CN114085778B - Rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle - Google Patents
Rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle Download PDFInfo
- Publication number
- CN114085778B CN114085778B CN202111298073.XA CN202111298073A CN114085778B CN 114085778 B CN114085778 B CN 114085778B CN 202111298073 A CN202111298073 A CN 202111298073A CN 114085778 B CN114085778 B CN 114085778B
- Authority
- CN
- China
- Prior art keywords
- honeysuckle
- jyh
- chlorogenic acid
- rhizopus oryzae
- extraction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Abstract
The invention discloses a rhizopus oryzae JYH-4-23 and application thereof in chlorogenic acid extraction of honeysuckle, which are prepared by fermenting rhizopus oryzae JYH-4-23 before chlorogenic acid is extracted by ultrasonic ethanol, and the crude enzyme liquid is pretreated by glycosidase crude enzyme liquid prepared by fermenting rhizopus oryzae JYH-4-23, and contains various glycosidases, so that cellulose, hemicellulose, pectin and other substances in the honeysuckle can be hydrolyzed, the structure tissue of the honeysuckle is loose, and chlorogenic acid is easier to dissolve out during ultrasonic ethanol extraction, so that the extraction yield of chlorogenic acid in the honeysuckle can be remarkably improved. The rhizopus oryzae JYH-4-23 used in the invention is obtained by purposeful screening and mutation breeding aiming at promoting the dissolution of chlorogenic acid in honeysuckle. Compared with the conventional ultrasonic ethanol extraction method, the extraction method for chlorogenic acid in honeysuckle provided by the invention has the advantage that the extraction yield of chlorogenic acid in honeysuckle can be improved by 41.5%.
Description
Field of the art
The invention belongs to the technical field of biochemical engineering, and particularly relates to rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle.
(II) background art
Chlorogenic acid (CAS number 327-97-9, molecular formula C) 16 H 18 O 9 Molecular weight 354.3, molecular structural formula is shown in figure 1), also known as caffeic tannic acid, depsipeptide composed of caffeic acid and quinic acid is phenylpropanoid compound produced by metabolism of plants in shikimic acid pathway in aerobic respiration process. Chlorogenic acid has various biological activities, and has good pharmacological effects of resisting oxidation, resisting tumor, resisting bacteria and virus, protecting liver and gall, lowering blood pressure, reducing blood lipid, etc. Chlorogenic acid as a natural antioxidant, which can be used as a preservative for foods and fruits; chlorogenic acid can effectively remove active oxygen free radicals, can protect skin collagen from damage and prevent ultraviolet rays from damaging skin, and is also widely applied to daily chemical products such as skin whitening, skin moisturizing, sun protection, hair care and the like. Chlorogenic acid is widely used in the fields of foods, medicines and cosmetics.
Chlorogenic acid is naturally present in many plants, ranging from higher dicotyledonous plants to lower ferns, and is mainly present in plants of the Caprifoliaceae (Caprifoliaceae), eucommiaceae (Eucommiaceae), compositae (Compositae), and Rosaceae (Rosaceae). Plants with higher content include flos Lonicerae (up to 5% in flower), eucommiae cortex (up to 5% in bark), sunflower (up to 3% in seed), coffee (2% in coffee bean), flos Chrysanthemi (0.2%), etc. In addition, the common fruits and vegetables also contain trace chlorogenic acid components such as potato, cabbage, carrot, eggplant, cabbage, lettuce, spinach, etc. [ Chen Shaohua, wang Yaqin, luo Lixin. Research on chlorogenic acid as a natural product progressed. Food science and technology 2008,33 (2): 195-199].
Although chlorogenic acid can be synthesized by a chemical method at present, natural chlorogenic acid extracted from plants is favored because of the use of toxic substances in the synthesis process or because of the low synthesis yield of chlorogenic acid which is not industrially used. The honeysuckle flower has higher chlorogenic acid content, and is a better raw material for extracting chlorogenic acid. There are many reports on chlorogenic acid extraction from honeysuckle in China, the method mainly comprises a water extraction method and an alcohol extraction method, and on the basis of the two methods, ultrasonic wave, microwave, ultrahigh pressure and enzymolysis auxiliary extraction methods are adopted. The different extraction methods have respective advantages and disadvantages, and the extraction rates reported by different researches are also different. The water extraction method has low cost, but the chlorogenic acid yield is lower; the yield of chlorogenic acid by alcohol extraction is obviously improved, but a large amount of ethanol is needed. Before water extraction or alcohol extraction, ultrasonic wave, microwave, ultra-high pressure or enzymolysis pretreatment is added, so that the dissolution of chlorogenic acid in plant materials can be promoted, and the extraction yield is remarkably improved. Several methods have certain advantages over ultrasonic or microwave-assisted extraction methods, without significantly increasing the extraction cost. The ultra-high pressure assisted extraction requires high pressure equipment; the enzymolysis auxiliary extraction method has high use cost of enzyme and low improvement range of product yield, and the industrialized application of the two methods has certain difficulty.
In order to improve the extraction yield of chlorogenic acid in honeysuckle, the invention improves the ultrasonic-assisted alcohol extraction process of chlorogenic acid in honeysuckle, and can obviously improve the extraction yield of chlorogenic acid in honeysuckle by adding a microbial enzyme pretreatment step.
(III) summary of the invention
The invention aims to provide a novel microorganism strain of glycosidase, namely Rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle, and the extraction yield of chlorogenic acid can be obviously improved after pretreatment of honeysuckle.
The technical scheme adopted by the invention is as follows:
the invention provides a new microorganism strain for producing glycosidase, namely Rhizopus oryzae (Rhizopus oryzae) JYH-4-23, which is preserved in the microorganism strain collection of Guangdong province, with the preservation number: GDMCC No. 61966, storage date 2021, 9 months 29 days, address: building 5 of No. 59 of Qinghui No. 100 college in Guangzhou City of Guangdong; postal code 510070.
The rhizopus oryzae JYH-4-23 is an excellent strain obtained by separating from a microorganism enrichment culture of honeysuckle and screening and mutation breeding. Colony morphology characteristics of rhizopus oryzae JYH-4-23 were as follows: culturing on Potato Dextrose Agar (PDA) plate medium at 28deg.C for 1d, spreading off-white slender villous mycelium over the culture dish, and making mycelium layer thicker. After 2d, the plant is gradually changed into grey brown, grey brown conidia are generated on the surface, and the number of the conidia is small; after 3 days, the number of spores is large. The creeping hypha exists, and the pseudoroot is developed; the cyst peduncles stand upright or are slightly bent, 2-4 plants are bundled and are longer. The sporangium is spherical, nearly spherical or oval, light brown, and has a diameter of 120-200 μm. The sporangium spores are elliptic or spherical and have inconsistent sizes. A photograph of a colony of Rhizopus oryzae JYH-4-23 cultured for 2d at 28℃on PDA plate medium is shown in FIG. 2.
