HY4-25 into PDA plate culture medium, and culturing at 28-30deg.C for 54-60 hr to obtain plate culture; adding sterile physiological saline into the plate culture, and stirring with an inoculating loop to suspend spores to obtain Aspergillus niger HY4-25 spore liquid; the final concentration composition of the PDA plate culture medium is as follows: 200g/L of potato, 20g/L of glucose and 20g/L of agar, wherein the solvent is tap water, and the pH is natural;

(2) enzyme production culture: inoculating the inoculated Aspergillus niger HY4-25 spore liquid with the volume fraction of 4% -6% after the activation culture in the step (1) into an enzyme-producing culture medium, and carrying out shaking culture for 64-72h at the temperature of 30 ℃ and at the speed of 200-250r/min to obtain a fermentation broth.

7. The use according to claim 1, wherein the crude enzyme liquid volume in step (2) is 6-10mL/g based on the lotus leaf powder mass.

8. The use according to claim 1, wherein the lotus leaf powder in step (2) is a fine powder obtained by drying fresh lotus leaves at 85 ℃ and pulverizing, and sieving with a 40-mesh sieve.

9. The use according to claim 1, wherein the total flavone extract of step (2) is prepared by the following method: after the enzymolysis of the lotus leaves is finished, absolute ethyl alcohol with the volume of 1.5-2.0 times of the crude enzyme liquid is added into the system, and the mixture is stirred uniformly and then is placed into an ultrasonic cleaner with the water bath temperature of 70-75 ℃ for 100-200W extraction for 40-60min; and after the ultrasonic alcohol extraction is finished, carrying out suction filtration while the solution is hot to obtain a total flavone extracting solution.

10. The use according to claim 1, wherein the step (3) of recovering total flavonoids from the total flavonoids extract comprises: distilling the total flavone extract at 45 deg.C and-0.1 MPa until no liquid flows out, adding 4-8mL/g absolute ethanol by mass of lotus leaf, centrifuging at 8000r/min for 5-10min after full shaking, distilling the supernatant at 45 deg.C and-0.1 MPa to 1/10 of the original volume, and vacuum drying at 50 deg.C and-0.1 MPa to obtain total flavone extract.