CN116023451A - Pathogenic regulatory protein containing FYVE and ANK structural domain, and coding gene and application thereof - Google Patents

Abstract

The invention discloses a pathogenic regulatory protein from phytophthora sojae (Phytophthora sojae) containing FYVE and ANK domains, and a coding gene and application thereof. The pathogenic regulatory protein PsZFANK5 containing FYVE and ANK domains has an amino acid sequence shown in SEQ ID No.4, and the coding gene thereof has a nucleotide sequence shown in SEQ ID No. 3. The main function of the PsZFANK5 protein is necessary for the complete virulence of phytophthora sojae. The gene provided by the invention has high application value in controlling phytophthora sojae root rot, and the developed bactericide has important practical significance in controlling the occurrence and epidemic of phytophthora sojae root rot by taking the protein as an action target.

Description

Pathogenic regulatory protein containing FYVE and ANK structural domain, and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, relates to a novel pathogenic regulatory protein of pathogenic oomycetes, and a coding gene and application thereof, and in particular relates to a pathogenic regulatory protein PsZFANK5 containing FYVE and ANK from phytophthora sojae, and a coding gene and application thereof.

Background

Phytophthora sojae (Phytophthora sojae) is one of the important soil-borne plant pathogenic oomycetes, first known by the world in North America in the fifties of the 20 th century, whose host range is very narrow and the only crop that can be infested is soybean. Apomixis of phytophthora sojae generally produces three types of asexual spores: the sporocysts, zoospores and chlamydospores can be matched with the Zong to produce oospores in sexual reproduction, so that the service life is longer, the capability of resisting stress is higher, and the sexual reproduction can develop into infection hyphae in a proper environment. The infected soybean starts from the root and then infects the stem, can grow under moist conditions and in dense or heavy clay soil, can cause rot of soybean seeds, lodging of seedlings, wilting and rot of rootstocks, and the like, and can cause serious economic loss in fields. The phytophthora sojae hosts have a narrow range, are a semi-living nutrient pathogenic oomycete, and enter a dead body nutrition stage after the initial nutrition of the infected host is successful, wherein the cell death of plants is controlled along with a complex molecular mechanism. Active oxygen plays an important role in the interaction process of phytophthora sojae and a host, and when a plant senses pathogen infection, PTI (PAMP triggered immunity, PTI) of the plant is stimulated first, and disease-resistant reactions such as active oxygen outbreak and the like are generated so as to resist the pathogen infection. Pathogenic bacteria also secrete effectors to attenuate the effects of host reactive oxygen species production. If the phytophthora sojae can lose the capacity of generating active oxygen against a host, the infection of the phytophthora sojae can be controlled, and the disease prevalence can be controlled.

Disclosure of Invention

Based on the above, research of the inventor finds that the pathogenic regulatory proteins containing FYVE and ANK domains in phytophthora sojae are related to the complete virulence of the phytophthora sojae to infect soybean, so that the normal infection of the phytophthora sojae can be blocked by controlling the pathogenic regulatory proteins containing FYVE and ANK domains, and the large-scale transmission and epidemic of the phytophthora sojae can be controlled (inhibited or blocked).

Thus, the invention provides a pathogenic regulatory protein containing FYVE and ANK in phytophthora sojae, named PsZFANK5, which has an amino acid sequence with the amino acid sequence shown in SEQ ID No.4 or an amino acid sequence with the amino acid sequence shown in SEQ ID No.4 being more than 93%, preferably more than 95%, more preferably more than 98% and having the same function as the amino acid sequence shown in SEQ ID No. 4.

Generally, amino acid sequences (or protein sequences) or nucleic acid sequences, in particular essential amino acid sequences (essential protein sequences) or essential nucleic acid sequences, which are homologous and functionally identical or similar are included in the same species, which sequences are not necessarily 100% identical, since different strains of the same species are subjected to geographical conditions, external circumstances such as temperature, humidity and cultivars, and various mutations, including nonsense mutations, are liable to occur, but because of the importance of their function to the survival or growth of the species, these mutations do not or substantially not affect the running of their function. Thus, even in the same species, a certain range of differences from the amino acid sequence shown in SEQ ID No.4 of the pathogenic regulatory protein of the present invention is allowed.

Wherein, the amino acid sequence of the invention can be an amino acid sequence which is shown as SEQ ID No.4, has the same function as the amino acid sequence shown as SEQ ID No.4 through substitution and/or deletion and/or addition of one or more amino acid residues.

For convenient purification, fusion proteins obtained by ligating a tag to the N-terminus and/or C-terminus of the protein shown in SEQ ID No. 4; the tag may be a tag such as Poly-Arg (RRRRR), poly-His (HHHHH), FLAG (DYKDDDDK), strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL), etc.

The pathogenic regulatory protein of the invention is generally derived from phytophthora sojae in nature, i.e. generally, is a natural product and can be expressed or synthesized artificially.

In the present invention, the amino acid sequence of the pathogenic regulatory protein may be specifically shown as SEQ ID No. 4. The protein shown in SEQ ID No.4 consists of 634 amino acid residues, wherein the FYVE domain has the amino acid residue sequence from 228 th to 285 th of the middle end of the SEQ ID No.4, and the ANK domain has the amino acid residue sequence from 24 th to 106 th of the amino end.

The second invention provides a coding gene PsZFANK5 of the pathogenic regulatory protein. The coding gene preferably has a DNA sequence shown as SEQ ID No.3 or a DNA sequence which has a similarity of 75% or more, more preferably 85% or more, still more preferably 95% or more with the DNA sequence shown as SEQ ID No.3 and has the same function as the DNA sequence shown as SEQ ID No.3, such as cDNA or recombinant DNA. For example, in the present invention, the DNA sequence of the pathogenic regulatory protein includes the DNA sequence of the pathogenic regulatory protein present in a different strain of Phytophthora sojae (for example, the strain P6497 of Phytophthora sojae).

In the present invention, the DNA sequence (coding gene and cDNA) of the pathogenic regulatory protein can be specifically shown as SEQ ID No. 3.

The third invention provides an RNA sequence transcribed from any of the above DNA sequences. Such as mRNA, etc. Preferably, the RNA sequence is an RNA sequence having a similarity of 75% or more, more preferably 85% or more, still more preferably 95% or more, with the RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 3. Most preferably, the RNA sequence is an RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 3.

