CN113564055B - Felt Mao Qingmei DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves - Google Patents
Felt Mao Qingmei DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves Download PDFInfo
- Publication number
- CN113564055B CN113564055B CN202110844947.0A CN202110844947A CN113564055B CN 113564055 B CN113564055 B CN 113564055B CN 202110844947 A CN202110844947 A CN 202110844947A CN 113564055 B CN113564055 B CN 113564055B
- Authority
- CN
- China
- Prior art keywords
- eucommia ulmoides
- qingmei
- mao
- felt
- extraction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/46—Eucommiaceae (Eucommia family), e.g. hardy rubber tree
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N3/00—Spore forming or isolating processes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/10—Preparation or pretreatment of starting material
- A61K2236/19—Preparation or pretreatment of starting material involving fermentation using yeast, bacteria or both; enzymatic treatment
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/30—Extraction of the material
- A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
- A61K2236/333—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones using mixed solvents, e.g. 70% EtOH
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/50—Methods involving additional extraction steps
- A61K2236/51—Concentration or drying of the extract, e.g. Lyophilisation, freeze-drying or spray-drying
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a felt Mao Qingmei DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves, which is prepared by adding sterile sucrose aqueous solution into eucommia ulmoides leaf powder, inoculating felt Mao Qingmei DZ-9-67 spores, fermenting for 2-3d at 28-30 ℃, adding the fermented product into 50-70% ethanol aqueous solution for leaching, performing ultrasonic extraction, filtering, concentrating the filtrate to obtain a concentrate, and vacuum drying to obtain the crude extract of total flavonoids of eucommia ulmoides leaves. Compared with an ultrasonic ethanol extraction method without fermentation pretreatment, the extraction method for total flavonoids of eucommia ulmoides leaves provided by the invention can improve the extraction yield of total flavonoids of eucommia ulmoides leaves by 34.2%.
Description
Field of the art
The invention belongs to the technical field of biochemical engineering, and particularly relates to felt Mao Qingmei DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves.
(II) background art
Eucommia ulmoides (Eucommia ulmoides Oliv.) is also known as Bakelite, a plant of the genus eucommia of the family eucommia. Eucommia ulmoides has been cultivated in China for over two thousand years. The medicine effect of eucommia bark is recorded in Shennong Ben Cao Jing of the first book of China, and eucommia bark is classified as the top grade. The origin and efficacy of eucommia bark are described in more detail in Ming Dynasty Lishizhen, ben Cao gang mu. Eucommia ulmoides (Eucommia Cortex) and eucommia ulmoides leaves (Eucommia Folium) are recorded in one part of Chinese pharmacopoeia and decoction pieces of 2020 edition. The pharmacopoeia records the functions and indications of eucommia ulmoides are: liver and kidney tonifying, tendons and bones strengthening, miscarriage preventing. Can be used for treating liver and kidney deficiency, soreness of waist and knees, weakness of tendons and bones, dizziness, blood leakage during pregnancy, and fetal irritability; the function and main indications of the eucommia ulmoides leaf are as follows: liver and kidney tonifying and tendons and bones strengthening. Can be used for treating deficiency of liver and kidney, dizziness, soreness of waist and knees, and flaccidity of tendons and bones.
Eucommia ulmoides leaves contain various bioactive components including lignans, iridoids, phenylpropanoids, flavonoids, polysaccharides and other compounds, wherein the flavonoids have high content, and analysis of Zhong Shujuan shows that: the average content of total flavonoids in eucommia bark, leaf, male flower and seed is 1.33%, 9.02%, 3.02% and 1.22% [ Zhong Shujuan, yang Xin, li Jing ], etc. the content of total flavonoids in different parts of eucommia bark and antioxidant activity are studied, china pharmacy, 2017,28 (13): 1787-1790]. The flavonoid compound has good effects in resisting oxidation, inhibiting lipid peroxidation, preventing atherosclerosis, protecting cardiovascular and cerebrovascular, preventing and resisting cancer, and has wide application in the fields of auxiliary medicines and health foods. The eucommia ulmoides leaf has rich flavone content, and is a good raw material for extracting the flavone.
At present, more domestic methods for extracting total flavonoids of eucommia ulmoides leaves are reported, and mainly comprise a water extraction method, an organic solvent extraction method, an ultrasonic or microwave auxiliary extraction method and CO 2 Supercritical extraction, enzyme-assisted extraction, semi-bionic extraction, etc. The different extraction methods have respective advantages and disadvantages, and the total flavone yields are also greatly different. The water extraction method has low cost, but the total flavone yield is lower; the yield of the total flavonoids by the organic solvent extraction method is obviously improved, but a large amount of organic solvents are needed; the ultrasonic or microwave assisted extraction method is added with ultrasonic or microwave treatment on the basis of the organic solvent extraction method, so that the dissolution of the total flavonoids is promoted, and the extraction yield is improved to a certain extent; CO 2 The supercritical extraction method can obtain higher extraction yield and product purity, but has higher equipment requirement; the extraction condition of the enzyme-assisted extraction method is mild, active substances are not easy to inactivate, but the cost of commercial pure enzyme is higher; the semi-bionic extraction method has complex process and is easy to destroy the structure of flavone by high-temperature decoction. In contrast, several methods, superelevationThe sonic assisted solvent extraction has certain advantages.