The nucleotide sequence of the transcription spacer (Ribosomal DNA internal transcribed spacer, rDNA-ITS) in the ribosomal DNA of rhizopus oryzae JYH-4-23 is shown as SEQ ID NO. 1.
The invention also provides an application of the rhizopus oryzae JYH-4-23 in extracting chlorogenic acid in honeysuckle, and the application method comprises the following steps: filtering fermentation liquor of rhizopus oryzae JYH-4-23 through fermentation culture, and obtaining filtrate which is crude enzyme liquid of glycosidase; mixing the crude enzyme solution with flos Lonicerae, performing enzymolysis at 30-35deg.C for 10-14 hr, and filtering to remove crude enzyme solution to obtain flos Lonicerae powder filter cake after enzymolysis; adding ethanol water solution into the filter cake for leaching, then carrying out ultrasonic extraction, carrying out suction filtration, concentrating the filtrate to obtain ethanol extract concentrate of honeysuckle, and carrying out vacuum drying to obtain chlorogenic acid.
Further, the volume of the crude enzyme liquid is 3-4mL/g based on the mass of the honeysuckle, and the honeysuckle is required to be dried and crushed at 85 ℃ and sieved by a 40-mesh sieve before being added.
Further, the preparation method of the crude enzyme solution comprises the following steps: inoculating rhizopus oryzae JYH-4-23 into an enzyme-producing culture medium, culturing for 36-48h at 28-30deg.C under 200-250r/min constant temperature shaking condition, filtering fermentation liquor, and obtaining filtrate as crude enzyme liquid of glycosidase; the final concentration composition of the enzyme-producing culture medium is as follows: bran 15-20g/L, (NH) 4 ) 2 SO 4 3–4g/L，KH 2 PO 4 2–5g/L，MgSO 4 0.5–1.0g/L，CaCl 2 0.2-0.5g/L, tap water as solvent, and pH 6.0-6.5.
Further, it is preferable that the enzyme-producing medium has the composition: bran 20g/L, (NH) 4 ) 2 SO 4 4g/L，KH 2 PO 4 2g/L，MgSO 4 0.5g/L，CaCl 2 0.2g/L, tap water as solvent, pH 6.0.
Before fermentation, the rhizopus oryzae JYH-4-23 is usually subjected to activation culture by a flat plate culture medium to prepare spore liquid, or is subjected to expansion culture by a seed culture medium to prepare seed liquid, and then the spore liquid or the seed liquid is inoculated into an enzyme production culture medium for enzyme production culture according to the volume concentration of 2% -5%, wherein the rhizopus oryzae JYH-4-23 fermentation culture method comprises the following steps:
(1) And (3) activating and culturing: rhizopus oryzae JYH-4-23 was inoculated in potato sucrose agar (PDA) plate medium and incubated at 28-30deg.C for 48-60h to obtain plate culture; adding sterile physiological saline into the plate culture, stirring with an inoculating loop to suspend spores to obtain rhizopus oryzae JYH-4-23 spore liquid; the final concentration composition of the PDA plate culture medium is as follows: 200g/L of potato, 20g/L of sucrose and 20g/L of agar, wherein the solvent is tap water, and the pH is natural (actually measured 6.5);
(2) Seed expansion culture: inoculating the rhizopus oryzae JYH-4-23 spore liquid subjected to the activation culture in a seed culture medium according to the inoculum size of 2% -5% of the volume concentration, and culturing for 30-36h at the constant temperature oscillation condition of 28-30 ℃ and 200-250r/min to obtain seed liquid with the dry thallus concentration of 2.15-2.23 g/L; the final concentration composition of the seed culture medium is as follows: 10-15g/L sucrose, 3-5g/L yeast extract powder, KH 2 PO 4 2–3g/L，MgSO 4 0.3–0.5g/L，CaCl 2 0.1-0.2g/L, tap water as solvent, and pH 6.0-6.5. Preferably, the seed culture medium comprises the following components: 10g/L sucrose, 3g/L yeast extract powder, KH 2 PO 4 2g/L，MgSO 4 0.5g/L，CaCl 2 0.2g/L, tap water as solvent, pH 6.0.
(3) Enzyme production culture: and (3) inoculating the rhizopus oryzae JYH-4-23 spore liquid obtained after the activation culture in the step (1) or the seed liquid prepared in the step (2) into an enzyme production culture medium according to the inoculum size with the volume concentration of 2% -5%, and carrying out constant-temperature shaking culture for 36-48h at the temperature of 28-30 ℃ and the constant temperature of 200-250r/min to obtain fermentation liquor with the dry cell concentration of 3.28-3.43g/L and the beta-glucosidase activity of 35.8-37.4U/mL.
Further, the ethanol water solution leaching is to add the filter cake of the honeysuckle after enzymolysis into ethanol water solution with the volume concentration of 70-80%, stir evenly and then put into water bath with the temperature of 50-60 ℃ for leaching for 1-2h; the dosage of the ethanol aqueous solution is 10-15mL/g based on the mass of the honeysuckle powder.
Further, the ultrasonic extraction refers to the steps of leaching an ethanol water solution, and then transferring the leached ethanol water solution into an ultrasonic cleaner with the temperature of 60 ℃ for ultrasonic extraction with the power of 100-200W for 30-60min.
Further, the preparation method of the ethanol extract concentrate of the honeysuckle comprises the following steps: adding the hydrolyzed honeysuckle filter cake into 70-80% ethanol water solution, stirring uniformly, placing into 50-60 ℃ water bath, leaching for 1-2h, and then transferring into a 60 ℃ ultrasonic cleaner for ultrasonic extraction for 30-60min at 100-200W; after ultrasonic alcohol extraction is finished, filtering while the solution is hot, concentrating the filtrate at 45 ℃ under reduced pressure to 1/20-1/15 of the original volume to obtain a concentrate; the dosage of the ethanol aqueous solution is 10-15mL/g based on the mass of the honeysuckle powder.
Further, the vacuum drying conditions are: vacuum drying at 50 deg.C and-0.1 MPa to constant weight.