The fourth aspect of the present invention provides a biological material related to the pathogenic regulatory protein, the coding gene, or the RNA molecule, which is any one of the following D1) to D10):

d1 An expression cassette containing the coding gene;

d2 A recombinant vector containing the coding gene or a recombinant vector containing the expression cassette of D1);

d3 A recombinant microorganism containing the coding gene, or a recombinant microorganism containing the expression cassette of D1), or a recombinant microorganism containing the recombinant vector of D2);

d4 A transgenic plant cell line comprising said coding gene, or a transgenic plant cell line comprising D1) said expression cassette;

d5 A transgenic plant tissue comprising said coding gene, or a transgenic plant tissue comprising D2) said expression cassette;

d6 A transgenic plant organ comprising said coding gene, or a transgenic plant organ comprising D2) said expression cassette;

d7 A nucleic acid molecule that inhibits expression of the encoding gene; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the encoding gene, or silences the encoding gene; wherein, the nucleic acid molecule for knocking out the coding gene comprises an RNA molecule with a sequence shown as UGAUAUUAACCGCCUCUCCU, GCCUUCUUGAACCAACCCGG or a DNA molecule which codes for the RNA molecule and is shown as SEQ ID No.23 and SEQ ID No.24 in a sequence table;

d8 An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing or expressing D7) said nucleic acid molecule;

d9 A nucleic acid molecule that inhibits translation of the RNA molecule;

d10 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing or expressing D9) said nucleic acid molecule.

The fifth object of the present invention is to provide the application of the pathogenic regulatory protein, its coding gene or the RNA molecule or the biological material in controlling the complete pathogenicity of oomycetes;

preferably, the oomycete is phytophthora sojae (Phytophthora sojae), most preferably phytophthora sojae (Phytophthora sojae) P6497.

It is a sixth object of the present invention to provide a method for inhibiting and/or killing oomycete growth by enhancing the inhibition of oomycete by active oxygen (e.g., hydrogen peroxide), which comprises inhibiting and/or killing the oomycete growth by gene knockout, or inhibiting translation of an RNA sequence, or inhibiting and/or inhibiting activity of a pathogenic regulatory protein; the amino acid sequence of the pathogenic regulatory protein containing FYVE and ANK domains is the amino acid sequence shown in SEQ ID No. 4; the DNA sequence is a DNA sequence capable of encoding the pathogenic regulatory protein; the RNA is an RNA sequence obtained by transcription of the DNA sequence; wherein, the inhibition of active oxygen to oomycetes is improved, the survival rate of the oomycetes in the presence of active oxygen is reduced, and the growth of oomycetes (oomycotta) is inhibited and/or killed; the oomycete is phytophthora sojae (Phytophthora sojae).

Preferably, the cDNA sequence of the pathogenic regulatory protein is a DNA sequence shown as SEQ ID No. 3.

Preferably, the method is used for inhibiting and/or killing oomycete diseases generated by soybeans.

The present invention also provides a method for controlling (inhibiting or blocking) the full pathogenicity of oomycetes, which comprises controlling (inhibiting or blocking) the full pathogenicity of oomycetes by inhibiting the expression of the coding gene of the aforementioned pathogenic regulatory protein or knocking out the coding gene, or inhibiting the translation of the aforementioned RNA, or inhibiting and/or inactivating the activity of the aforementioned pathogenic regulatory protein; the oomycete is phytophthora sojae (Phytophthora sojae). The oomycete is preferably a phytophthora sojae strain P6497.

The invention also provides a method for reducing the capability of an oomycete infected host, which is to reduce the capability of the oomycete infected host by controlling complete pathogenicity according to the claims; the host is soybean.

The method for controlling the complete pathogenicity of the phytophthora sojae comprises the step of knocking out any one of the DNA sequences to control the formation of the complete pathogenicity of the phytophthora sojae. The phytophthora sojae comprises a phytophthora sojae strain P6497.

In one embodiment of the present invention, wherein the above-described gene knockout method employs CRISPR/Cas 9-based gene knockout.

Specifically, the CRISPR/Cas 9-based gene knockout method is to transfect a target gene Donor vector, sgRNA and Cas9 co-expression plasmid into phytophthora sojae to obtain the target knockout protein inactivated recombinant strain through screening.

Wherein the Donor vector is a recombinant vector containing a sequence of 800-1500bp upstream of a target gene to be knocked out, a screening gene and a sequence of 800-1500bp downstream of the target gene to be knocked out which are connected in sequence.

Preferably, the Donor vector is a recombinant vector containing a sequence 1000bp upstream of a target gene to be knocked out, a screening gene and a sequence 1000bp downstream of the target gene to be knocked out which are connected in sequence. The substitution is performed by mCherry gene shown in SEQ ID No.29, the sequence 1000bp upstream of the target gene has the DNA sequence of SEQ ID No.27 in the sequence table, and the sequence 1000bp downstream of the target gene has the DNA sequence shown in SEQ ID No.28 in the sequence table.

The sgRNA expressed by the sgRNA and Cas9 coexpression plasmid is UGAUAUUAACCGCCUCUCCU, GCCUUCUUGAACCAACCCGG.

Preferably, the sgRNA and Cas9 co-expression plasmid is a CRISPR-Cas9 system expression vector containing a coding DNA fragment for expressing the sgRNA of the target gene to be knocked out, wherein the coding DNA of the sgRNA of the target PsZFANK5 gene is SEQ ID No.23 or SEQ ID No.24 in a sequence table.

Preferably, the sgRNA and Cas9 co-expression plasmid is a starting vector, wherein PYF515 is taken as the starting vector, and the DNA fragment shown in SEQ ID No.23 or SEQ ID No.24 is respectively inserted between BsaI and NneI enzyme recognition sites of PYF515 to obtain a recombinant expression vector for expressing the sgRNA and Cas9.

The invention provides a method for detecting the transfer level of pathogenic regulatory protein containing FYVE structural domain in phytophthora sojae, which comprises selecting any one of 80-300bp, especially 150-200bp long target sequence in any one of DNA sequences to carry out reverse transcription fluorescence quantitative PCR detection; preferably also included are internal reference sequences. The phytophthora sojae comprises a phytophthora sojae strain P6497.

The eighth invention provides a primer sequence for amplifying the expression level of pathogenic regulatory proteins containing FYVE and ANK domains in phytophthora sojae, namely a primer sequence for amplifying a target sequence, wherein the primer sequence is preferably shown as SEQ ID No.5 and SEQ ID No. 6; more preferably, the primer sequences of the internal reference sequences are shown in SEQ ID Nos. 13-14. The phytophthora sojae comprises a phytophthora sojae strain P6497.

A primer and/or primer pair that amplifies the entire length of the DNA sequence encoding the pathogenic regulatory protein described above or any DNA sequence thereon is also within the scope of the present invention.

Experiments prove that the pathogenic regulatory protein provided by the invention plays a role in the process of infecting host soybeans by phytophthora sojae and utilizes PEG-CaCl ₂ The pathogenicity of the knockout transformant obtained by the mediated protoplast transformation technique is significantly reduced (the pathogenicity reduction cases of phytophthora sojae P6497 and knockout mutant ΔPsZFANK5-3 (ΔZFANK5-3 in FIG. 4) are shown in FIG. 4), and the restoring phenotype of the full-length transformant is restored (restoring of the pathogenicity of the complementation transformant is shown in FIG. 6). Therefore, the pathogenic regulatory protein PsZFANK5 containing FYVE and ANK domains in phytophthora sojae can regulate and control the complete virulence of phytophthora sojae, and the infection process of phytophthora sojae can be controlled by inhibiting the function of the protein, so that the disease pandemic is controlled. The invention provides a technical foundation for further developing the development process and molecular detection technology of phytophthora sojae and the prevention and research of plant diseases caused by phytophthora sojae.

Drawings

FIG. 1 is an analysis chart of the expression pattern of the Phytophthora sojae PsZFANK5 gene in different development stages of Phytophthora sojae (the abscissa is from left to right: hypha (My), sporangium (Sp), zoospore (Zo), resting spore (Cy), resting spore germination (Cg), infected soybean leaves 1.5h, 3h, 6h, 12h, 24h, 48 h).

FIG. 2 is a schematic representation of a knockout vector, with homology arms on the left to replace the vector, and sgRNA on the right.

FIG. 3 shows the PCR identification results of the inside of the soybean phytophthora PsZFANK5 knockout mutant gene, namely a wild soybean phytophthora strain P6497 and the knockout mutant (delta ZA5-1, delta ZA5-3, delta ZA5-5 and delta ZA5-7 in the figure) in sequence from left to right.

FIG. 4 shows the pathogenicity reduction photographs of most leaves of wild type Phytophthora sojae strain P6497, psZFANK5 gene knockout mutant ΔPsZFANK5-3 (ΔZFANK5-3 in the figure) in a cake-to-cake manner (36 h after inoculation).

FIG. 5 is a schematic diagram of PsZFANK5 domains including ANK, FYVE, etc.

FIG. 6 is a schematic representation of the infection of the soybean hypocotyl by the hyphae of the anaplerotic transformants by the infection of most of the leaves and zoospores. The wild type Phytophthora sojae strain P6497, the PsZFANK5 knockout full-length complementation transformant (C16 in the figure), the PsZFANK5 knockout over-expression complementation transformant (OE-ZA 5-2 in the figure) and the PsZFANK5 full-length knockout transformant (ΔZA5-1 and ΔZA5-3 in the figure) are sequentially arranged from left to right from the first row, and the scale=2cm.

FIG. 7 is a graph showing colony morphology and hypha growth rate. FIG. 7 shows colony morphology of wild type Phytophthora sojae strain P6497 and PsZFANK5 knockout transformants in order from left to right.

FIG. 8 is a graph showing the hydrogen peroxide tolerance assay of PsZFANK5 knockout transformants. In FIG. a, wild type Phytophthora sojae strain P6497, psZFANK5 knockout transformants ΔZA5-1, ΔZA5-3 and ΔZA5-7, and PsZFANK5 knockout full-length complementation transformants C16 and C18 were grown on plates inoculated with 3mM hydrogen peroxide V8 (10% V8 juice, 1% calcium carbonate and 1.5% agar powder). Figure b is the quantization result of figure a.

FIG. 9 is a graph of a PsZFANK5 knockout transformant sensitive to mitochondrial respiration inhibitor SDHI class agents. Wherein wild type phytophthora sojae strain P6497 and PsZFANK5 knockout transformants delta ZA5-1, delta ZA5-3, delta ZA5-7, delta ZA5-10, delta ZA5-11 and delta ZA5-13 are respectively inoculated to V8 plates of 0.5mg/L zoxamide and 0.1mg/L pyraclostrobin, and the drug-free V8 plate plates are used as controls. Wherein both the control group and the treatment group were supplemented with 100mg/L of salicylic oxime acid to inhibit the alternative oxidation pathway.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The wild-type strain P6497 of Phytophthora sojae is the standard strain of Phytophthora sojae taught gift by Brett M.Tyler, U.S.A. The above strains are merely materials used in the examples of the present invention, and in fact, the phytophthora strains can be obtained using any commercially available route when the screening markers of the present invention are applied.

All of the above strains have been identified by existing morphological and molecular biological methods.

EXAMPLE 1 cloning of FYVE domain-containing pathogenic regulatory protein PsZFANK5 Gene in Phytophthora sojae

1.1 Phytophthora sojae Total RNA extraction

After the phytophthora sojae strain P6497 is subjected to dark culture for 4 days on a 10% V8 solid culture medium at 25 ℃, fungus cakes with the diameter of 5mm are taken from the edges of the colonies, inoculated into a 10% V8 liquid culture medium (10% V8 juice and 1% calcium carbonate), mycelia are collected after the fungus cakes are subjected to dark culture for 4 days at 25 ℃, about 30mg of mycelia are taken, and the mycelia are placed into a 2mL sterile centrifuge tube, two steel balls with the diameter of 5mm are added, and the mixture is ground into powder by a ball mill after being frozen by liquid nitrogen. Phytophthora sojae RNA was extracted using the SV Total RNA extraction kit (Z3100) from Promega company, and specific method steps were referred to the instructions for extracting RNA from plant tissues in the kit.

1.2 Synthesis of first Strand cDNA from Phytophthora sojae reverse transcription

First Strand cDNA Synthesis Using Takara Co

RT reagent Kit with gDNA Eraser (Perfect Real Time) kit (RR 047A). The method comprises the following specific steps:

(1) Genomic DNA was removed (10 μl reaction system): 5X gDNA Eraser Buffer. Mu.L; gDNA Eraser 1. Mu.L; total RNA 2. Mu.L; RNase-free ultrapure water 5. Mu.L.

(2) Reverse transcription reaction (10 μl reaction system): 10 mu L of the reaction solution in the step (1); 5×

Buffer 4μL；/>

RT Enzyme Mix I L. Mu.L; RT Primer Mix. Mu.L; RNase-free ultrapure water 4. Mu.L.

Reaction conditions: 15min at 37 ℃; 5s at 85 ℃; preserving at 4 ℃. The obtained cDNA was diluted 4-fold for Real time PCR reaction.

1.3PsZFANK5 Gene cloning

Designing a primer for cloning pathogenic regulatory protein genes containing FYVE structural domain in phytophthora sojae, and performing PsZFANK5-F: ATGAAGCCCAAGGCCGC (SEQ ID No. 1); psZFANK5-R: TTACCATCCAACAGTCATCGAGC (SEQ ID No. 2). And (3) taking the phytophthora sojae cDNA and the genome obtained in the step (1.2) as templates, carrying out PCR amplification by using the primers, recovering amplified products, respectively connecting with a T1-simple Vector (Beijing full-type gold biotechnology Co., ltd.), converting competent cells of the escherichia coli T1, screening positive clones, extracting plasmids of the positive clones, sequencing, and carrying out sequencing, wherein the sequencing result shows that the PsZFANK5 gene cDNA has a nucleotide sequence shown as a sequence 3 in a sequence table, and the inventor shows that the coding genes are consistent with the cDNA sequence by amplifying and sequencing the genome. Sequence 3 consists of 1905 nucleotides and encodes a protein of 634 amino acids (SEQ ID No. 4), which is designated PsZFANK5. Wherein the FYVE domain has the sequence from 228 th to 285 th amino acid residues at the middle end of SEQ ID No.4, and the ANK domain has the sequence from 24 th to 106 th amino acid residues at the amino end.

Sequence 3 in the sequence listing is shown below:

/>

sequence 4 in the sequence listing is shown below:

EXAMPLE 2 analysis of the expression Pattern of the PsZFANK5 Gene at different stages of Phytophthora sojae

The kit is selected as follows: takara TB Green ^TM Premix Ex Taq ^TM II (Tli RNase H Plus) (Code: RR 820A). Dilution of cDNA samples at hypha stage with 0, 4, respectively ² 、4 ³ 、4 ⁴ 、4 ⁵ 、4 ⁶ By times, a real-time fluorescence quantitative PCR standard curve is established by taking PsActin (primer sequences shown in SEQ ID No.13 and SEQ ID No. 14) as an internal reference gene and PsZFANK5 as a detection gene. The amplification efficiency of the gene primer is over 90 percent, and the appropriate diluted sample concentration is selected for the next test.

Samples at different development stages and infection stages are diluted by 4 times to be used as templates, psActin is used as an internal reference gene, and a detection primer PsZFANK5-qPCR F/PsZFANK5-qPCRR (the sequences are shown as SEQ ID No.5 and SEQ ID No. 6) is utilized to carry out real-time fluorescence quantitative PCR detection. The qPCR reaction system was 20. Mu.L: 10 mu L TB Green Premix Ex Taq II, 1.6 mu L template, 0.8 mu L F/R primer each, 6.8 mu L ddH ₂ O. The reaction procedure is a two-step process: 95 ℃ for 30s;95℃for 5s,60℃for 30s,40 cycles. Through 2 ^-ΔΔCt And calculating the relative expression quantity of the PsZFANK5 gene at different development stages of phytophthora sojae.

As shown in FIG. 1, the result is normalized by the mycelium stage of P6497 of Phytophthora sojae, psZFANK5 is remarkably high-expressed in zoospore stage and telogen germination stage of Phytophthora sojae, and the initial expression amount in the infection stage is reduced.

EXAMPLE 3 obtaining of knockout transformant of Phytophthora sojae PsZFANK5 Gene

3.1 construction of knockout vector of Phytophthora sojae PsZFANK5 Gene

(1) Obtaining candidate sgrnas

The design of the sgRNA of PsZFANK5 was performed by EuPaGDT (http:// grna. Ctegd. Uga. Edu /), and the search was performed by inputting the full length of the genome into the website.

(2) Secondary structure screening

And analyzing the secondary structure of the candidate sgRNA by using a website tool (http:// rna. Urmc. Rochester. Edu/RNAstructureWeb/Servers/pretreatment 1. Html), and selecting the number of complementary bridges forming the hairpin as the candidate sgRNA, wherein the number is less than or equal to 3.

(3) Off-target analysis

The risk of off-target was considered higher by performing off-target analysis on sgrnas by FungiDB (www.fungidb.org), inputting a total of 23 bases including PAM region for alignment, including the case of 9 to 23 (NGG containing) perfect matches.

(4) And (3) selecting ideal sgRNA for synthesis (the DNA molecular sequences for expressing the sgRNA are shown in SEQ ID No.23 and SEQ ID No.24, and the sgRNA sequences are UGAUAUUAACCGCCUCUCCU and GCCUUCUUGAACCAACCCGG respectively, and the 1404 th to 1423 th nucleic acid sequences of the 5 'end and the 478 th to 497 th nucleic acid sequences of the 5' end of the sequence 3 in the sequence table are targeted respectively.

(5) The construction of the sgRNA expression vector (structure as the sgRNA vector in FIG. 2) was carried out using PYF515 (published vector, fang Y, cui L, gu B, et al 2017. Effect genome editing in the oomycete Phytophthora sojae using CRISPR/cas9.Current Protocols in Microbiology,44:21A.1.1-21 A.1.26.) as a backbone vector according to the published method of the literature (described in Fang Y, cui L, gu B, et al 2017. Effect genome editing in the oomycete Phytophthora sojae using CRISPR/cas9.Current Protocols in Microbiology,44:21A.1.1-21 A.1.26.). sgRNA encoding DNA annealing treatment (30. Mu.L System): 3. Mu.L of sense strand, 3. Mu.L of antisense strand, 3. Mu.L of 10 XT 4 DNA Ligase Buffer (NEB), 2. Mu. L T4 Polynudeotides and 19. Mu.L of ddH ₂ O,37 ℃ for 30min; adding 4 μL of 0.5M NaCl at 100deg.C for 2min; slowly cooling at room temperature for about 3-4 h; dilute 1. Mu.L, add 499μL ddH ₂ O; enzyme cutting sites BsaI and NneI are selected to enzyme-cut PYF515 plasmid, so that the plasmid is linearized; ligation plasmid: 3. Mu.L of DNA encoding the diluted and annealed sgRNA fragment (SEQ ID No.23 or SEQ ID No. 24), 2. Mu.L of 10×T DNA Ligase Buffer (NEB), 1. Mu. L T4 DNA Polynudeotide,50ng PYF515 linear plasmid, ddH ₂ O was added to 20. Mu.L at 25℃for 30min. Transferring the connection product into competent cells of escherichia coli DH5 alpha, ice-bathing for 30min, heat-shocking for 42 s, ice-bathing for 2min, adding non-resistant LB, shaking and culturing for 60min, coating bacterial liquid on an LB plate with Amp resistance, culturing overnight at 37 ℃, amplifying and sequencing by using a universal primer M13F (sequence: TGTAAAACGACGGCCAGT)/RPL 41-F (sequence: CAAGCCTCACTTTCTGCTGACTG), and verifying cloning. The recombinant vector of the fragment shown in SEQ ID No.23 is named as PYF515-sgRNA1, and the expression of the recombinant vector targets 1404 th to 1426 th nucleic acid sequences at the 5' end of the sequence 3 in the sequence table; the recombinant vector containing the fragment shown in SEQ ID No.24, which is verified to be correct, is named as PYF515-sgRNA2, and the vector expresses the 478 th to 500 th nucleic acid sequence of the 5' end of the sequence 3 in the targeting sequence table.

(6) Using soybean phytophthora P6497 genome DNA as a template, and respectively amplifying an upstream 1000bp fragment (sequence shown in SEQ ID No. 27) and a downstream 1000bp fragment (sequence shown in SEQ ID No. 28) of a target gene by using a primer pair (the sequences of the primer pair of the upstream 1000bp fragment and the primer pair of the downstream 1000bp fragment of the gene are shown in SEQ ID No.7 and SEQ ID No.8, and the sequences of the primer pair of the downstream 1000bp fragment and the primer pair of the gene are shown in SEQ ID No.11 and SEQ ID No. 12); the mCherry fragment (see SEQ ID No.29 for details) was amplified using a commercially available mCherry plasmid as template and a primer pair (see SEQ ID No.9 and SEQ ID No.10 for sequence). pBluescript II SK by ⁺ As a backbone vector, cleavage sites EcoRI and BamHI (enzyme purchased from NEB Co.) were selected for cleavage pBluescript II SK ⁺ The plasmid was constructed by an In-fusion kit (Takara Code No. 639650) as a homology arm replacement vector (structure as ZFANK5 Donor vector In FIG. 2). By means of

HD Cloning Kit fusion of three amplified fragments to Cloning vector pBluescript II SK ⁺ (EcoRI and BamHI cleavage), transferring the ligation product into E.coli DH 5. Alpha. Sense after 15min at 50deg.CIn the received cells, ice-bath is carried out for 30min, heat shock is carried out for 42 s, ice-bath is carried out for 2min, non-resistant LB is added for shaking culture for 60min, bacterial liquid is coated on an LB plate with Amp resistance, after overnight culture at 37 ℃, general primer M13F (sequence: TGTAAAACGACGGCCAGT)/M13R (sequence: CAGGAAACAGCTATGACC) is used for amplifying and sequencing to verify cloning, and a recombinant expression vector which is verified to be correct and contains a 1000bp sequence at the upstream of PsZFANK5, a mCherry gene sequence and a 1000bp sequence at the downstream of PsZFANK5 which are connected in sequence is named pBS-mCherry-PsZFANK5.

3.2 obtaining of knockout transformant of Phytophthora sojae PsZFANK5 Gene

CaCl is adopted ₂ PEG-mediated protoplast transformation method to obtain knockout transformants of the PsZFANK5 gene (described in Fang and Tyler,2016.Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR/Cas 9). Specifically, the sgRNA expression vector (PYF 515-sgRNA1 and PYF515-sgRNA 2) constructed in 3.1 and a homology arm replacement vector pBS-mCherry-PsZFANK5 are subjected to protoplast transformation at the same time, transferred into phytophthora sojae P6497, grown transformants are cultured and screened on a G418 resistant V8 plate at 25 ℃, hypha blocks are taken from colony edges and inoculated on a V8 plate paved with cellophane, hypha is scraped after dark culture for 6d at 25 ℃, and DNA of a transformant sample is extracted.

The verification of the knocked-out transformant is carried out by using three pairs of primers, namely, a primer pair PsZFANK5-QCYZ-F1/R1 (see SEQ ID No.15 and SEQ ID No.16 in a sequence table) and PsZFANK5-QCYZ-F3/R3 (see SEQ ID No.19 and SEQ ID No.20 in the sequence table) are used for the replacement verification of genes, and a primer pair PsZFANK5-QCYZ-F2/R2 (see SEQ ID No.17 and SEQ ID No.18 in the sequence table) is used for the verification of the interiors of genes. If the pseudo-transformant is banded when the PsZFANK5-QCYZ-F1/R1 and PsZFANK5-QCYZ-F3/R3 carry out PCR amplification, and the pseudo-transformant is not banded when the PsZFANK5-QCYZ-F2/R2 carries out PCR amplification, the pseudo-transformant can be identified as a positive homozygous transformant; if all three pairs of primers have bands, the suspected transformant can be identified as a positive heterozygous transformant. As shown in FIG. 3, 7 homozygous PsZFANK5 knockout transformants were obtained in total, respectively: ΔPsZFANK5-1, ΔPsZFANK5-3, ΔPsZFANK5-5, ΔPsZFANK5-7, ΔPsZFANK5-10, ΔPsZFANK5-11, and ΔPsZFANK5-13 (partial transformants are shown as ΔZA5-1 (ΔPsZFANK 5-1), ΔZA5-3 (ΔPsZFANK 5-3), ΔZA5-5 (ΔPsZFANK 5-5), and ΔZA5-7 (ΔPsZFANK 5-7) in FIG. 3).

EXAMPLE 4 obtaining of overexpression of Phytophthora sojae PsZFANK5 Gene

PCR amplification was performed using cDNA of Phytophthora sojae P6497 as a template, using primers (sequences shown in SEQ ID No.21 and SEQ ID No. 22), and the amplified cDNA fragment product of the PsZFANK5 gene was recovered and then subjected to cleavage using ApaI and SpeI (enzyme purchased from NEB company), while the PYF3 plasmid (published vector, fang Y, cui L, gu B, et al.2017.effect genome editing in the oomycete Phytophthora sojae using CRISPR/cas9.Current Protocols in Microbiology,44:21A.1.1-21 A.1.26.) was amplified for cleavage. The digested PsZFANK5 gene was ligated into digested PYF3 plasmid as follows (T4 ligase was purchased from Takara): 10. Mu.L of the system (reaction condition: 30min at 25 ℃) and 1. Mu.L of the digested PYF3 plasmid; 5 mu L of the PsZFANK5 gene fragment after enzyme digestion; 5×T DNA Ligase Buffer 2.mu.L; t4 DNA Ligase 0.5. Mu.L; ddH ₂ O1.5. Mu.L. Sequencing to obtain the PsZFANK5 full-length overexpression vector PYF3-PsZFANK5.

Taking a PsZFANK5 knockout transformant delta PsZFANK5-1 obtained by 3.2 as an experimental material, and carrying out CaCl by using PYF3-PsZFANK5 ₂ PEG-mediated protoplast transformation and verification using primer pairs (see SEQ ID No. 5-6) to obtain PsZFANK5 full-length over-expressed anaplerotic transformants. The full-length overexpression and complementation transformant of PsZFANK5 which is verified to be correct is named as delta PsZFANK5-OE. One transformant that was confirmed to be correct was designated OE-ZA5-2.

EXAMPLE 5 obtaining full-Length retrocomplement transformant of Phytophthora sojae PsZFANK5 Gene

5.1 full-length feedback vector construction of Phytophthora sojae PsZFANK5 Gene

The cDNA of the phytophthora sojae P6497 is used as a template, the primer is used for amplifying a fragment with the length of 3905bp, wherein the fragment is 1000bp upstream and 1000bp downstream, and the fragment is formed by amplifying the target gene by using a primer pair (SEQ ID No.7 and SEQ ID No. 12) by using the genomic DNA of the phytophthora sojae P6497 as the template. pBluescript II SK by ⁺ As backbone vector, restriction sites EcoRI and BamHI (enzyme purchased from NEB Co., ltd.) were selected) Enzyme digestion pBluescript II SK ⁺ The plasmid was used to construct a full-length restorer vector using an In-fusion kit (Takara Code No. 639650). By In-

HD Cloning Kit fusion of three amplified fragments to Cloning vector pBluescript II SK ⁺ (EcoRI and BamHI enzyme digestion), transferring the connection product into E.coli DH5 alpha competent cells after 15min at 50 ℃, ice-bathing for 30min, heat shock for 42 min, ice-bathing for 35s, adding non-resistant LB, shaking culture for 60min, coating bacterial liquid on an LB plate with Amp resistance, culturing overnight at 37 ℃, amplifying by using a universal primer M13F (sequence: TGTAAAACGACGGCCAGT)/M13R (sequence: CAGGAAACAGCTATGACC), sequencing, verifying cloning, and naming the correct recombinant expression vector which contains the 1000bp sequence upstream of PsZFANK5, the 1000bp sequence downstream of PsZFANK5 and is sequentially connected as pBS-C-PsZFANK5.

5.2 construction of full-Length anaplerotic sgRNA vector of Phytophthora sojae PsZFANK5 Gene

By using the methods of PsZFANK5sgRNA candidate selection, secondary structure screening and off-target analysis in example 3, ideal sgRNA is selected for synthesis (the DNA molecular sequences for expressing the sgRNA are shown as SEQ ID No.25 and SEQ ID No.26, the sgRNA sequences are GGUGUAGUCCUCGUUGUGGG and CAUGUCUCUCUCUCUGCAUUA respectively), and the 5 '623-642 nucleotide sequences of SEQ ID No.29 and the 5' 419-438 nucleotide sequences of sequence 3 in the sequence table are targeted respectively.

PYF515 (published vector, fang Y, cui L, gu B, et al 2017. Effect genome editing in the oomycete Phytophthora sojae using CRISPR/cas9.Current Protocols in Microbiology, 44:21A.1.1-21A.1.26.) is used as a backbone vector, an sgRNA vector is constructed according to the method of vector construction in example 3, and a recombinant vector which is verified to be correct and contains the fragment shown in SEQ ID No.25 is named PYF515-mCherry-sgRNA1, and expresses the nucleotide sequence 623-642 at the 5' -end of SEQ ID No.29 in the targeting sequence table; the recombinant vector containing the fragment shown in SEQ ID No.26, which was verified to be correct, was designated as PYF515-mCherry-sgRNA2, and the expression of the vector targets the 419-438 nucleotide sequence at the 5' end of SEQ ID No.29 in the sequence Listing.

5.3 obtaining full Length anaplerotic transformant of Phytophthora sojae PsZFANK5 Gene

The PsZFANK5 knockout transformant delta PsZFANK5-1 obtained by 3.2 is taken as an experimental material, caCl is adopted ₂ The PEG-mediated protoplast transformation method yielded a retrocomplement transformant of the PsZFANK5 gene (described in Fang and Tyler,2016.Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR/Cas 9). Specifically, the sgRNA expression vectors (PYF 515-mCherry-sgRNA1 and PYF515-mCherry-sgRNA 2) constructed in 5.2 are respectively transformed with homologous arm replacement vector pBS-C-PsZFANK5 by protoplast, transferred into a phytophthora sojae PsZFANK5 knockout transformant delta PsZFANK5-1, the grown transformant is cultured and screened on a G418 resistant V8 plate at 25 ℃, hypha blocks are taken from the edge of the colony and inoculated on a V8 plate paved with cellophane, hypha is scraped after dark culture is carried out for 6d at 25 ℃, and DNA of a transformant sample is extracted for transformant verification.

Three pairs of primers are used for verifying the knockout transformant, and the primer pairs PsZFANK5-QCYZ-F1/R1 (see sequence 15 and sequence 16 in the sequence table) and PsZFANK5-QCYZ-F3/R3 (see sequence 19 and sequence 20 in the sequence table) are used for verifying whether the mCherry sequence is replaced or not, and the PsZFANK5-QCYZ-F2/R2 (see sequence 17 and sequence 18 in the sequence table) are used for verifying the inside of the gene. If the pseudo-transformant is subjected to PCR amplification by the PsZFANK5-QCYZ-F1/R1 and PsZFANK5-QCYZ-F3/R3, and the pseudo-transformant is subjected to PCR amplification by the PsZFANK5-QCYZ-F2/R2, the pseudo-full-length anaplerotic transformant can be identified as a positive homozygous transformant; if all three pairs of primers have bands, the suspected full-length anaplerotic transformant can be identified as a positive heterozygous transformant. The full-length complementation transformant of PsZFANK5 which was confirmed to be correct was designated as ΔPsZFANK5-C, and two transformants which were confirmed to be correct were designated as C16 and C18.

EXAMPLE 6 analysis of the biological Properties of knockout transformant of Phytophthora sojae PsZFANK5 Gene

(1) Hypha growth rate assay

The knockout transformant delta PsZFANK5-1 of the soybean phytophthora strain PsZFANK5 gene to be tested is inoculated on a V8 plate, after being subjected to dark culture for 6 days at 25 ℃, a puncher with the diameter of 5mm is used for punching a bacterial cake along the edge of a bacterial colony, the bacterial cake is inoculated on the V8 plate, and the bacterial colony diameter is measured by adopting a crisscross method in a culture box for dark culture for 6 days at 25 ℃. The experiment was performed 3 times in biological replicates. Phytophthora sojae P6497 is used as a control.

As shown in FIG. 7, there was no significant difference in the growth rate of the knock-out mutant ΔPsZFANK5-1 hypha compared to the wild-type Phytophthora sojae strain P6497.

(2) Hydrogen peroxide sensitivity assay

The knock-out transformants ΔpszFANK5-1, ΔpszFANK5-3, ΔpszFANK5-7, ΔpszFANK5-10, ΔpszFANK5-11 and knock-out and make-up transformants C16, C18 of the test strain Phytophthora sojae were inoculated onto a V8 solid plate (10% V8 juice, 1% calcium carbonate and 1.5% agar powder) to which 3mM hydrogen peroxide was added, and after 6 days of dark culture at 25℃the colony diameters were measured, and the test was performed for 3 biological replicates. Phytophthora sojae P6497 is used as a control.

As a result, as shown in FIG. 8, the growth rate of the delta PsZFANK5 gene knockout transformants delta PsZFANK5-1, delta PsZFANK5-3, delta PsZFANK5-7, delta PsZFANK5-10, delta PsZFANK5-11 (delta ZA5-1, delta ZA5-3 and delta ZA5-7 in FIG. 8 are delta PsZFANK5-1, delta PsZFANK5-3 and delta PsZFANK 5-7) hyphae was significantly lower than that of the wild type P6497 strain, and the knockout full length anaplerotic transformants (C16, C18 in FIG. 8).

(3) Determination of drug sensitivity to mitochondrial inhibitors

The knock-out transformants of the soybean phytophthora PsZFANK5 gene, ΔPsZFANK5-1 (ZA 5-1 in FIG. 9), ΔPsZFANK5-3 (ZA 5-3 in FIG. 9), ΔPsZFANK5-7 (ZA 5-7 in FIG. 9), ΔPsZFANK5-10 (ZA 5-10 in FIG. 9), ΔPsZFANK5-11 (ZA 5-11 in FIG. 9) and ΔPsZFANK5-13 (ZA 5-11 in FIG. 9) were inoculated onto pyraclostrobin V8 solid plates (10% V8 juice, 1% calcium carbonate and 1.5% agar powder) containing 0.5mg/L, respectively, and colony diameters were measured after 6d of dark culture at 25℃using V8 solid plates without addition of the drugs as controls (100 mg/L salicylic acid was added for all treatments and controls), and the test was performed 3 biological replicates were performed. Phytophthora sojae P6497 is used as a control.

As a result, as shown in FIG. 9, ZA5 knockout transformants (ZA 5-1, ZA5-3, ZA5-7, ZA5-10, ZA5-11, ZA 5-13) had increased sensitivity to SDHI-type mitochondrial respiration inhibitors relative to wild-type P6497.

(3) In vitro leaf pathogenicity of transformants

Bacterial cake in vitro leaf pathogenicity: the knockout transformant ΔpszFANK5-3 of the phytophthora sojae PszFANK5 gene and the knockout full-length anaplerotic transformant C16 (obtained in example 5), the knockout overexpressing anaplerotic transformant OE-ZA5-2 (obtained in example 4) were placed in a dark culture at 25℃for 6 days, and a bacterial cake was removed along the colony edge with a punch having a diameter of 5mm for use. Two layers of water absorbing paper are paved in a fresh-keeping box, and 6 healthy, equal-sized and same-age soybean leaves (second pair of true leaves) are put in the fresh-keeping box after a proper amount of deionized water is poured in. Inoculating the obtained bacterial cake into soybean leaves, inoculating 1 leaf per leaf, and inoculating at least 6 leaves per group. The inoculated soybean leaves were placed under 25 ℃ (rh=60% -80%) condition and dark cultured for 2d. The lesion area was measured and recorded and photographed, and the test was performed 3 times in biological duplicate. Phytophthora sojae P6497 is used as a control.

In vitro soybean hypocotyl pathogenicity: the knockout transformant delta PsZFANK5-3 of the phytophthora sojae PsZFANK5 gene and the knockout and complement transformant C16, the knockout and over-expression complement transformant OE-ZA5-2 are placed in the dark at 25 ℃ for 6d, and a puncher with the diameter of 5mm is used for punching bacterial cakes along the edge of a bacterial colony for standby. Culturing soybean in vermiculite for 4d, spreading two layers of absorbent paper in a fresh-keeping box, pouring a proper amount of deionized water, then placing 6 healthy, equal-thick and same-age soybean hypocotyls, inoculating an obtained bacterial cake to the soybean hypocotyls, inoculating one soybean hypocotyl, and culturing in darkness for 2d under the condition of 25 ℃ (RH=60% -80%). The lesion area was measured and recorded and photographed, and the test was performed 3 times in biological duplicate. Phytophthora sojae P6497 is used as a control.

As shown in fig. 4 and 6, the pathogenicity of the knockout mutants (Δzfank5-3 in fig. 4, Δza5-1 in fig. 6, Δza 5-3) was significantly reduced compared to the wild-type phytophthora sojae strain P6497 by inoculating soybean in vitro leaves and soybean-hypocotyls to the bacterial cake.

Experiments prove that the pathogenic regulatory protein provided by the invention plays a role in the process of infecting host soybeans by phytophthora sojae and utilizes PEG-CaCl ₂ Mediation ofThe virulence of the knockout transformant obtained by the protoplast transformation technique of (a virulence reduction case of P6497 soybean and knockout mutant ΔPsZFANK5-3 (ΔZFANK5-3 in FIG. 4) is shown in FIG. 4), and full-length complementation and overexpression complementation transformants are restored to the virulence reduction phenotype (a restoration of virulence of the complementation transformants is shown in FIG. 6). At the same time, the sensitivity of the knockdown transformant to hydrogen peroxide was increased (as shown in FIG. 8), and the sensitivity to SDHI-based respiration inhibitors was increased (as shown in FIG. 9). Therefore, the pathogenic regulatory protein PsZFANK5 containing FYVE and ANK domains in phytophthora sojae can regulate and control the complete virulence of phytophthora sojae, and the infection process of phytophthora sojae can be controlled by inhibiting the function of the protein, so that the disease pandemic is controlled.

Claims (10)

1. A pathogenic regulatory protein comprising FYVE and ANK domains, which is a protein of the following A1) or A2) or A3) or A4):

a1 A protein consisting of the amino acid sequence shown in SEQ ID No. 4;

a2 Fusion proteins obtained by ligating tags at the N-terminal and/or C-terminal of the protein shown in SEQ ID No. 4;

a3 A protein which is derived from A1) by substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence shown in SEQ ID No.4 and is related to pathogenicity of phytophthora sojae;

a4 Amino acid sequence having the same function as the amino acid sequence shown in SEQ ID No.4 with an amino acid sequence similarity of 93% or more, preferably 95% or more, more preferably 98% or more with SEQ ID No. 4.

2. A coding gene encoding the PsZFANK5 protein of claim 1; preferably, the coding gene is B1) or B2) or B3) as follows:

b1 A DNA molecule represented by the nucleotide sequence shown in SEQ ID No. 3;

b2 A cDNA molecule or a DNA molecule having 75% or more, or 85% or more, or 95% or more identity with the nucleotide sequence shown in B1) and encoding the protein of claim 1;

b3 A cDNA molecule or a DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in B1) or B2) and which codes for a protein according to claim 1.

3. An RNA molecule transcribed from the coding gene of claim 2;

preferably, the sequence of the RNA molecule is C1) or C2) as follows:

c1 A DNA sequence shown in SEQ ID No. 3) having a similarity of 75% or more, more preferably 85% or more, still more preferably 95% or more, with an RNA sequence having the same function as the RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 3;

c2 RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 3.

4. Biological material related to the pathogenic regulatory protein of claim 1, the coding gene of claim 2 or the RNA molecule of claim 3 is any one of the following D1) to D10):

d1 An expression cassette comprising the coding gene of claim 2;

d2 A recombinant vector comprising the coding gene of claim 2 or a recombinant vector comprising the expression cassette of D1);

d3 A recombinant microorganism comprising the coding gene of claim 2, or a recombinant microorganism comprising the expression cassette of D1), or a recombinant microorganism comprising the recombinant vector of D2);

d4 A transgenic plant cell line comprising the coding gene of claim 2, or a transgenic plant cell line comprising the expression cassette of D1);

d5 A transgenic plant tissue comprising the coding gene of claim 2, or a transgenic plant tissue comprising the expression cassette of D2);

d6 A transgenic plant organ comprising the coding gene of claim 2, or a transgenic plant organ comprising the expression cassette of D2);

d7 A nucleic acid molecule which inhibits the expression of the coding gene of claim 2; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the encoding gene of claim 2, or that silences the encoding gene of claim 2;

d8 An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing or expressing D7) said nucleic acid molecule;

d9 A nucleic acid molecule that inhibits translation of the RNA molecule of claim 3;

d10 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing or expressing D9) said nucleic acid molecule.

5. Use of a pathogenic regulatory protein according to claim 1, a coding gene according to claim 2 or an RNA molecule according to claim 3 or a biomaterial according to claim 4 for controlling oomycete pathogenicity or for regulating oomycete sensitivity to reactive oxygen species;

preferably, the oomycete is phytophthora sojae (Phytophthora sojae), most preferably phytophthora sojae (Phytophthora sojae) P6497.

6. Use of a pathogenic regulatory protein according to claim 1, a coding gene according to claim 2 or an RNA molecule according to claim 3 or a biological material according to claim 4 as a pesticide formulation for screening for inhibition of oomycete pathogenicity and/or for increasing the sensitivity of oomycetes to active oxygen.

7. A method for inhibiting and/or killing oomycetes growth comprises inhibiting the expression or inactivation of genes encoding pathogenic regulatory proteins containing FYVE and ANK domains in oomycetes, or inhibiting the translation of RNA thereof, or inhibiting the activity or inactivation of pathogenic regulatory proteins containing FYVE and ANK domains, thereby improving the inhibition of active oxygen on oomycetes, and reducing the survival rate of oomycetes in the presence of active oxygen; the amino acid sequence of the pathogenic regulatory protein containing FYVE and ANK domains is the amino acid sequence shown in SEQ ID No. 4; the oomycete is phytophthora sojae (Phytophthora sojae);

the method for inhibiting the expression of or inactivating the coding gene of the pathogenic regulatory protein containing FYVE and ANK domains in oomycetes is preferably to knock out the coding gene, and preferably the coding gene of the pathogenic regulatory protein containing FYVE and ANK domains is DNA shown as SEQ ID No. 3.

8. A method for inhibiting and/or killing oomycetes produced by soybeans, which is a method of treating the soybean milk according to claim 7 with active oxygen; the oomycete is preferably phytophthora sojae (Phytophthora sojae) P6497.

9. A method of inhibiting or blocking the full pathogenicity of an oomycete comprising inhibiting or blocking the full pathogenicity of the oomycete by inhibiting or inactivating the expression of the gene of claim 2, or inhibiting the translation of the RNA sequence of claim 3, or inhibiting or inactivating the activity of the pathogenic regulatory protein of claim 1; the oomycete is phytophthora sojae (Phytophthora sojae);

the method of inhibiting or inactivating the expression of the gene of claim 2 is preferably a knockout of the gene of claim 2.

10. A method for reducing the capability of an oomycete infected host, which is to inhibit or block complete pathogenicity by the method of claim 9, so as to achieve the aim of reducing the capability of the oomycete infected host; the host is soybean.

Images