In order to improve the extraction yield of the total flavonoids of the eucommia ulmoides leaves, the invention improves the ultrasonic-assisted extraction process of the total flavonoids of the eucommia ulmoides leaves, and adds the microbial fermentation pretreatment step, so that the extraction yield of the total flavonoids of the eucommia ulmoides leaves can be obviously improved.
(III) summary of the invention
The invention aims to provide a novel microorganism strain-felt Mao Qingmei (Penicillium velutinum) DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves, which can obviously improve the extraction yield of the total flavonoids of eucommia ulmoides leaves.
The technical scheme adopted by the invention is as follows:
the invention provides a fermentation pretreatment microorganism strain-felt Mao Qingmei (Penicillium velutinum) DZ-9-67 for extracting total flavonoids of eucommia ulmoides leaves, which is preserved in the microorganism strain preservation center of Guangdong province, with a preservation number: GDMCC No. 61728, storage date 2021, 21 months, address: building 5 of No. 59 of Qinghui No. 100 college in Guangzhou City of Guangdong; postal code 510070.
The felt Mao Qingmei DZ-9-67 is an excellent strain obtained by separating from a microorganism enrichment culture of eucommia ulmoides leaves, screening and mutagenizing and breeding. The colony morphology of felt Mao Qingmei DZ-9-67 was characterized as follows: culturing on Potato Dextrose Agar (PDA) plate culture medium at 28deg.C for 3d, wherein the initial stage of colony is gray fine short fluff, and then gradually changes into green to olive green, the middle part is raised and other parts are flat, hypha is short, and a large amount of powder conidium is generated on the surface. Generating conidiophores at the top of aerial hyphae, branching 1-4 branches at the top of the stems, and dividing terminal cells of each branch into strings of conidiophores to form typical broom-shaped conidiophore ears; the conidium is spherical or approximately spherical, and has a diameter of 2.5-3.0 μm and is green. A photograph of a colony of felt Mao Qingmei DZ-9-67 cultured for 3d at 28℃on PDA plate medium is shown in FIG. 1.
The nucleotide sequence of the rDNA ribosome transcription spacer (rDNA-ITS) of the felt Mao Qingmei DZ-9-67 is shown in SEQ ID NO. 1.
The invention also provides an application of the felt Mao Qingmei DZ-9-67 in extraction of total flavonoids of eucommia ulmoides leaves, and the application method comprises the following steps: adding sterile sucrose water solution into folium Eucommiae powder, inoculating felt Mao Qingmei DZ-9-67 spores, fermenting at 28-30deg.C for 1.5-3d, adding the fermented product into ethanol water solution, leaching, performing ultrasonic extraction, vacuum filtering, concentrating the filtrate to obtain concentrate, and vacuum drying to obtain folium Eucommiae total flavone crude extract.
Further, the concentration of the sterile sucrose aqueous solution is 3-5g/L, the sterile sucrose aqueous solution is sterilized by high-pressure steam at 121 ℃ for 15min, the volume dosage of the sterile sucrose aqueous solution is 1.0-1.5mL/g based on the weight of eucommia ulmoides leaf powder, and the inoculation amount of the felt Mao Qingmei DZ-9-67 spores is 5 multiplied by 10 based on the weight of the eucommia ulmoides leaf powder 7 –7×10 7 Individual/g; the eucommia ulmoides leaf powder is obtained by drying and crushing mature green eucommia ulmoides leaves and sieving the crushed eucommia ulmoides leaves with a 20-mesh sieve.
Further, the felt Mao Qingmei DZ-9-67 spores are added in the form of spore liquid, and the preparation method of the spore liquid comprises the following steps: inoculating the low-temperature preserved felt Mao Qingmei DZ-9-67 to Potato Dextrose (PDA) plate culture medium, culturing at 28-30deg.C for 1.5-2d, adding sterile physiological saline into a culture dish, and suspending spores with inoculating loop stirring to obtain spore liquid; preferably, the spore solution is transferred into a sterile test tube, and the spore concentration is adjusted to 5×10 with sterile physiological saline 8 –7×10 8 And each mL. The final concentration composition of the PDA plate culture medium is as follows: 200g/L potato (cut into small blocks with a side length of about 1cm, boiled for 20min and filtered to leave juice), 20g/L glucose, 20g/L agar, tap water as solvent and natural pH (measured about 6.5).
Further, the preparation method of the concentrate comprises the following steps: adding the fermented product into an ethanol water solution with the volume concentration of 50% -70%, uniformly stirring, placing in a water bath with the temperature of 60-70 ℃ for leaching for 2-4h, and then transferring into an ultrasonic cleaner with the temperature of 50 ℃ for ultrasonic extraction for 30-60min at the temperature of 200-300W; after ultrasonic alcohol extraction is finished, filtering while the solution is hot, concentrating the filtrate at 45 ℃ under reduced pressure to 1/15-1/25 of the original volume to obtain a concentrate; the dosage of the ethanol aqueous solution is 15-25mL/g based on the weight of eucommia ulmoides leaf powder before fermentation.
Further, the vacuum drying conditions are: vacuum drying at 50deg.C under 0.1MPa to constant weight.