Compared with the prior art, the invention has the beneficial effects that: before extracting chlorogenic acid from honeysuckle by ultrasonic ethanol, the crude enzyme liquid of glycosidase prepared by fermentation of rhizopus oryzae JYH-4-23 is pretreated, and contains various glycosidases, so that cellulose, hemicellulose, pectin and other substances in the honeysuckle can be hydrolyzed, the structural tissues of the honeysuckle are loose, and chlorogenic acid is easier to dissolve out during ultrasonic ethanol extraction, so that the extraction yield of chlorogenic acid in honeysuckle can be remarkably improved. The rhizopus oryzae JYH-4-23 used in the invention is obtained by purposeful screening and mutation breeding aiming at promoting the dissolution of chlorogenic acid in honeysuckle. Compared with the conventional ultrasonic ethanol extraction method, the extraction method for chlorogenic acid in honeysuckle provided by the invention has the advantage that the extraction yield of chlorogenic acid in honeysuckle can be improved by 41.5%.
(IV) description of the drawings
FIG. 1 shows the molecular structural formula of chlorogenic acid.
FIG. 2 is a photograph of a colony of Rhizopus oryzae JYH-4-23.
FIG. 3 shows chlorogenic acid concentration-A 328 Is a standard curve of (2).
FIG. 4 shows p-nitrophenol concentration-A 400 A standard curve.
(fifth) detailed description of the invention
The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:
the honeysuckle flower is a dried flower bud or a flower with a primary opening of honeysuckle flower (Lonicera japonica thunder.) of Caprifoliaceae (Caprifoliaceae), and is collected and dried before the primary opening of summer flowers. The honeysuckle powder is fine powder which is obtained by crushing honeysuckle dried at 85 ℃ and sieving the crushed honeysuckle powder with a 40-mesh sieve.
Example 1: isolation and screening of enzyme producing strains
Wild strains for enzyme production pretreatment of honeysuckle are separated and screened according to the following steps:
(1) 10g of honeysuckle powder is added into a 250-mL triangular flask, then 8mL of sterile physiological saline is added for wetting, and the mixture is cultured for 72 hours at the constant temperature of 28 ℃. Diluting the enriched culture of the grown mould with sterile physiological saline for 1×10 respectively -6 、1×10 -7 、1×10 -8 After doubling, 0.1mL of the diluent is respectively absorbed and coated on a Potato Dextrose Agar (PDA) flat plate culture medium, the culture is carried out for 48 hours at the constant temperature of 28 ℃, mould colonies with different colors and forms are picked up and transferred to a fresh PDA flat plate culture medium, and the fresh PDA flat plate culture medium is placed at the constant temperature of 28 ℃ for 72 hours, thus obtaining 11 strains of pure culture strains, and the serial numbers of all strains are shown in the table 1.
(2) 10mL of sterile physiological saline is added to fresh plate cultures of 11 strains respectively, and spores are suspended by stirring with an inoculating loop, so that spore liquid of each strain is obtained.
(3) Taking 1.0mL (the volume percentage of the inoculum size is 2%) of spore liquid of each strain prepared in the step (2), inoculating the spore liquid into 50mL of enzyme production culture medium, carrying out enzyme production culture for 48 hours at the constant temperature of 28 ℃ and under the constant oscillating condition of 200r/min, and carrying out suction filtration on all fermentation liquor by using a Buchner funnel, wherein the collected filtrate is glycosidase crude enzyme liquid.
(4) 15g of honeysuckle fine powder is placed in a 250-mL triangular flask, 45mL of crude enzyme solution prepared in the step (3) is added, and after being stirred uniformly, the crude enzyme solution is subjected to enzymolysis for 10 hours at 30 ℃, and a Buchner funnel is used for carrying out suction filtration to remove the crude enzyme solution, so that a honeysuckle powder filter cake is obtained.
(5) And (4) respectively adding all the honeysuckle powder filter cakes pretreated by the crude enzyme liquid of each strain into 250-mL triangular flasks, respectively adding 150mL ethanol water solution with the volume concentration of 70%, shaking uniformly, placing into a water bath at 50 ℃ for leaching for 2 hours, then transferring into an ultrasonic cleaner at 60 ℃, performing ultrasonic extraction at 100W for 60 minutes, performing suction filtration by using a Buchner funnel while the filter cakes are hot, measuring the absorbance value at 328nm by using a spectrophotometry, and calculating the concentration of chlorogenic acid in the filtrate.
Under the same conditions, 45mL of enzyme-producing culture medium without microorganism inoculation is used for replacing crude enzyme liquid to be used as negative control; a cellulase pretreatment control was prepared by replacing the crude enzyme solution with 45mL of phosphate buffer (pH 6.0,0.2 mol/L) containing cellulase (activity 100000U/g) at a mass concentration of 1%.
TABLE 1 extraction yield of chlorogenic acid after pretreatment of crude enzyme solution prepared by fermentation of different strains
As can be seen from the data in Table 1, after the honeysuckle is pretreated by crude enzyme liquid prepared by fermenting the strain JYH-4, compared with a negative control, the extraction yield of chlorogenic acid is improved to the highest extent and reaches 25.7%; compared with a cellulase pretreatment control, the extraction yield of chlorogenic acid is improved by 11.8%, which indicates that the crude enzyme liquid prepared by fermentation of the strain JYH-4 is used for pretreatment of honeysuckle, the extraction yield of chlorogenic acid can be remarkably improved, and the method is superior to the cellulase pretreatment. The strain is selected as a fermentation enzyme-producing strain for improving the chlorogenic acid extraction rate in the honeysuckle.
The PDA plate culture medium is prepared according to the following composition and method: cleaning potato, peeling, cutting into small blocks with side length of about 1cm, weighing 200g, adding 1000mL of tap water, boiling for 20min, filtering with 4 layers of gauze, removing residues, supplementing the filtrate to 1000mL, adding 20g of glucose and 20g of agar, naturally measuring pH (about 6.5), heating to dissolve agar, packaging in triangular flask, sterilizing at 121deg.C for 20min under high pressure, pouring into sterile culture dishes with diameter of 9cm before solidification, and 15-20mL per dish.
The final concentration composition and preparation method of the enzyme-producing culture medium are as follows: bran 20g/L, (NH) 4 ) 2 SO 4 4g/L，KH 2 PO 4 2g/L，MgSO 4 0.5g/L，CaCl 2 0.2g/L, tap water as solvent, pH 6.0. 250-mL triangular flask is filled with 50mL of enzyme-producing culture medium, 8 layers of gauze are tied up, and high-pressure steam is used for sterilization at 121 ℃ for 20min.
The chlorogenic acid content is measured by spectrophotometry, and the specific method comprises the following steps: 1.0mL chlorogenic acid extract sample (the sampling amount is properly adjusted according to the concentration of chlorogenic acid in the sample, and the measurement A is controlled) 328 Between 0.2 and 1.0, dissolving the crude solid chlorogenic acid extract with 70% ethanol aqueous solution), fixing volume in 10-mL volumetric flask, and measuring absorbance at 328nm with ultraviolet-visible spectrophotometer (A 328 ) From chlorogenic acid standard concentration-A 328 And calculating the concentration of chlorogenic acid in the sample by using a standard curve, and multiplying the concentration by the volume and dilution times of the measured sample to obtain the mass of chlorogenic acid.
Chlorogenic acid standard concentration-A 328 Drawing a standard curve: 5mg chlorogenic acid standard is weighed in a 100mL volumetric flask, and 70% ethanol water solution is used for constant volume to form a standard solution with the concentration of 50 mg/L. 1, 2, 3, 4 and 5mL of the standard solution are respectively sucked into a 10mL volumetric flask, and chlorogenic acid solutions with the concentrations of 5, 10, 15, 20 and 25mg/L are respectively prepared by using 70% ethanol water solution to fix the volume. Measuring A with ultraviolet-visible spectrophotometer with 70% ethanol water solution as reference 328 Chlorogenic acid concentration is taken as an abscissa, A 328 A standard curve is plotted for the ordinate (fig. 3).
The chlorogenic acid extraction rate is calculated according to the formula (1):
example 2: mutagenesis breeding of enzyme-producing strain JYH-4
The strain JYH-4 is subjected to mutation breeding by taking the activity of beta-glucosidase in the fermentation broth as an index, and the strain with excellent glycosidase production performance is screened, and the specific method comprises the following steps:
(1) Preparation of spore liquid: after the strain JYH-4 is subjected to activating culture for 48 hours at 28 ℃ through a PDA flat-plate culture medium, 5mL of sterile physiological saline is added, and after the spores are suspended by stirring of an inoculating loop, the spores are transferred into a triangular flask containing 45mL of sterile physiological saline20-30 glass beads are added), and the mixture is oscillated for 20min at room temperature. Filtering spore suspension to remove mycelium (2 layers of mirror cleaning paper on triangular funnel pad), counting spores in suspension with blood cell counting plate under microscope, diluting with sterile physiological saline, and adjusting spore number to 1×10 8 And each mL.
(2) Mutagenesis: under the illumination of red light, respectively taking 2.0mL of the spore suspension and a piece of sterile paperclip into 5 culture dishes with the diameter of 6cm, respectively placing the culture dishes on a magnetic stirrer, and respectively irradiating 1, 2, 3, 4 and 5min at the distance of 30cm of a 15W ultraviolet lamp preheated for 30min. After 0.5mL of the above-mentioned spore liquid subjected to the irradiation treatment was diluted by an appropriate factor, 0.1mL of the PDA-coated plate medium was removed, respectively. In the same manner, a spore liquid dilution plating plate without ultraviolet irradiation was used as a control to calculate the mortality rate. The inoculated PDA plates were wrapped with black cloth, incubated for 36h at 28℃upside down, colonies on the plates were counted and mortality was calculated.
(3) Screening: colonies on PDA plates with mortality rate of more than 90% are picked up and transferred to fresh PDA plate culture medium, and 48 strains are obtained. 10mL of sterile physiological saline is added to fresh plate cultures of each strain, and spores are suspended by stirring with an inoculating loop, so that spore liquid of each strain is obtained. Sucking 1mL of spore liquid of each strain, inoculating into 50mL of enzyme-producing culture medium, carrying out enzyme-producing culture for 48h at the constant temperature of 28 ℃ and under the constant oscillating condition of 200r/min, carrying out suction filtration on all fermentation liquor by using a Buchner funnel, and collecting filtrate. And (3) measuring the activity of beta-glucosidase of the fermentation filtrate of each strain, and selecting the strain with the enzyme activity improved compared with that of the original strain. And (3) performing primary screening to obtain 13 strains with the enzyme activity improved by more than 20%, and performing secondary screening on the activity of the beta-glucosidase of 3 repeated fermentations on each strain according to the method, wherein the activity of the beta-glucosidase of the secondary screened strains is shown in Table 2.
Table 2 results of rescreening the mutant strains for β -glucosidase production Activity
As can be seen from the data in Table 2, the activity of the beta-glucosidase in the fermentation broth of the JYH-4-23 strain is highest and reaches 36.4U/mL, which is improved by 53.6% compared with the JYH-4 strain.
After the crude enzyme solution prepared by fermentation of JYH-4-23 strain was used for pretreatment of honeysuckle powder according to the method described in example 1, the extraction yield of chlorogenic acid was 6.67%, which was improved by 11.9% compared with 5.96% of the strain JYH-4, and by 40.7% compared with 4.74% of the negative control without pretreatment. After the JYH-4-23 strain is subjected to transfer passage for 5 times and crude enzyme liquid prepared by fermentation of each generation is subjected to pretreatment of honeysuckle, the fluctuation range of the activity of beta-glucosidase is less than 10%, which indicates that the genetic stability of glycosidase produced by the strain is good.
The method for measuring the activity of the beta-glucosidase comprises the following steps: adding 0.6mL of crude enzyme solution, 0.2mL of citric acid buffer solution with pH of 5.5 and 0.2mL of p-nitrophenol-beta-glucoside (pNPG) with the concentration of 10mmol/L into a test tube in sequence, reacting for 15min at 30 ℃, and adding 5mL of 1mol/L Na 2 CO 3 The solution was shaken to terminate the reaction. The absorbance was measured at 400nm wavelength using the same treatment as that of the boiling-inactivated crude enzyme (A) 400 ). From the concentration of p-nitrophenol (pNP) -A 400 The standard curve calculated the pNP concentration in the reaction system.
Definition of beta-glucosidase activity unit (U): in a buffer system at 30℃and pH 5.5, the amount of enzyme that hydrolyzes pNPG to 1. Mu. Mol of pNP in lmin was 1 enzyme activity unit.
The enzyme activity was calculated according to the following formula (2).
In the formula (2), V 1 : the total volume of the reaction system; v (V) 2 : crude enzyme liquid volume; c (C) 1 : the pNP concentration; t: reaction time.
P-nitrophenol concentration-A 400 And (3) manufacturing a standard curve: a pNP standard solution was prepared at a concentration of 1mmol/L with distilled water. Respectively sucking standard solutions 0.1, 0.2, 0.3, 0.4, 0.5mL to L0mL volumetric flask, and adding lmol/L Na 2 CO 3 After the solution is fixed in volume, the solution is uniformly mixed, so that the concentration of the p-nitrophenol in each sample is 10, 20, 30, 40 and 50 mu mol/L. By distillationMeasuring absorbance at 400nm with water as blank and p-nitrophenol concentration as abscissa, A 400 On the ordinate, the p-nitrophenol concentration-A is plotted 400 A standard curve.
Example 3: classification and identification of strain JYH-4-23
The strain JYH-4-23 was inoculated on PDA plate medium and cultured at 28℃for 1d, the gray-white slender villiated hyphae were spread over the petri dish, and the hyphae layer was thicker. After 2d, the plant is gradually changed into grey brown, grey brown conidia are generated on the surface, and the number of the conidia is small; after 3 days, the number of spores is large. The creeping hypha exists, and the pseudoroot is developed; the cyst peduncles stand upright or are slightly bent, 2-4 plants are bundled and are longer. The sporangium is spherical, nearly spherical or oval, light brown, and has a diameter of 120-200 μm. The sporangium spores are elliptic or spherical and have inconsistent sizes. A photograph of a colony of Rhizopus oryzae JYH-4-23 cultured for 2d at 28℃on PDA plate medium is shown in FIG. 2.
The rDNA-ITS nucleotide sequence of strain JYH-4-23 was shown as SEQ ID NO.1, which was subjected to BLAST alignment at NCBI (National Center for Biotechnology Information, https:// www.ncbi.nlm.nih.gov) with more than 99% homology to 6 known Rhizopus oryzae (Rhizopus oryzae). Based on the colony characteristics of the strain JYH-4-23 and the rDNA-ITS nucleotide sequence comparison result, the biological classification position of the strain JYH-4-23 can be determined as follows (refer to Mycobank, http:// www.mycobank.org): the kingdom Fungi (Fungi), mucor (Mucoromycota), mucor subgenera (Mucoromycotina), mao Meigang (Mucoromycotes), mucor (Mucorrales), mucor (Mucorraceae), rhizopus (Rhizopus), rhizopus oryzae (Rhizopus oryzae).
The ITS region rDNA sequence is:
TCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGGCTTCTGCCCTCTGGCCCGCGCCCGCCGAAGACACCATTGAACGCTGTCTGAAGATTGCAGTCTGAGCAATTAGCTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCTTGTAGGCCCGGCCGGCGCTTGCCGACAACAATCAATCTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT。
in summary, the strain JYH-4 separated from the microorganism enrichment of honeysuckle powder is subjected to ultraviolet mutagenesis and then is screened to obtain the strain JYH-4-23, namely Rhizopus oryzae (Rhizopus oryzae) JYH-4-23, which is preserved in the microorganism strain collection of Guangdong province, with the preservation number: GDMCC No. 61966, storage date 2021, 9 months 29 days, address: building 5 of No. 59 of Qinghui No. 100 college in Guangzhou City of Guangdong; postal code 510070.
Example 4: application of rhizopus oryzae JYH-4-23 in extraction of chlorogenic acid in honeysuckle
The rhizopus oryzae JYH-4-23 is applied to the extraction of chlorogenic acid in honeysuckle, and can be operated according to the following steps:
(1) Freeze-drying preserved rhizopus oryzae JYH-4-23 bacterial powder, inoculating to fresh PDA flat-plate culture medium, culturing at constant temperature of 28 ℃ for 60h, adding 10mL of sterile physiological saline into a culture dish, stirring with an inoculating loop to suspend spores, and obtaining spore liquid of rhizopus oryzae JYH-4-23. The PDA plate medium composition and formulation method are the same as in example 1.
(2) Taking 1.5mL (the volume percentage of the inoculum size is 2%) of the spore liquid prepared in the step (1), inoculating into 75mL of enzyme-producing culture medium, and carrying out enzyme-producing culture for 48h at the constant temperature of 28 ℃ and under the constant oscillating condition of 200r/min to obtain fermentation liquor with the dry thallus concentration of 3.28 g/L. And (3) carrying out suction filtration on all fermentation liquor by using a Buchner funnel, wherein the collected filtrate is crude enzyme solution, and the activity of beta-glucosidase of the filtrate is 37.4U/mL. The final concentration composition of the enzyme-producing culture medium is the same as that of the enzyme-producing culture medium of 75mL in a 250-mL triangular flask in example 1, 8 layers of gauze are tied up, and high-pressure steam is used for sterilization at 121 ℃ for 20min.
(3) And (3) adding 20g of honeysuckle fine powder into a 250-mL triangular flask, adding 60mL of the crude enzyme solution prepared in the step (2), uniformly stirring, carrying out enzymolysis for 10 hours at 30 ℃, and filtering the crude enzyme solution by suction filtration through a Buchner funnel to obtain a gold-silver pollen filter cake.
(4) And (3) putting all the honeysuckle powder filter cakes pretreated by the crude enzyme solution in a 250-mL triangular flask, adding 300mL of 70% ethanol water solution with volume concentration, shaking uniformly, putting into a water bath at 50 ℃ for leaching for 2 hours, and then transferring into an ultrasonic cleaner at 60 ℃ for ultrasonic extraction for 60 minutes at power of 100W. After the ultrasonic alcohol extraction is finished, the solution is filtered by a Buchner funnel while the solution is hot, and the filtrate is concentrated to 20mL under reduced pressure at 45 ℃ to obtain chlorogenic acid concentrate.
(5) And (3) drying all concentrates in the step (4) under the conditions of 50 ℃ and minus 0.1MPa in vacuum until the weights are constant, and grinding the concentrates into fine powder to obtain the crude extract of the chlorogenic acid in the honeysuckle.
According to the steps, 4.68g of crude chlorogenic acid extract of honeysuckle is obtained, the mass content of chlorogenic acid is 28.7%, 1.34g of chlorogenic acid is obtained, the extraction yield is 6.72%, and the product is a grey green powder.
Example 5: application of rhizopus oryzae JYH-4-23 in extraction of chlorogenic acid in honeysuckle
The rhizopus oryzae JYH-4-23 is applied to the extraction of chlorogenic acid in honeysuckle, and can be operated according to the following steps:
(1) The Rhizopus oryzae JYH-4-23 flat-plate culture preserved in a refrigerator at 4 ℃ is inoculated in a fresh PDA flat-plate culture medium, cultured for 54 hours at a constant temperature of 30 ℃,10 mL of sterile physiological saline is added into a culture dish, and spores are suspended by stirring of an inoculating loop, so that the spore liquid of Rhizopus oryzae JYH-4-23 is obtained. The PDA plate medium composition and formulation method are the same as in example 1.
(2) Taking 1mL (the volume percentage of the inoculum size is 2%) of the spore liquid prepared in the step (1), inoculating the spore liquid into 50mL of seed culture medium, and carrying out enzyme production culture for 30h under the constant-temperature shaking condition of 28 ℃ and 200r/min to obtain seed liquid with the dry thallus concentration of 2.15g/L, wherein the final concentration composition and the preparation method of the seed culture medium are as follows: 10g/L sucrose, 3g/L yeast extract powder, KH 2 PO 4 2g/L，MgSO 4 0.5g/L，CaCl 2 0.2g/L, tap water as solvent, pH 6.0. 250-mL triangular flask is filled with 50mL of seed culture medium, eight layers of gauze are tied up, and high-pressure steam is used for sterilization at 121 ℃ for 20min.
(3) And (3) inoculating 7.5mL (the volume percentage of the inoculum size is 5%) of the seed solution prepared in the step (2) into 150mL of an enzyme-producing culture medium, and culturing for 42h at the constant temperature of 30 ℃ under the constant shaking condition of 250r/min to obtain a fermentation broth with the dry thallus concentration of 3.43 g/L. And (3) carrying out suction filtration on all fermentation liquor by using a Buchner funnel, wherein the collected filtrate is crude enzyme solution, and the activity of beta-glucosidase of the filtrate is 36.6U/mL. The final concentration composition of the enzyme-producing culture medium is the same as that of the triangular flask of example 1, 500-mL, 150mL of enzyme-producing culture medium, eight layers of gauze are tied, and high-pressure steam is used for sterilization at 121 ℃ for 20min.
(4) Adding 30g of honeysuckle fine powder into a 250-mL triangular flask, adding 100mL of the crude enzyme solution prepared in the step (3), uniformly stirring, performing enzymolysis for 12 hours at 35 ℃, and filtering the crude enzyme solution by suction filtration through a Buchner funnel to obtain a honeysuckle powder filter cake.
(5) And (4) putting all the honeysuckle powder filter cakes pretreated by the crude enzyme solution in a 500-mL triangular flask, adding 400mL of ethanol water solution with the volume concentration of 75%, shaking uniformly, placing in a 65 ℃ water bath for leaching for 1h, and then transferring into a 60 ℃ ultrasonic cleaner for ultrasonic extraction with the power of 150W for 45min. After the ultrasonic alcohol extraction is finished, the solution is filtered by a Buchner funnel while the solution is hot, and the filtrate is concentrated to 20mL under reduced pressure at 45 ℃ to obtain chlorogenic acid concentrate.
(6) And (3) vacuum drying all the concentrates in the step (5) at 50 ℃ and minus 0.1MPa for 10 hours to constant weight, and grinding the concentrates into fine powder to obtain the crude extract of the chlorogenic acid in the honeysuckle.
According to the steps, 6.24g of crude chlorogenic acid extract of honeysuckle is obtained, the mass content of chlorogenic acid is 31.8%, 1.98g of chlorogenic acid of honeysuckle is obtained, the extraction yield is 6.61%, and the product is a grey green powder.
Example 6: application of rhizopus oryzae JYH-4-23 in extraction of chlorogenic acid in honeysuckle
The rhizopus oryzae JYH-4-23 is applied to the extraction of chlorogenic acid in honeysuckle, and can be operated according to the following steps:
(1) The Rhizopus oryzae JYH-4-23 flat-plate culture preserved in a refrigerator at 4 ℃ is inoculated in a fresh PDA flat-plate culture medium, cultivated for 48 hours at a constant temperature of 30 ℃,10 mL of sterile physiological saline is added into a petri dish, and spores are suspended by stirring with an inoculating loop, so as to obtain the spore liquid of Rhizopus oryzae JYH-4-23. The PDA plate medium composition and formulation method are the same as in example 1.
(2) Taking 1mL (the volume percentage of the inoculum size is 2%) of the spore liquid prepared in the step (1), inoculating the spore liquid into 50mL of seed culture medium, and carrying out enzyme production culture for 36h under the constant-temperature shaking condition of 30 ℃ and 250r/min to obtain seed liquid with the dry thallus concentration of 2.32g/L, wherein the final concentration composition and the preparation method of the seed culture medium are the same as those of the example 5.
(3) And (3) culturing 7.5mL (the volume percentage of the inoculum size is 5%) of the seed liquid prepared in the step (2) for 36h at the constant temperature of 30 ℃ under the shaking condition of 250r/min by using 150mL of an enzyme-producing culture medium to obtain a fermentation broth with the dry thallus concentration of 3.35 g/L. And (3) carrying out suction filtration on all fermentation liquor by using a Buchner funnel, wherein the collected filtrate is crude enzyme solution, and the activity of beta-glucosidase of the filtrate is 35.8U/mL. The final concentration composition and preparation method of the enzyme-producing medium are the same as in example 5.
(4) And (3) adding 50g of honeysuckle fine powder into a 500-mL triangular flask, adding 200mL of the crude enzyme solution prepared in the step (3), uniformly stirring, and carrying out enzymolysis for 14h at 35 ℃, and carrying out suction filtration on the crude enzyme solution by using a Buchner funnel to obtain a honeysuckle powder filter cake.
(5) And (4) putting all the honeysuckle powder filter cakes pretreated by the crude enzyme solution in a 1-L triangular flask, adding 500mL of 80% ethanol water solution with volume concentration, shaking uniformly, placing in a water bath at 60 ℃ for leaching for 1h, and then transferring into an ultrasonic cleaner at 60 ℃ for ultrasonic extraction with power of 200W for 30min. After the ultrasonic alcohol extraction is finished, the solution is filtered by a Buchner funnel while the solution is hot, and the filtrate is concentrated to 25mL under reduced pressure at 45 ℃ to obtain chlorogenic acid concentrate.
(6) And (3) vacuum drying all the concentrates in the step (5) at 50 ℃ and minus 0.1MPa for 10 hours to constant weight, and grinding the concentrates into fine powder to obtain the crude extract of the chlorogenic acid in the honeysuckle.
According to the steps, 9.75g of crude chlorogenic acid extract of honeysuckle is obtained, the mass content of chlorogenic acid is 33.6%, 3.28g of chlorogenic acid of honeysuckle is obtained, the extraction yield is 6.55%, and the product is a grey green powder.
If the honeysuckle powder is not subjected to enzymolysis pretreatment in the steps (1) to (4) in the embodiment, 50g of honeysuckle powder can be extracted according to the method in the embodiment to obtain 7.16g of honeysuckle chlorogenic acid crude extract, the mass content of chlorogenic acid is 32.3%, and 2.31g of honeysuckle chlorogenic acid is obtained, the extraction yield is 4.63%, and the product is a greenish-grey powder. Therefore, the pretreatment of the rhizopus oryzae JYH-4-23 crude enzyme solution is added before the ultrasonic ethanol extraction of the chlorogenic acid in the honeysuckle, and compared with the conventional method without adopting the enzymolysis pretreatment, the extraction yield of the chlorogenic acid in the honeysuckle can be improved by 41.5 percent.
Sequence listing
<110> Zhejiang university Zheshan food and drug inspection and detection institute
<120> Rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 505
<212> DNA
<213> Rhizopus oryzae (Rhizopus oryzae)
<400> 1
tcccacccgt gtttatcgta ccttgttgct tcggcgggcc cgcctcacgg ccgccggggg 60
gcttctgccc tctggcccgc gcccgccgaa gacaccattg aacgctgtct gaagattgca 120
gtctgagcaa ttagctaaat aagttaaaac tttcaacaac ggatctcttg gttccggcat 180
cgatgaagaa cgcagcgaaa tgcgatacgt aatgtgaatt gcagaattca gtgaatcatc 240
gagtctttga acgcacattg cgccccttgg tattccgggg ggcatgcctg tccgagcgtc 300
attgctgccc tcaagcacgg cttgtgtgtt gggccccgtc ctccttcccg ggggacgggc 360
ccgaaaggca gcggcggcac cgcgtccggt cctcgagcgt atggggcttc gtcttccgct 420
cttgtaggcc cggccggcgc ttgccgacaa caatcaatct tttttcaggt tgacctcgga 480
tcaggtaggg atacccgctg aactt 505
Claims (10)
1. Rhizopus oryzae (Rhizopus oryzae) JYH-4-23 deposited at the microorganism strain collection, guangdong province, accession number: GDMCC No. 61966, storage date 2021, 9 months 29 days, address: building 5 of No. 59 of Qinghui No. 100 college in Guangzhou City of Guangdong; postal code 510070.
2. An application of rhizopus oryzae JYH-4-23 in extracting chlorogenic acid of honeysuckle according to claim 1, which is characterized in that the application method is as follows: filtering fermentation liquor of rhizopus oryzae JYH-4-23 through fermentation culture, and obtaining filtrate which is crude enzyme liquid; mixing the crude enzyme solution with flos Lonicerae, performing enzymolysis at 30-35deg.C for 10-14 hr, and filtering to obtain flos Lonicerae powder filter cake after enzymolysis; adding ethanol water solution into the filter cake for leaching, then carrying out ultrasonic extraction, carrying out suction filtration, concentrating the filtrate to obtain ethanol extract concentrate of honeysuckle, and carrying out vacuum drying to obtain chlorogenic acid.
3. The use according to claim 2, wherein the crude enzyme liquid is present in an amount of 3-4mL/g based on the mass of honeysuckle, which is dried and crushed at 85 ℃ and sieved through a 40 mesh sieve before addition.
4. The use according to claim 2, characterized in that the crude enzyme solution is prepared by: inoculating Rhizopus oryzae JYH-4-23 into enzyme-producing culture medium, culturing at 28-30deg.C under 200-250r/min constant temperature shaking condition for 36-48 hr, filtering fermentation broth, and collecting filtrate to obtain crude enzyme solution; the final concentration composition of the enzyme-producing culture medium is as follows: bran 15-20g/L, (NH) 4 ) 2 SO 4 3–4g/L，KH 2 PO 4 2–5g/L，MgSO 4 0.5–1.0g/L，CaCl 2 0.2-0.5g/L, tap water as solvent, and pH 6.0-6.5.
5. The use according to claim 4, wherein the enzyme-producing medium consists of: bran 20g/L, (NH) 4 ) 2 SO 4 4g/L，KH 2 PO 4 2g/L，MgSO 4 0.5g/L，CaCl 2 0.2g/L, tap water as solvent, pH 6.0.
6. The use according to claim 2, wherein before fermentation, rhizopus oryzae JYH-4-23 is subjected to activation culture in a plate culture medium to prepare spore liquid or is subjected to expansion culture in a seed culture medium to prepare seed liquid, and then the spore liquid or the seed liquid is inoculated into an enzyme-producing culture medium for enzyme production culture in an amount of 2% -5% of volume concentration, and the method comprises the steps of:
(1) And (3) activating and culturing: rhizopus oryzae JYH-4-23 was inoculated in PDA plate medium and incubated at 28-30deg.C for 48-60h to obtain plate culture; adding sterile physiological saline into the plate culture, stirring with an inoculating loop to suspend spores to obtain rhizopus oryzae JYH-4-23 spore liquid; the final concentration composition of the PDA plate culture medium is as follows: 200g/L of potato, 20g/L of sucrose and 20g/L of agar, wherein the solvent is tap water, and the pH is natural;
(2) Seed expansion culture: inoculating the rhizopus oryzae JYH-4-23 spore liquid subjected to the activation culture in a seed culture medium according to the inoculum size with the volume concentration of 2% -5%, and culturing for 30-36h at the constant temperature oscillation condition of 28-30 ℃ and 200-250r/min to obtain seed liquid; the final concentration composition of the seed culture medium is as follows: 10-15g/L sucrose, 3-5g/L yeast extract powder, KH 2 PO 4 2–3g/L，MgSO 4 0.3–0.5g/L，CaCl 2 0.1-0.2g/L, tap water as solvent, and pH 6.0-6.5.
7. The application of claim 2, wherein the ethanol water solution leaching is characterized in that the gold and silver pollen filter cake after enzymolysis is added into ethanol water solution with volume concentration of 70-80%, stirred uniformly and then placed into water bath with the temperature of 50-60 ℃ for leaching for 1-2h; the dosage of the ethanol aqueous solution is 10-15mL/g based on the mass of the honeysuckle powder.
8. The use according to claim 2, wherein the ultrasonic extraction is carried out by leaching with ethanol aqueous solution, transferring into ultrasonic cleaner at 60deg.C, and ultrasonic extracting at power of 100-200W for 30-60min.
9. The use according to claim 2, characterized in that the preparation method of the alcoholic extract concentrate of honeysuckle is: adding the gold and silver pollen filter cake subjected to enzymolysis into 70-80% ethanol water solution, stirring uniformly, placing into 50-60 ℃ water bath for leaching for 1-2h, and then transferring into a 60 ℃ ultrasonic cleaner for ultrasonic extraction for 30-60min at power of 100-200W; after ultrasonic alcohol extraction is finished, filtering while the solution is hot, concentrating the filtrate at 45 ℃ under reduced pressure to 1/20-1/15 of the original volume to obtain a concentrate; the dosage of the ethanol aqueous solution is 10-15mL/g based on the mass of the honeysuckle powder.
10. Use according to claim 2, characterized in that the vacuum drying conditions are: vacuum drying at 50 deg.C and-0.1 MPa to constant weight.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111298073.XA CN114085778B (en) | 2021-11-04 | 2021-11-04 | Rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111298073.XA CN114085778B (en) | 2021-11-04 | 2021-11-04 | Rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114085778A CN114085778A (en) | 2022-02-25 |
| CN114085778B true CN114085778B (en) | 2023-09-15 |
Family
ID=80298822
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111298073.XA Active CN114085778B (en) | 2021-11-04 | 2021-11-04 | Rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114085778B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116041561A (en) * | 2022-11-08 | 2023-05-02 | 浙江树人学院 | Method for extracting lotus leaf polysaccharide with assistance of microbial fermentation |
| CN116622526B (en) * | 2023-07-20 | 2023-10-10 | 苏陀科技(北京)有限公司 | Rhizopus oryzae strain and application thereof in mycelium protein production |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102443619A (en) * | 2010-10-09 | 2012-05-09 | 苏州宝泽堂医药科技有限公司 | Method for extracting chlorogenic acid and hederagenin from honeysuckle flower |
| CN103435486A (en) * | 2013-09-12 | 2013-12-11 | 南京泽朗农业发展有限公司 | Novel method for preparing high-purity chlorogenic acid in honeysuckle |
-
2021
- 2021-11-04 CN CN202111298073.XA patent/CN114085778B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102443619A (en) * | 2010-10-09 | 2012-05-09 | 苏州宝泽堂医药科技有限公司 | Method for extracting chlorogenic acid and hederagenin from honeysuckle flower |
| CN103435486A (en) * | 2013-09-12 | 2013-12-11 | 南京泽朗农业发展有限公司 | Novel method for preparing high-purity chlorogenic acid in honeysuckle |
Non-Patent Citations (2)
| Title |
|---|
| 微生物发酵蒲公英粗提物对绿原酸含量的影响;刘国庆等;农产品加工(创新版)(第12期);第38-41页 * |
| 绿原酸清洁提取及其体外生物活性评价;王星敏等;食品与生物技术学报;第36卷(第2期);第172-178页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114085778A (en) | 2022-02-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114085778B (en) | Rhizopus oryzae JYH-4-23 and application thereof in extraction of chlorogenic acid in honeysuckle | |
| CN112481134B (en) | Method for extracting mulberry leaf polysaccharide by using microbial fermentation method | |
| CN113564212B (en) | Method for extracting eucommia ulmoides leaf polysaccharide by utilizing microbial fermentation method | |
| CN112574890B (en) | Mucor racemosus SY5-47 and application thereof in mulberry leaf flavone extraction | |
| CN104893983B (en) | Liquid state fermentation low citrinin, the preparation method of High color values monascorubin and product | |
| CN111334440A (en) | Rhizopus oryzae CH5 and application thereof in extraction of ganoderma sinensis polysaccharide | |
| CN111218406A (en) | Mucor circinelloides MF-8 and application thereof in improving content of taxifolin in rhizoma smilacis glabrae | |
| CN114933973B (en) | Mucor lassitanum HZ-6-27 and application thereof in extraction of rhizoma polygonati polysaccharide | |
| CN114606137B (en) | Aspergillus japonicus HY-8-25 and application thereof in rosemary essential oil extraction | |
| CN114196578B (en) | Aspergillus aculeatus NM-11-6 and application thereof in lemon essential oil extraction | |
| CN110551636B (en) | Monascus purpureus MY-21 strain and application thereof | |
| CN116024096A (en) | Aspergillus awamori SR3-28 and application thereof in extraction of emodin from radix Ardisiae Crenatae | |
| CN113564055B (en) | Felt Mao Qingmei DZ-9-67 and application thereof in extraction of total flavonoids of eucommia ulmoides leaves | |
| CN110699263B (en) | Aspergillus niger YH-6 and application thereof in improving content of icaritin in epimedium | |
| CN116549507B (en) | Method for preparing radix puerariae extract by microbial fermentation method | |
| CN116042407A (en) | Rhizopus arrhizus AS7-34 and application thereof in extraction of angelica sinensis polysaccharide | |
| CN118027240A (en) | Method for extracting sea buckthorn leaf polysaccharide with assistance of microbial fermentation | |
| CN115353981B (en) | Liquid fermentation culture method of trephine hirsutum and active metabolite | |
| CN115960725A (en) | Aspergillus terreus HBJ5-32 and application thereof in extraction of Hangzhou white chrysanthemum total flavonoids | |
| CN116115675B (en) | Method for extracting loquat leaf total flavonoids by microbial enzymolysis | |
| CN116041561A (en) | Method for extracting lotus leaf polysaccharide with assistance of microbial fermentation | |
| CN116042409A (en) | Aspergillus niger HY4-25 and application thereof in extracting lotus leaf total flavonoids | |
| CN116144506A (en) | Aspergillus terreus DK3-18 and application thereof in extracting persimmon leaf total flavonoids | |
| CN112300948B (en) | Phellinus igniarius laser pulse intense light combined mutagenesis strain and ultrasonic enhanced fermentation method thereof | |
| CN115894726A (en) | Method for extracting chrysanthemum morifolium polysaccharide by microbial enzymolysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |