CN116004626A - Application of ZmMIR398b-pro - Google Patents

Abstract

The embodiment of the invention discloses an application of ZmMIR398b-pro, wherein a T-DNA insertion transgenic technology is used for constructing ZmmiR398 over-expression vectors and transgenic plants with two tandem repeat hairpin structures, a PCR method is used for cloning and constructing a mature nucleotide sequence of ZmmiR398 to a pOT2-Polycis-UN vector, zmmiR398 is further constructed to a target vector pZZ00026-PM, and the ZmmiR398 over-expression vectors are obtained and transferred into immature embryos of a maize inbred line C01 to obtain a plurality of transgenic events; and identifying independent events with increased expression level of ZmmiR398 gene in the leaf by Northern blot. An expression vector and a transgenic plant containing the ZmMIR398b promoter fusion GUS gene are constructed by using a T-DNA insertion transgenic technology. The ZmMIR398b promoter was constructed into the target vector pCAMBIA3301-GUS after PCR amplification of the ZmMIR398b promoter nucleotide sequence using primers and double digestion of the PCR product using BamH I and NcoI; transferring the pCAMBIA3301-ZmMIR398b promoter-GUS over-expression vector into immature embryo of maize inbred line C01; the response of zmm 398b promoter under maize heat stress was identified by means of GUS histochemical staining.

Description

Application of ZmMIR398b-pro

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an application of ZmMIR398 b-pro.

Background

Corn (Zea mays) is an important grain and economic crop in the world and is also a first large grain crop in China, and under the background of limited cultivated area, the capability of resisting adversity stress of the corn is improved, and the high and stable yield of the corn is ensured, so that the corn is one of important ways for ensuring the grain safety. In recent years, due to global warming, greenhouse effect phenomenon is increasingly evident, and high temperature becomes a major environmental factor restricting crop yield. The rapid rise of the ambient temperature in a short time can form high temperature stress, seriously affect the plant height, root length, biomass production, grain quality and the like of field crops, is particularly important to research the molecular regulation mechanism of corn under the high temperature stress, and discovers a new factor for regulating the high temperature stress response to provide a new theoretical basis for improving the excellent properties of corn and molecular breeding.

High temperature stress exists widely under natural conditions, plants form a set of protection mechanism for high temperature stress during long-term evolution, and various reported regulatory factors can respond to the heat stress to improve the expression level. Promoters are classified into constitutive promoters, tissue-or organ-specific promoters and inducible promoters. Inducible promoters refer to the switching on and off of rapid induction of gene transcription in a plant's specific stage of development, tissue organ or growth environment, as desired. The promoter of the thermal response regulatory factor belongs to an inducible promoter, can efficiently and specifically start the expression of exogenous genes under high temperature conditions, and is an important carrier element.

microRNA (miRNA) plays a key regulation role in the growth and development of crops and is a new improvement target of the crops. miR398 belongs to a family of miRNAs that are conserved across species, with the target genes Copper/zinc superoxide dismutase1 (CSD 1), CSD2, copper chaperone for superoxide dismutase (CCS) and Cytochrome c oxidase subunit 5b-1 (COX 5 b-1) conserved across species. The overexpression of miR398 in arabidopsis leads to unbalanced oxidation-reduction state in cells by inhibiting the expression of target genes, and finally improves the resistance of transgenic arabidopsis to high-temperature stress.

Disclosure of Invention

The embodiment of the invention provides an application of ZmMIR398b-pro in starting target gene expression during thermal induction, and a method for thermally inducing corn comprises the following steps:

constructing an expression vector and a transgenic plant containing a ZmMIR398b promoter fusion GUS gene by using a T-DNA insertion transgenic technology, carrying out PCR amplification on a ZmMIR398b promoter nucleotide sequence, and constructing a ZmMIR398b promoter into a target vector pCAMBIA3301-GUS by using BamHI and NcoI double-enzyme digestion PCR products, wherein the ZmMIR398b promoter is used for GUS gene expression under a thermal induction condition, and the 3' -end of the ZmMIR398b promoter is connected with an upstream sequence of the GUS gene;

transferring the pCAMBIA3301-ZmMIR398b promoter-GUS over-expression vector into immature embryo of maize inbred line C01 by agrobacterium EHA105 strain to obtain a plurality of transgenic events;

the response of zmm 398b promoter under maize heat stress was identified by means of GUS histochemical staining.

Further, primers used in PCR amplification of ZmMIR398b promoter nucleotide sequence were: MIR398b-p-F6 and MIR398b-p-R4.

Further, MIR398b-p-F was gagctcggtacccggggatccATGATGTCAT GCAGTGAGGTGTCA.

Further, MIR398b-p-R4 is ttaccctcagatctaccatggGCCGGAAC TGCCTTTGCG.

Further, the method for regulating and controlling the heat resistance of the corn comprises the following steps:

constructing a ZmmiR398 gene over-expression vector and a transgenic plant containing two tandem repeat hairpin structures by utilizing a T-DNA insertion transgenic technology, cloning and constructing a ZmmiR398 mature nucleotide sequence to a pOT-Polycis-UN vector by using a PCR method, and further constructing a ZmmiR398 into a target vector pZZ00026-PM to obtain the ZmmiR398 over-expression vector;

transferring the ZmmiR398 overexpression vector into immature embryo of maize inbred line C01 through agrobacterium EHA105 strain to obtain a plurality of transgenic events;

and identifying independent events with the increased expression level of the ZmmiR398 gene in the leaves by a Northern blot method for a plurality of transgenic events to obtain the events for regulating and controlling the heat resistance of the corn.

Further, the ZmmiR398 overexpression vector of the hairpin structure comprises: an artificial miRNA construct driven by maize ubiquitin gene UBI and a BAR gene construct driven by the use of the enhanced CaMV 35S promoter.

Further, the ZmmiR398 overexpression vector of two hairpin structures of tandem repeat is constructed by using T-DNA insertion transgenic technology, and the ZmmiR398 overexpression vector comprises:

in the pOT2-Polycis-UN vector, two tandem repeats of ZmmiR398 with hairpin structure were cloned into the downstream backbone of the maize ubiquitin gene UBI promoter.

Further, the method further comprises the following steps:

sequencing and verifying the ZmmiR398 over-expression vector with the hairpin structure, and double-digesting the obtained pOT2-Polycis-UN-miR398 vector by PacI and MluI restriction enzymes;

cloning the recovered UBI-miR398-NOS fragment after digestion into a binary vector of pZZ 00026-PM;

binary vectors verified by sanger sequencing were introduced into agrobacterium strain EHA105.

Further, the primers used in constructing ZmmiR398 overexpression vector were:

OE398-F:

gccATTTAAATgcagggattggCGGGGGCGATCTGAGAACACTatcggatcctcgaggtgtaaa aaaactcg；

OE398-R:

ccATTTAAATagccgaattggCGGGGGCGACCTGAGAACACAatccgagcccgatggtgagac tTTT。

further, the primer adopted in the sequencing of the pOT2-Polycis-UN-miR398 vector is as follows: PF-2 CGACTCTAGAGGACAAGCTT;

PR-2:GCCAAATGTTTGAACGATCGAATTC。

further, the primers adopted in the sequencing of the target vector miR398-OE-p26 are as follows:

PF-3:GGCATATGCAGCAGCTATATGTGG；

PF-4：ATTTAAATGCAGGGATTGG。

in the present example, mature maize ZmmiR398 is derived from two precursors ZmmiR398a and ZmmiR398b, each having a mature sequence of 5'-UGUGUUCUCAGGUCGCCCCCG-3'. Wherein the expression level of ZmMIR398b is far higher than that of ZmMIR398a, and the expression of ZmMIR398b is remarkably responded under high temperature stress, and ZmMIR398a is not basically influenced by the high temperature stress, so that the regulation and control effect of ZmMIR398b on the high temperature stress of corn is particularly important. The ZmMIR398b promoter is a maize high temperature inducible promoter that can be used to efficiently express a desired gene in maize under high temperature processing conditions. These findings provide a theoretical basis for improving genetic manipulation means to increase plant stress resistance.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the description of the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1A is a schematic representation of the expression levels of pri-miR398a and pri-miR398b induced at high temperature for different times;

FIG. 1B is a schematic representation of a thermal response histochemical staining analysis of the transgenic plant pCAMBIA3301-MIR398B promoter-GUS;

FIG. 2A is a schematic representation of the expression level of ZmmiR398 in northern detected different transgenic plants;

FIG. 2B is a graphical representation of heat stress phenotypes of different transgenic lines overexpressing ZmmiR 398.

Detailed Description

In order to enable those skilled in the art to better understand the present invention, the following description will make clear and complete descriptions of the technical solutions according to the embodiments of the present invention with reference to the accompanying drawings.

The embodiment of the invention provides an application of ZmMIR398b-pro in starting target gene expression during thermal induction, and a method for thermally inducing corn comprises the following steps:

step one, the ZmMIR398b promoter was constructed into the vector of interest pCAMBIA3301-GUS after amplification of the ZmMIR398 bpromiter nucleotide sequence using the primers MIR398b-p-F6 and MIR398b-p-R4 and double cleavage of the PCR product using BamH I and NcoI.

Transferring the pCAMBIA3301-ZmMIR398 bpromiter-GUS over-expression vector into immature embryo of maize inbred line C01 by agrobacterium EHA105 strain to obtain a plurality of transgenic events;

and step three, identifying the effect of ZmMIR398b promoter in the corn heat induction process by a GUS histochemical staining method.

The embodiment of the invention also provides a method for regulating and controlling the heat resistance of corn, which comprises the following steps:

constructing a ZmmiR398 gene over-expression vector and a transgenic plant which comprise two tandem repeat hairpin structures, cloning a ZmmiR398 mature nucleotide sequence by a PCR method, constructing the ZmmiR398 mature nucleotide sequence to a pOT2-Polycis-UN vector, and constructing the ZmmiR398 into a target vector pZZ00026-PM to obtain the ZmmiR398 over-expression vector;

transferring the ZmmiR398 overexpression vector into immature embryo of maize inbred line C01 through agrobacterium EHA105 strain to obtain a plurality of transgenic events;

and step three, identifying independent events with increased expression quantity of ZmmiR398 genes in the leaves by a Northern blot method for a plurality of transgenic events, and obtaining the events for regulating and controlling the heat resistance of the corn.

Specifically, the ZmmiR398 overexpression vector of the hairpin structure comprises: an artificial miRNA construct driven by maize ubiquitin gene UBI and a BAR gene construct driven by the use of the enhanced CaMV 35S promoter. Wherein, the T-DNA insertion transgenic technology is utilized to construct ZmmiR398 overexpression vectors with two hairpin structures of tandem repeat, comprising: in the pOT2-Polycis-UN vector, two tandem repeats of ZmmiR398 with hairpin structure were cloned into the downstream backbone of the maize ubiquitin gene UBI promoter.

The embodiment of the invention also comprises the following steps: sequencing and verifying the ZmmiR398 over-expression vector with the hairpin structure, and double-digesting the obtained pOT2-Polycis-UN-miR398 vector by PacI and MluI restriction enzymes; cloning the recovered UBI-miR398-NOS fragment after digestion into a binary vector of pZZ 00026-PM; binary vectors verified by sanger sequencing were introduced into agrobacterium strain EHA105.

The embodiment of the invention provides a construction method of a corn over-expression ZmmiR398 vector, which comprises the following steps: overexpression of ZmmiR398 was achieved by integrated T-DNA insertion using an artificial miRNA structure driven by maize ubiquitin gene Ubiquitin (UBI) and a BAR (streptomyces hygroscopicus phosphorylase acetyltransferase) gene driven by the CaMV 35S promoter was enhanced. Wherein, as shown in FIG. 1A, the expression levels of the pri-miR398a and the pri-miR398B are shown in schematic form when the expression levels are induced at high temperature for different time, and FIG. 1B, the thermal response histochemical staining analysis schematic form of the transgenic plant pCAMBIA3301-MIR398 bpromiter-GUS is shown in the schematic form; FIGS. 2A and 2B are schematic representations of the expression level of ZmmiR398 in different transgenic plants by northern blot analysis and schematic representations of the heat stress phenotype of different transgenic lines overexpressing ZmmiR398, respectively, in a pOT-Polycis-UN vector, two tandem repeats of ZmmiR398 hairpin structures were cloned into the downstream backbone of the UBI promoter. After sequencing verification, the obtained pOT2-Polycis-UN-miR398 vector is subjected to double digestion by PacI and MluI restriction enzymes. The recovered UBI-miR398-NOS fragment was then cloned into a binary vector of pZZ 00026-PM. The sanger sequencing verified binary vector was introduced into agrobacterium strain EHA105 and transformed into the immature embryo genome of maize inbred line C01. Successful transgenic events were identified by PCR and ZmmiR398 expression levels were further quantified by Northern blot. Among them, the primers used for vector construction and positive clone sequencing (pOT-Polycis-UN-miR 398) and final vector positive clone identification (OE-amiR-F/R) were as follows:

the sequence of OE398-F is:

gccATTTAAATgcagggattggCGGGGGCGATCTGAGAACACTatcggatcctcgagg tgtaaaaaaactcg。

the sequence of OE398-R is:

gccATTTAAATagccgaattggCGGGGGCGACCTGAGAACACAatccgagcccgatg gtgagactTTT。

PF-2 was found to have a sequence of CGACTCTAGAGGATCCAAGCTT.

PR-2 has the sequence of GCCAAATGTTTGAACGATCGAATTC.

PF-3 was found to have a sequence of GGCATATGCAGCAGCTATATGTGG.

The sequence of PF-4 is: ATTTAAATGCAGGGATTGG.

In the embodiment of the invention, the intermediate vector pOT-polycis-UN of the ZmmiR398 overexpression vector has the following full-length sequence:

the ZmmiR398 overexpression vector is miR398-OE-p26, and the full-length sequence is as follows:

pZZ 00026-UN-dModuZmammiR 398 (miR 398-OE-p26 full-length sequence)

The invention also identifies a high temperature stress inducible promoter which can be applied to high temperature start specific target gene expression. The sequence of the primer named MIR398b promoter is as follows:

the primer sequences for cloning ZmMIR398b promoter were:

MIR398b-p-F1ATGATGTCATGCAGTGAGGTGTCA

MIR398b-p-F2GGTACTATGGCCACGAGCATAGT

the successfully constructed genetic transformation vector (pCAMBIA 3301-MIR398b promoter-GUS) containing ZmMIR398b promoter has the following sequence:

vector construction of ZmMIR398b promoter and Agrobacterium transformation according to the examples of the invention:

the zmm 398b promoter nucleotide sequence was PCR amplified using one of the following pairs of primers: MIR398b-p-F6 is gagctcggtacccggggatccATGATGTCATGCAGTGAG GTGTCA; MIR398b-p-R4 is ttaccctcagatctaccatggGCCGGAACT GCCTTTGCG.

PCR procedure: 94 ℃ for 5min;94 ℃,30sec;55 ℃,30sec;72 ℃ for 2min;32 cycles; 72℃for 5min. PCR products were detected by 1% agarose electrophoresis.

After the PCR product was digested with BamHI and NcoI, the target vector pCAMBIA3301-GUS was constructed. The constructed promoter vector is transferred into agrobacterium through sequencing verification. PCR identification procedure was as above.

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. While still being apparent from variations or modifications that may be made by those skilled in the art are within the scope of the invention.

The foregoing is only a partial embodiment of the present invention, and it should be noted that it will be apparent to those skilled in the art that modifications and adaptations can be made without departing from the principles of the present invention, and such modifications and adaptations are intended to be comprehended within the scope of the present invention.

Claims (10)

1. The use of ZmMIR398b-pro for initiating expression of a gene of interest, said gene of interest having a DNA sequence linked to the 3' end of the ZmMIR398b-pro nucleotide sequence, upon thermal induction; wherein, the method for thermally inducing corn comprises the following steps:

constructing an expression vector and a transgenic plant containing a ZmMIR398b promoter fusion GUS gene by using a T-DNA insertion transgenic technology, carrying out PCR amplification on a ZmMIR398b promoter nucleotide sequence, and constructing a ZmMIR398b promoter into a target vector pCAMBIA3301-GUS by using BamHI and NcoI double-enzyme digestion PCR products, wherein the ZmMIR398b promoter is used for GUS gene expression under a thermal induction condition, and the 3' -end of the ZmMIR398b promoter is connected with an upstream sequence of the GUS gene;

transferring the pCAMBIA3301-ZmMIR398b promoter-GUS over-expression vector into immature embryo of maize inbred line C01 by agrobacterium EHA105 strain to obtain a plurality of transgenic events;

the role of zmm 398b promoter in the thermal induction of maize was identified by means of GUS histochemical staining.

2. The use of claim 1, further comprising a method of modulating heat resistance of corn:

constructing a ZmmiR398 gene over-expression vector and a transgenic plant containing two tandem repeat hairpin structures by utilizing a T-DNA insertion transgenic technology, cloning and constructing a ZmmiR398 mature nucleotide sequence to a pOT-Polycis-UN vector by using a PCR method, and further constructing a ZmmiR398 into a target vector pZZ00026-PM to obtain the ZmmiR398 over-expression vector;

transferring the ZmmiR398 overexpression vector into immature embryo of maize inbred line C01 through agrobacterium EHA105 strain to obtain a plurality of transgenic events;

and identifying independent events with the increased expression level of the ZmmiR398 gene in the leaves by a Northern blot method for a plurality of transgenic events to obtain the events for regulating and controlling the heat resistance of the corn.

3. The use according to claim 1, wherein the primers used in the PCR amplification of the ZmMIR398 bpromiter nucleotide sequence are: MIR398b-p-F6 and MIR398b-p-R4.

4. Use according to claim 3, characterized in that MIR398b-p-F6 is gagctcggtacccggggatccATGATGTCATGCAGTGA GG TGTCA.

5. Use according to claim 3, characterized in that MIR398b-p-R4 is ttaccctcagatctaccatggGCCGGAACTGCCTTTGCG.

6. The use according to claim 2, wherein the ZmmiR398 overexpression vector of the hairpin structure comprises: an artificial miRNA construct driven by maize ubiquitin gene UBI and a BAR gene construct driven by the use of the enhanced CaMV 35S promoter.

7. The use according to claim 2, wherein the ZmmiR398 overexpression vector of two tandem repeat hairpin structures is constructed using T-DNA insertion transgene technology, comprising:

in the pOT2-Polycis-UN vector, two tandem repeats of ZmmiR398 with hairpin structure were cloned into the downstream backbone of the maize ubiquitin gene UBI promoter.

8. The use according to claim 2, further comprising:

sequencing and verifying the ZmmiR398 over-expression vector with a hairpin structure, and double-digesting the obtained pOT2-Polycis-UN-miR398 vector and a target vector pZZ00026-PM by PacI and MluI restriction enzymes;

cloning the recovered UBI-miR398-NOS fragment after digestion into a binary vector of pZZ 00026-PM;

binary vectors verified by sanger sequencing were introduced into agrobacterium strain EHA105.

9. The use according to claim 2, wherein the primers used in constructing the pOT2-Polycis-UN-miR398 vector are:

OE398-F:

gccATTTAAATgcagggattggCGGGGGCGATCTGAGAACACTatcggatcctcgaggtgtaaa aaaactcg；

OE398-R:

ccATTTAAATagccgaattggCGGGGGCGACCTGAGAACACAatccgagcccgatggtgagac tTTT。

10. the use according to claim 2, wherein,

the primer adopted in the sequencing of the pOT-Polycis-UN-miR 398 vector is as follows:

PF-2:CGACTCTAGAGGATCCAAGCTT；

PR-2:GCCAAATGTTTGAACGATCGAATTC；

the primers used in the sequencing of the target vector miR398-OE-p26 are as follows:

PF-3:GGCATATGCAGCAGCTATATGTGG；

PF-4：ATTTAAATGCAGGGATTGG。

Images