Compared with the prior art, the invention has the beneficial effects that: before total flavone is extracted from folium Eucommiae by ultrasonic ethanol, fermentation pretreatment of felt Mao Qingmei DZ-9-67 is added. Felt Mao Qingmei DZ-9-67 is an excellent strain obtained by screening from a microorganism enrichment culture of eucommia ulmoides leaves and carrying out mutation breeding, and is moderately grown in eucommia ulmoides leaf powder to generate polysaccharide hydrolase, hydrolyze substances such as eucommia ulmoides leaf cellulose, hemicellulose and pectin, so that the structure tissue of the eucommia ulmoides leaves is loose, and flavonoid compounds are easier to dissolve out during ultrasonic ethanol extraction. Compared with an ultrasonic ethanol extraction method without fermentation pretreatment, the extraction method for total flavonoids of eucommia ulmoides leaves provided by the invention can improve the extraction yield of total flavonoids of eucommia ulmoides leaves by 34.2%.
(IV) description of the drawings
FIG. 1 is a photograph of colony morphology of felt Mao Qingmei DZ-9-67.
FIG. 2 is a standard curve of total flavonoids (rutin as a standard) determined spectrophotometrically.
(fifth) detailed description of the invention
The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:
the eucommia ulmoides leaf disclosed by the invention is a dry leaf of eucommia ulmoides (Eucommia ulmoides Oliv.) belonging to the family eucommia, the traditional Chinese medicine material is Eucommiae Folium, and the eucommia ulmoides leaf is picked up in summer and autumn when Ji Zhishe is luxuriant, and is dried in the sun or dried at a low temperature. The folium Eucommiae powder is prepared by pulverizing dried folium Eucommiae, and sieving with 20 mesh sieve.
Example 1: isolation and screening of fermentation strains
Microbial strains of fermented eucommia ulmoides leaves are separated and screened according to the following steps:
(1) About 5g of eucommia ulmoides leaf powder is added into a 250-mL triangular flask, 5mL of sterile physiological saline is added for wetting, and the mixture is cultured for 4 days at the constant temperature of 28 ℃. Diluting the enriched culture of the grown mould with sterile physiological saline for 1×10 respectively -6 、1×10 -7 、1×10 -8 After doubling, respectively sucking 0.1mL of the diluent, coating on Potato Dextrose Agar (PDA), culturing at constant temperature of 28 ℃ for 2d, and picking up mould colonies with different colors and formsFresh PDA plate culture medium is transferred, and the culture is carried out for 3d at the constant temperature of 28 ℃ to obtain 14 strains of pure culture strains, and the serial numbers of the strains are shown in table 1.
(2) Adding 5mL of sterile physiological saline into fresh plate culture of 14 strains, stirring with inoculating loop to suspend spores, transferring spore solution into sterile test tube, and adjusting spore concentration to 5×10 with sterile physiological saline 8 The spore liquid of each strain is obtained by each/mL.
(3) Eight layers of gauze are tied into 250-mL triangular flask, and then are subjected to dry heat sterilization at 160 ℃ for 2 hours, 10g of eucommia ulmoides leaf powder is added, 10mL of sterile sucrose aqueous solution with the concentration of 3g/L is added, and then 1mL of spore liquid of each strain in the step (2) is inoculated, and the mixture is stirred uniformly. The triangular flask was tied up with eight layers of gauze and cultured for 3d at 28 ℃.
(4) Adding 150mL of 50% ethanol water solution with volume concentration into the whole eucommia ulmoides leaf powder subjected to fermentation in the step (3), shaking uniformly, placing in a water bath at 60 ℃ for leaching for 2h, and then transferring into an ultrasonic cleaner at 50 ℃ for ultrasonic extraction at 200W for 30min. After the ultrasonic alcohol extraction is finished, the filter is pumped and filtered by a Buchner funnel while the filter is hot, and the content of total flavonoids in the filtrate is measured by an HPLC method.
Under the same conditions, the non-inoculated mould spore liquid is used as the non-fermented eucommia ulmoides leaf powder control. The extraction yield of total flavonoids after the eucommia ulmoides leaf powder is fermented by different strains is shown in table 1.
TABLE 1 extraction yield of Total Flavonoids after fermentation of eucommia ulmoides leaves by different strains
As can be seen from the data in Table 1, the extraction yield of total flavonoids is improved to 16.6% by the highest extent compared with the unfermented control after the eucommia ulmoides leaf powder is fermented by the strain DZ-9, and the strain is selected as a fermentation strain for improving the extraction yield of total flavonoids of eucommia ulmoides leaves.
The PDA plate culture medium is prepared according to the following composition and method: cleaning potato, peeling, cutting into small blocks with side length of about 1cm, weighing 200g, adding 1000mL of tap water, boiling for 20min, filtering with 4 layers of gauze, removing residues, supplementing the filtrate to 1000mL, adding 20g of glucose and 20g of agar, naturally measuring pH (about 6.5), heating to dissolve agar, packaging in triangular flask, sterilizing at 121deg.C for 20min under high pressure, pouring into sterile culture dishes with diameter of 9cm before solidification, and 15-20mL per dish.
The content of the total flavonoids in the eucommia ulmoides leaves is determined by a spectrophotometry, and the method specifically comprises the following steps: 5.0mL folium Eucommiae total flavone extract (sampling amount is properly adjusted according to total flavone concentration in sample, and measurement A is controlled) 510 Between 0.2 and 0.7, dissolving the crude extract with 60% ethanol aqueous solution), adding sodium nitrite (NaNO) with mass concentration of 5% into 25-mL colorimetric tube 2 ) 1.0mL of aqueous solution, standing for 6min, adding 10% aluminum nitrate [ Al (NO) 3 ) 3 ]1.5mL of aqueous solution, standing for 6min, adding 4mL of aqueous solution of sodium hydroxide (NaOH) with mass concentration of 20%, fixing volume to 25mL with aqueous solution of ethanol with volume concentration of 60%, shaking, standing for 15min, and measuring absorbance at 510nm (A) 510 ) And calculating the total flavone content in the sample according to a rutin standard curve, and multiplying the total flavone content by the volume of the measured sample to obtain the total flavone mass.
Drawing a rutin standard curve: and preparing a rutin standard substance solution with the concentration of 0.2g/L by using a 60% ethanol water solution by volume. Respectively taking rutin standard solution 0, 1.0, 2.0, 3.0, 4.0 and 5.0mL in a 25mL colorimetric tube, supplementing 5.0mL with 60% ethanol aqueous solution, adding 1.0mL with 5% sodium nitrite aqueous solution, standing for 6min, adding 1.5mL with 10% aluminum nitrate aqueous solution, standing for 6min, adding 4mL with 20% sodium hydroxide aqueous solution, fixing volume to 25-mL with 60% ethanol aqueous solution, shaking, standing for 15min, and measuring absorbance at 510nm (A 510 ). Rutin concentration is taken as an abscissa, A 510 A standard curve is plotted for the ordinate (fig. 2).
The extraction rate of the total flavonoids of the eucommia ulmoides leaves is calculated according to the following formula:
example 2: mutagenesis breeding of fermentation strain DZ-9
The strain DZ-9 is subjected to mutation breeding, and strains with excellent fermentation performance are screened, and the specific method is as follows:
(1) Preparation of spore liquid: after the strain DZ-9 is subjected to activation culture for 2d at 28 ℃ through a PDA plate culture medium, 5mL of sterile physiological saline is added, the spores are suspended by stirring through an inoculating loop, and then the spores are transferred into a triangular flask containing 45mL of sterile physiological saline (20-30 glass beads are added), and the spores are oscillated for 20min at room temperature. Filtering spore suspension to remove mycelium (2 layers of mirror cleaning paper on triangular funnel pad), counting spores in suspension with blood cell counting plate under microscope, diluting with sterile physiological saline, and adjusting spore number to 1×10 8 And each mL.
(2) Mutagenesis: under the illumination of red light, respectively taking 2.0mL of the spore suspension and a piece of sterile paperclip into 5 culture dishes with the diameter of 6cm, respectively placing the culture dishes on a magnetic stirrer, and respectively irradiating 1, 2, 3, 4 and 5min at the distance of 30cm of a 15W ultraviolet lamp preheated for 30min. 0.5mL of the spore liquid after the irradiation treatment was diluted by a proper factor, and 0.1mL of the PDA-coated plate medium was removed. In the same manner, a spore liquid dilution plating plate without ultraviolet irradiation was used as a control to calculate the mortality rate. The inoculated PDA plates were wrapped with black cloth, incubated for 1.5d at 28℃upside down, colonies on the plates were counted and mortality was calculated.
(3) Screening: colonies with a mortality rate of 90% or more on PDA plates were picked up and transferred to fresh PDA plate medium and the mutant strains were screened as described in example 1. Through 2 rounds of screening, a strain with the number of DZ-9-67 is obtained from 85 strains, and the fermentation performance of improving the extraction rate of total flavonoids of eucommia ulmoides leaves is best. After the eucommia leaves are fermented by the strain, the extraction yield of the total flavone is 9.72%, which is improved by 13.6% compared with 8.56% of the extracted strain DZ-9, and is improved by 32.4% compared with 7.34% of the unfermented control. The DZ-9-67 strain is subjected to transfer passage for 5 times, and the fluctuation range of the total flavone extraction rate after each generation of fermenting eucommia leaves is less than 10%, which shows that the strain has good genetic stability.
Example 3: classification and identification of Strain DZ-9-67
The strain DZ-9-67 is inoculated on a PDA flat plate culture medium and cultured for 3 days at 28 ℃, the initial stage of a bacterial colony is in an off-white fine short velvet shape, then the bacterial colony gradually turns green to olive green, the middle part of the bacterial colony is raised, the other parts of the bacterial colony are flat, hyphae are shorter, and a large amount of powdery conidium is generated on the surface of the bacterial colony. Generating conidiophores at the top of aerial hyphae, branching 1-4 branches at the top of the stems, and dividing terminal cells of each branch into strings of conidiophores to form typical broom-shaped conidiophore ears; the conidium is spherical or approximately spherical, and has a diameter of 2.5-3.0 μm and is green. A photograph of a colony of felt Mao Qingmei DZ-9-67 cultured for 3d at 28℃on PDA plate medium is shown in FIG. 1.
The strain DZ-9-67 was submitted to BLAST alignment at NCBI (National Center for Biotechnology Information, https:// www.ncbi.nlm.nih.gov) with greater than 99% homology to 5 known strains of felt Mao Qingmei (Penicillium velutinum), as shown in SEQ ID NO.1 for ITS ribosomal ITS region rDNA nucleotide sequence as determined by biological engineering (Shanghai). Based on the colony characteristics of the strain DZ-9-67 and the rDNA-ITS nucleotide sequence comparison result, the biological classification position of the strain DZ-9-67 can be determined as follows (refer to Mycobank, http:// www.mycobank.org): fungus kingdom (Fungi), ascomycota (Ascomycota), ascomycota (Eurotiomycetes), ascomycota (Eurotiales), aspergillum (aspergillus aculeatus), penicillium (Penicillium), felt Mao Qingmei (Penicillium velutinum).
The ITS region rDNA sequence is:
TCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCTTCTGCCCTCTGGCCCGCGCCCGCCGAAGACACCATTGAACGCTGTCTGAAGATTGCAGTCTGAGCAATTAGCTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCTTGTAGGCCCGGCCGGCGCTTGCCGACAACAATCAATCTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT。
in summary, the strain DZ-9 separated from the microorganism enrichment of eucommia ulmoides leaf powder is subjected to ultraviolet mutagenesis, and then the strain DZ-9-67, namely felt Mao Qingmei (Penicillium velutinum) DZ-9-67, is obtained by screening, and is preserved in the Guangdong province microorganism strain collection center, with the preservation number: GDMCC No. 61728, storage date 2021, 21 months, address: building 5 of No. 59 of Qinghui No. 100 college in Guangzhou City of Guangdong; postal code 510070.
Example 4: felt Mao Qingmei DZ-9-67 for extracting total flavonoids from folium Eucommiae
Felt Mao Qingmei DZ-9-67 is applied to extraction of total flavonoids of eucommia ulmoides leaves, and can be operated according to the following steps:
(1) Inoculating the low-temperature preserved felt Mao Qingmei DZ-9-67 (lyophilized tube or plate colony) into fresh PDA plate culture medium, culturing at 30deg.C for 2d, adding 5mL of sterile physiological saline into culture dish, suspending spores with stirring of inoculating loop, transferring spore liquid into sterile test tube, and adjusting spore concentration to 5×10 with sterile physiological saline 8 And each mL. The PDA plate medium composition and formulation method are the same as in example 1.
(2) Sterilizing eight layers of gauze-tied 250-mL triangular flask at 160deg.C for 2 hr, adding 10g of folium Eucommiae powder, adding 10mL of 3g/L sterile sucrose water solution, inoculating 1mL of spore solution of felt Mao Qingmei DZ-9-67 prepared in step (1) (spore inoculation concentration is 5×10) 7 Per gram), and stirring uniformly. Tying the triangular flask with eight layers of gauze, and culturing at 30deg.C for 2d to obtain fermented product.
(3) And (3) adding 150mL of 50% ethanol water solution by volume concentration into the whole fermentation product in the step (2), uniformly stirring, placing in a water bath at 60 ℃ for leaching for 2 hours, and then transferring into an ultrasonic cleaner at 50 ℃ for ultrasonic extraction at 200W for 30 minutes. After the ultrasonic alcohol extraction is finished, filtering the solution by a hot Buchner funnel, and concentrating the filtrate to 10mL under reduced pressure at 45 ℃ to obtain the total flavone concentrate.
(4) And (3) vacuum drying all the concentrate in the step (3) at 50 ℃ and 0.1MPa for 10 hours to constant weight, and grinding the concentrate into fine powder to obtain the crude extract of total flavonoids of eucommia ulmoides leaves.
According to the steps, 3.91g of eucommia ulmoides leaf total flavone crude extract with the total flavone content of 24.6 g is obtained, 0.963g of eucommia ulmoides leaf total flavone is obtained, the extraction yield is 9.63%, and the product is dark brown powder.
Example 5: felt Mao Qingmei DZ-9-67 for extracting total flavonoids from folium Eucommiae
Felt Mao Qingmei DZ-9-67 is applied to extraction of total flavonoids of eucommia ulmoides leaves, and can be operated according to the following steps:
(1) Inoculating the low-temperature preserved felt Mao Qingmei DZ-9-67 (lyophilized tube or plate colony) into fresh PDA plate culture medium, culturing at 30deg.C for 1.5d, adding 5mL of sterile physiological saline into culture dish, suspending spores with stirring of inoculating loop, transferring spore liquid into sterile test tube, and adjusting spore concentration to 6×10 with sterile physiological saline 8 And each mL. The PDA plate medium composition and formulation method are the same as in example 1.
(2) Sterilizing eight layers of gauze-tied 250-mL triangular flask at 160deg.C for 2 hr, adding 10g folium Eucommiae powder, adding 12.5mL sterile sucrose water solution with concentration of 4g/L, inoculating 1mL spore solution of felt Mao Qingmei DZ-9-67 prepared in step (1) (spore inoculation concentration is 6X10) 7 Per gram), and stirring uniformly. The triangular flask was tied up with eight layers of gauze and incubated at 30deg.C for 2.5d to give a fermented product.
(3) Transferring all the fermented products in the step (2) into a 500-mL triangular flask, adding 200mL of 60% ethanol water solution by volume concentration, uniformly stirring, placing in a 65 ℃ water bath for leaching for 3h, and then transferring into a 50 ℃ ultrasonic cleaner for ultrasonic extraction for 45min at 250W. After the ultrasonic alcohol extraction is finished, filtering the solution by a hot Buchner funnel, and concentrating the filtrate to 10mL under reduced pressure at 45 ℃ to obtain the total flavone concentrate.
(4) And (3) vacuum drying all the concentrate in the step (3) at 50 ℃ and 0.1MPa for 10 hours to constant weight, and grinding the concentrate into fine powder to obtain the crude extract of total flavonoids of eucommia ulmoides leaves.
According to the steps, 3.37g of eucommia ulmoides leaf total flavone crude extract with the total flavone content of 29.3 percent is obtained, 0.988g of eucommia ulmoides leaf total flavone is obtained, the extraction yield is 9.88 percent, and the product is dark brown powder.
Example 6: felt Mao Qingmei DZ-9-67 for extracting total flavonoids from folium Eucommiae
Felt Mao Qingmei DZ-9-67 is applied to extraction of total flavonoids of eucommia ulmoides leaves, and can be operated according to the following steps:
(1) The low-temperature preserved felt Mao Qingmei DZ-9-67 (freeze-dried tube or plate colony) is inoculated on fresh PDA plate culture medium and cultured at constant temperature of 28 ℃ for 15d, adding 5mL of sterile physiological saline into a culture dish, stirring with an inoculating loop to suspend spores, transferring the spore liquid into a sterile test tube, and adjusting the spore concentration to 7×10 with the sterile physiological saline 8 And each mL. The PDA plate medium composition and formulation method are the same as in example 1.
(2) Sterilizing eight layers of gauze-tied 250-mL triangular flask at 160deg.C for 2 hr, adding 10g folium Eucommiae powder, adding 15mL sterile sucrose water solution with concentration of 5g/L, inoculating 1mL spore solution of felt Mao Qingmei DZ-9-67 prepared in step (1) (spore inoculation concentration is 7X10) 7 Per gram), and stirring uniformly. Tying the triangular flask with eight layers of gauze, and culturing at 28deg.C for 3d to obtain fermented product.
(3) Transferring all the fermented products in the step (2) into a 500-mL triangular flask, adding 250mL of 70% ethanol water solution by volume concentration, uniformly stirring, placing in a water bath at 70 ℃ for leaching for 4 hours, and then transferring into an ultrasonic cleaner at 50 ℃ for ultrasonic extraction at 300W for 60 minutes. After the ultrasonic alcohol extraction is finished, filtering the solution by a hot Buchner funnel, and concentrating the filtrate to 10mL under reduced pressure at 45 ℃ to obtain the total flavone concentrate.
(4) And (3) vacuum drying all the concentrate in the step (3) at 50 ℃ and 0.1MPa for 10 hours to constant weight, and grinding the concentrate into fine powder to obtain the crude extract of total flavonoids of eucommia ulmoides leaves.
According to the steps, 2.86g of eucommia ulmoides leaf total flavone crude extract with the total flavone content of 36.4% is obtained, 1.04g of eucommia ulmoides leaf total flavone is obtained, the extraction yield is 10.4%, and the product is dark brown powder.
If the fermentation process of the step (1) and the step (2) is not performed in the embodiment, the other steps are performed according to the method of the embodiment, 10g of eucommia ulmoides leaf powder can be extracted to obtain 2.43g of eucommia ulmoides leaf total flavone crude extract, the total flavone content is 31.9%, and the eucommia ulmoides leaf total flavone is 0.775g, the extraction yield is 7.75%, and the product is dark brown powder. Therefore, before ultrasonic ethanol extraction of the eucommia ulmoides leaf total flavonoids, fermentation pretreatment of felt Mao Qingmei DZ-9-67 is added, and compared with a conventional method without fermentation pretreatment, the extraction yield of the eucommia ulmoides leaf total flavonoids can be improved by 34.2%.
Sequence listing
<110> Zhejiang tree college (Zhejiang tree university)
<120> felt Mao Qingmei DZ-9-67 and its application in extraction of folium Eucommiae total flavonoids
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 505
<212> DNA
<213> felt Mao Qingmei (Penicillium velutinum)
<400> 1
tcccacccgt gtttatcgta ccttgttgct tcggcgggcc cgcctcacgg ccgccggggg 60
gcttctgccc tctggcccgc gcccgccgaa gacaccattg aacgctgtct gaagattgca 120
gtctgagcaa ttagctaaat aagttaaaac tttcaacaac ggatctcttg gttccggcat 180
cgatgaagaa cgcagcgaaa tgcgatacgt aatgtgaatt gcagaattca gtgaatcatc 240
gagtctttga acgcacattg cgccccttgg tattccgggg ggcatgcctg tccgagcgtc 300
attgctgccc tcaagcacgg cttgtgtgtt gggccccgtc ctccttcccg ggggacgggc 360
ccgaaaggca gcggcggcac cgcgtccggt cctcgagcgt atggggcttc gtcttccgct 420
cttgtaggcc cggccggcgc ttgccgacaa caatcaatct tttttcaggt tgacctcgga 480
tcaggtaggg atacccgctg aactt 505
Claims (10)
1. Felt Mao Qingmei (Penicillium velutinum) DZ-9-67, deposited at the Guangdong province microorganism strain collection, accession number: GDMCC No. 61728, storage date 2021, 21 months, address: building 5 of No. 59 of Qinghui No. 100 college in Guangzhou City of Guangdong; postal code 510070.
2. Use of felt Mao Qingmei DZ-9-67 according to claim 1 in extraction of total flavonoids from folium Eucommiae.
3. The application according to claim 2, characterized in that the method of application is: adding sterile sucrose water solution into folium Eucommiae powder, inoculating felt Mao Qingmei DZ-9-67 spores, fermenting at 28-30deg.C for 2-3d, adding the fermented product into ethanol water solution, leaching, performing ultrasonic extraction, vacuum filtering, concentrating the filtrate to obtain concentrate, and vacuum drying to obtain folium Eucommiae total flavonoids crude extract.
4. The use as claimed in claim 3, wherein the concentration of the sterile sucrose aqueous solution is 3-5g/L, the volume of the sterile sucrose aqueous solution is 1.0-1.5mL/g based on the weight of the eucommia ulmoides leaf powder, and the inoculum size of the felt Mao Qingmei DZ-9-67 spores is 5X 10 based on the weight of the eucommia ulmoides leaf powder 7 –7×10 7 Each/g.
5. The use according to claim 3, wherein the eucommia ulmoides leaf powder is obtained by drying and crushing mature green eucommia ulmoides leaves and sieving the crushed green eucommia ulmoides leaves with a 20-mesh sieve.
6. The use according to claim 3, wherein the volume concentration of the ethanol aqueous solution is 50% -70%, and the dosage of the ethanol aqueous solution is 15-25mL/g based on the weight of the eucommia ulmoides leaf powder before fermentation.
7. Use according to claim 3, characterized in that the ultrasonic extraction is in an ultrasonic cleaner at 50 ℃ for 30-60min at 200-300W.
8. Use according to claim 3, wherein the felt Mao Qingmei DZ-9-67 spores are added in the form of a spore liquid prepared by: inoculating the felt Mao Qingmei DZ-9-67 preserved at low temperature into PDA plate culture medium, culturing at constant temperature of 28-30deg.C for 1.5-2d, adding sterile physiological saline into culture dish, and suspending spores with inoculating loop to obtain spore liquid; the final concentration composition of the PDA plate culture medium is as follows: 200g/L of potato, 20g/L of glucose and 20g/L of agar, wherein the solvent is tap water, and the pH is natural.
9. Use according to claim 3, characterized in that the concentrate is prepared by the following method: adding the fermented product into 50% -70% ethanol water solution, stirring, leaching in 60-70deg.C water bath for 2-4 hr, and ultrasonic extracting at 200-300W for 30-60min; after ultrasonic alcohol extraction is finished, filtering while the solution is hot, concentrating the filtrate at 45 ℃ under reduced pressure to 1/15-1/25 of the original volume to obtain a concentrate; the dosage of the ethanol aqueous solution is 15-25mL/g based on the weight of eucommia ulmoides leaf powder before fermentation.
10. Use according to claim 3, characterized in that the vacuum drying is: vacuum drying at 50deg.C under 0.1MPa to constant weight.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110844947.0A CN113564055B (en) | 2021-07-26 | 2021-07-26 | Felt Mao Qingmei DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110844947.0A CN113564055B (en) | 2021-07-26 | 2021-07-26 | Felt Mao Qingmei DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113564055A CN113564055A (en) | 2021-10-29 |
| CN113564055B true CN113564055B (en) | 2023-09-01 |
Family
ID=78167460
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110844947.0A Active CN113564055B (en) | 2021-07-26 | 2021-07-26 | Felt Mao Qingmei DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113564055B (en) |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104688801A (en) * | 2013-12-09 | 2015-06-10 | 北京联合大学生物化学工程学院 | Production technology for extracting eucommia flavonoid from eucommia ulmoides leaves by combining compound enzyme with ultrasound |
| CN105456333A (en) * | 2015-07-03 | 2016-04-06 | 普正药业股份有限公司 | Preparation method and quality inspection method of total flavonoid extract of cortex eucommiae leaves |
| KR20160142923A (en) * | 2015-06-03 | 2016-12-14 | 계명대학교 산학협력단 | Preparation method of vinegar composition using Cornu cervi and functional food using the same |
| WO2017210166A1 (en) * | 2016-05-31 | 2017-12-07 | Novozymes Bioag A/S | Stable liquid inoculant compositions and coated plant propagation materials comprising same |
| CN107970270A (en) * | 2017-12-05 | 2018-05-01 | 郑州中科新兴产业技术研究院 | A kind of method of step by step arithmetic general flavone and polysaccharide from folium cortex eucommiae |
| CN108552355A (en) * | 2018-01-04 | 2018-09-21 | 陕西乾宁健康食品有限公司 | Pure folium cortex eucommiae Fu-brick tea oral solution based on natural strain and preparation method thereof |
| CN109295120A (en) * | 2018-10-31 | 2019-02-01 | 湖南中茂生物科技有限公司 | A method of flavones is obtained using Penicillium notatum bioconversion corn stigma |
| CN109439719A (en) * | 2018-11-27 | 2019-03-08 | 广东中测食品化妆品安全评价中心有限公司 | A kind of fungi two-way solid-fermented technique and its application based on Cortex Eucommiae |
| CN110839810A (en) * | 2019-12-06 | 2020-02-28 | 吉首大学 | Process for extracting total flavonoids from folium Eucommiae by microwave-assisted method and application of total flavonoids in antioxidant |
| CN112481134A (en) * | 2020-11-26 | 2021-03-12 | 浙江工业大学 | Method for extracting mulberry leaf polysaccharide by using microbial fermentation method |
| CN112574890A (en) * | 2020-11-26 | 2021-03-30 | 浙江工业大学 | Mucor racemosus SY5-47 and application thereof in mulberry leaf flavone extraction |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101891417B1 (en) * | 2013-10-31 | 2018-08-23 | 쓰촨 아카데미 오브 차이니즈 메디신 사이언스 | Paliurus ramosissimus(lour.)poir extract and preparation method and uses thereof |
| WO2019135972A1 (en) * | 2018-01-03 | 2019-07-11 | Monsanto Technology Llc | Bacillus isolates and uses thereof |
-
2021
- 2021-07-26 CN CN202110844947.0A patent/CN113564055B/en active Active
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104688801A (en) * | 2013-12-09 | 2015-06-10 | 北京联合大学生物化学工程学院 | Production technology for extracting eucommia flavonoid from eucommia ulmoides leaves by combining compound enzyme with ultrasound |
| KR20160142923A (en) * | 2015-06-03 | 2016-12-14 | 계명대학교 산학협력단 | Preparation method of vinegar composition using Cornu cervi and functional food using the same |
| CN105456333A (en) * | 2015-07-03 | 2016-04-06 | 普正药业股份有限公司 | Preparation method and quality inspection method of total flavonoid extract of cortex eucommiae leaves |
| WO2017210166A1 (en) * | 2016-05-31 | 2017-12-07 | Novozymes Bioag A/S | Stable liquid inoculant compositions and coated plant propagation materials comprising same |
| CN107970270A (en) * | 2017-12-05 | 2018-05-01 | 郑州中科新兴产业技术研究院 | A kind of method of step by step arithmetic general flavone and polysaccharide from folium cortex eucommiae |
| CN108552355A (en) * | 2018-01-04 | 2018-09-21 | 陕西乾宁健康食品有限公司 | Pure folium cortex eucommiae Fu-brick tea oral solution based on natural strain and preparation method thereof |
| CN109295120A (en) * | 2018-10-31 | 2019-02-01 | 湖南中茂生物科技有限公司 | A method of flavones is obtained using Penicillium notatum bioconversion corn stigma |
| CN109439719A (en) * | 2018-11-27 | 2019-03-08 | 广东中测食品化妆品安全评价中心有限公司 | A kind of fungi two-way solid-fermented technique and its application based on Cortex Eucommiae |
| CN110839810A (en) * | 2019-12-06 | 2020-02-28 | 吉首大学 | Process for extracting total flavonoids from folium Eucommiae by microwave-assisted method and application of total flavonoids in antioxidant |
| CN112481134A (en) * | 2020-11-26 | 2021-03-12 | 浙江工业大学 | Method for extracting mulberry leaf polysaccharide by using microbial fermentation method |
| CN112574890A (en) * | 2020-11-26 | 2021-03-30 | 浙江工业大学 | Mucor racemosus SY5-47 and application thereof in mulberry leaf flavone extraction |
Non-Patent Citations (1)
| Title |
|---|
| 蝉拟青霉/黄芪双向发酵体系建立及成分研究;赵崇妍等;世界中医药;第13卷(第12期);3195-3198 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113564055A (en) | 2021-10-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112481134B (en) | Method for extracting mulberry leaf polysaccharide by using microbial fermentation method | |
| CN113564212B (en) | Method for extracting eucommia ulmoides leaf polysaccharide by utilizing microbial fermentation method | |
| CN112574890B (en) | Mucor racemosus SY5-47 and application thereof in mulberry leaf flavone extraction | |
| CN114085778B (en) | Rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle | |
| CN111334440B (en) | Rhizopus oryzae CH5 and application thereof in extraction of ganoderma sinensis polysaccharide | |
| CN111471727A (en) | Method for extracting atractylodes macrocephala polysaccharide by using microbial fermentation method | |
| CN111218406B (en) | Mucor circinelloides MF-8 and application thereof in improving content of taxifolin in rhizoma smilacis glabrae | |
| CN110551636B (en) | Monascus purpureus MY-21 strain and application thereof | |
| CN114196578B (en) | Aspergillus aculeatus NM-11-6 and application thereof in lemon essential oil extraction | |
| CN113564055B (en) | Felt Mao Qingmei DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves | |
| CN114606137B (en) | Aspergillus japonicus HY-8-25 and application thereof in rosemary essential oil extraction | |
| CN116024096A (en) | Aspergillus awamori SR3-28 and application thereof in extraction of emodin from radix Ardisiae Crenatae | |
| CN111394258B (en) | Rhizopus stolonifer FL-3 and application thereof in extracting pachyman | |
| CN114933973B (en) | Mucor lassitanum HZ-6-27 and application thereof in extraction of rhizoma polygonati polysaccharide | |
| CN116549507B (en) | Method for preparing radix puerariae extract by microbial fermentation method | |
| CN116115675B (en) | Method for extracting loquat leaf total flavonoids by microbial enzymolysis | |
| CN116041561A (en) | Method for extracting lotus leaf polysaccharide with assistance of microbial fermentation | |
| CN115838444B (en) | Method for extracting mugwort leaf polysaccharide with assistance of microbial enzymolysis | |
| CN113149819B (en) | Method for extracting hypocrellin from solid-state fermentation material of tabasheer fungus | |
| CN116042407A (en) | Rhizopus arrhizus AS7-34 and application thereof in extraction of angelica sinensis polysaccharide | |
| CN116549507A (en) | Method for preparing radix puerariae extract by microbial fermentation method | |
| CN117467725B (en) | Fermentation production process of paecilomyces hepiali mycelium powder with high nucleoside content | |
| CN116731881A (en) | Mucor HY6-19 and application thereof in preparation of semen Hoveniae extract | |
| CN117866118A (en) | Method for extracting okra polysaccharide with assistance of microbial fermentation | |
| CN116144506A (en) | Aspergillus terreus DK3-18 and application thereof in extracting persimmon leaf total flavonoids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 2016 Jiangxia Road, Yangxunqiao Town, Keqiao District, Shaoxing City, Zhejiang Province Applicant after: ZHEJIANG SHUREN College (ZHEJIANG SHUREN University) Address before: No.8 Shuren street, Gongshu District, Hangzhou City, Zhejiang Province 310015 Applicant before: ZHEJIANG SHUREN College (ZHEJIANG SHUREN University) |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |