CN116003566A

CN116003566A - CREPT mutant and application thereof in inhibiting tumor growth

Info

Publication number: CN116003566A
Application number: CN202210971835.6A
Authority: CN
Inventors: 常智杰; 任芳丽; 王银银; 褚君
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2022-08-12
Filing date: 2022-08-12
Publication date: 2023-04-25
Also published as: WO2024032486A1

Abstract

The invention relates to a CREPT mutant and application thereof in inhibiting tumor growth. In particular, the invention relates to a protein obtained by replacing 134 th residue of SEQ ID NO. 4 with a non-phosphorylable residue, nucleic acid encoding the protein, a vector and a cell containing the nucleic acid, and application of the protein, the nucleic acid or the vector in preparing reagents for inhibiting proliferation and/or migration of eukaryotic cells and anticancer drugs. The invention also relates to a method of treating cancer and a method of identifying whether a substance is an inhibitor of phosphorylation at the S134 site of CREPT protein.

Description

CREPT mutant and application thereof in inhibiting tumor growth

Technical Field

The invention relates to the field of molecular biology, in particular to an S134A mutant of CREPT protein and application thereof in inhibiting tumor growth.

Background

The switching at different stages of the cell cycle is the result of the regulation of a variety of proteins, the most important of which is CDK (cyclin-dependent kinase), a class of serine/threonine protein kinases that are in different states of activity at different stages of cell division. When these kinases are in an activated state, downstream substrates can be phosphorylated to regulate the cell cycle, and different levels of Cyclin are required at different times of cell division. The formation of the Cyclin D1/2/3 and CDK4/6 complexes is necessary for the cells to enter the G1 phase. The formation of Cyclin E and CDK2 complexes determines whether a cell can enter S phase through G1 phase. Binding of Cyclin A to CDK2 is necessary for the cell to be in S phase. Binding of Cyclin A to CDK1 at the end of the G2 phase and at the beginning of the M phase is essential for promoting cell complete G2-M phase conversion. Binding of Cyclin B1 to CDK1 is also necessary after cells enter the M phase. In the late M phase, degradation of Cyclin B1 is again necessary for the cell to leave the M phase and enter the next G1 phase.

Cell cycle is closely related to tumorigenesis, and researchers have found a new tumor-associated gene CREPT (cell-cycle related and expression-elevated protein in tumor, patent number ZL 200510135513.4) in studies looking for tumor-associated genes. The gene can be combined with RNA polymerase II, a key enzyme in transcription, on Cyclin D1 genes, and the Cyclin D1 genes form a circular structure, and the formation of the circular structure probably promotes the transcription of the genes. CREPT is a cell cycle positive regulatory protein which is present and very conserved in a variety of eukaryotic organisms (e.g.human, yeast, mouse, chicken, toad, zebra fish, drosophila, nematode or Arabidopsis thaliana); moreover, researchers have demonstrated that CREPT proteins exhibit high expression in a variety of tumor cells and tumor tissues (Li et al, 2021; lu et al, 2012).

However, it is not clear how CREPT is involved in the regulation of the cell cycle.

Disclosure of Invention

The inventors found that the phosphorylation state of residue 134 of human CREPT protein plays a very important role in cell growth and cell cycle regulation, and further found that the S134A mutant of CREPT protein is not phosphorylated, can inhibit proliferation and migration of eukaryotic cells, inhibit growth and metastasis of tumors and can kill cancer cells, thereby completing the present invention.

In a first aspect of the present invention, there is provided a protein obtained by replacing residue 134 of the amino acid sequence (SEQ ID NO: 4) of wild-type human CREPT with a non-phosphorylable residue. In one embodiment, the non-phosphorylatable residue is alanine or glutamine. In one embodiment, the amino acid sequence of the protein is SEQ ID NO. 2 (hereinafter simply referred to as "CREPT S134A"). In one embodiment, the protein is obtained by converting serine at position 134 of human CREPT to alanine.

The invention also provides a protein which has more than 75% sequence identity with any of the above proteins and the residue at the position corresponding to position 134 of SEQ ID NO. 4 is said non-phosphorylable residue.

The invention also provides a protein with a tag sequence or a guide sequence connected to the N-terminal and/or the C-terminal of the protein according to any of the above embodiments.

The invention also provides nucleic acids encoding any of the proteins described above. In one embodiment, the nucleic acid has the sequence of SEQ ID NO. 1.

The invention also provides vectors comprising the nucleic acids and cells comprising the vectors.

In a second aspect of the invention there is provided the use of a protein, nucleic acid or vector as described above for the preparation of a reagent for inhibiting proliferation and/or migration of eukaryotic cells. In one embodiment, the eukaryotic cell is a cell of a human, yeast, mouse, chicken, toad, zebra fish, drosophila, nematode or arabidopsis thaliana, preferably a human cell, more preferably a human cancer cell.

In a third aspect of the invention there is provided the use of a protein, nucleic acid or vector as described above in the preparation of an anticancer agent. In one embodiment, the anti-cancer agent comprises an agent that inhibits proliferation of cancer cells, an agent that inhibits metastasis of cancer cells, or an agent that kills cancer cells. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, stomach cancer, or colorectal cancer (e.g., colon cancer). In one embodiment, the anti-cancer agent further comprises a small molecule anti-cancer agent and/or an antibody anti-cancer agent.

In a fourth aspect of the invention, there is provided a method of treating cancer, the method comprising administering to a subject an effective amount of a protein, nucleic acid or vector as described above; alternatively, the method comprises editing a CRPET gene in the genome of a cancer cell of a subject using CRISPR/Cas 9-based gene editing techniques to cause the cancer cell to express any of the above proteins. In one embodiment, the subject is a mammal, preferably a human. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, stomach cancer, or colorectal cancer. In one embodiment, the method further comprises administering a small molecule anti-cancer agent and/or an antibody anti-cancer agent to the subject. In one embodiment, the method further comprises administering radiation and/or chemotherapy to the subject. In one embodiment, the method further comprises: the expression of wild-type CREPT in cancer cells of a subject is reduced or eliminated prior to, during, or after administration of an effective amount of the protein, nucleic acid, or vector to the subject.

In a fifth aspect of the invention, there is provided a method of identifying whether a substance is an inhibitor of phosphorylation of the S134 site of CREPT protein, wherein the inhibitor maintains the S134 site of CREPT protein in a sustained non-phosphorylated state in eukaryotic cells; the amino acid sequence of the CREPT protein is SEQ ID No. 4, and the method comprises the following steps: s1) treating eukaryotic cells expressing CREPT proteins with a substance to be identified; s2) immunoprecipitation with an anti-phospho antibody to examine the level of phosphorylation at the S134 site of CREPT protein in the treated cells in step S1; if the level of phosphorylation of the S134 site of the CREPT protein in the cells treated with the agent is reduced by more than 10%, more than 20%, more than 30% or more than 40% as compared to the level of phosphorylation of the S134 site of the CREPT protein in control cells not treated with the agent, the agent is identified as a phosphorylation inhibitor of the S134 site of the CREPT protein, otherwise the agent is identified as not being a phosphorylation inhibitor of the S134 site of the CREPT protein. In one embodiment, prior to step S1, the method comprises: the substances to be identified were designed for CREPT using the prediction tools SwissTargetPrediction and SEA. In one embodiment, step S1 is performed by incubating the substance to be identified and the eukaryotic cell under conditions that allow for phosphorylation. In one embodiment, step S2 comprises immunoprecipitation with an anti-CREPT antibody recognizing CREPT protein and an anti-phosphorylated antibody recognizing the phosphorylation of CREPT protein 134 site, thereby quantifying the level of phosphorylation of CREPT protein S134 site. In one embodiment, the level of phosphorylation is the relative value of the amount of protein that S134 phosphorylates to the total amount of CREPT protein.

Drawings

Specific embodiments of the invention will now be described in connection with the accompanying drawings, but neither the drawings nor the following detailed description should be read as limiting the scope of the invention, in which:

FIG. 1 shows the effect of CREPT S134A on tumor cell growth. FIGS. 1A and C are cell migration experiments and FIGS. 1B and D are colony formation experiments. Wherein MOCK is a normal cell blank; CREPT (WT) is a cell line stably expressing wild-type CREPT; CREPT (S134A) is a cell line stably expressing CREPT S134A protein.

FIG. 2 is the effect of CREPT S134A on melanoma lung metastasis. Wherein MOCK is a normal cell blank; CREPT (WT) is a cell line stably expressing wild-type CREPT; CREPT (S134A) is a cell line stably expressing CREPT S134A protein.

FIG. 3 shows the effect on lung metastasis in mice after re-transfer to wild type CREPT in B16 cell lines from which the CREPT gene was knocked out. Wherein CREPT (KO) is a pcDNA3.1-HA empty vector control transferred in B16 cells from which CREPT gene is knocked out; KO-CREPT (WT) is a cell line transformed with pcDNA3.1-HA-CREPT plasmid in B16 cells from which CREPT gene is knocked out to stably express wild-type CREPT; KO-CREPT (S134E) is a cell line in which pcDNA3.1-HA-CREPT (S134E) plasmid was transferred in B16 cells from which CREPT gene was knocked out to stably express CREPT S134E mutant protein.

FIG. 4 shows the effect on tumor cell growth after re-transformation of wild type CREPT in a CREPT gene knockout DLD1 cell line. Wherein CREPT (KO) is a pcDNA3.1-HA empty vector control transferred in DLD1 cells from which CREPT gene is knocked out; KO-CREPT (WT) is a cell line transformed with pcDNA3.1-HA-CREPT plasmid in DLD1 cells from which CREPT gene is knocked out to stably express wild type CREPT; KO-CREPT (S134E) is a cell line in which pcDNA3.1-HA-CREPT (S134E) plasmid was transferred in DLD1 cells from which CREPT gene was knocked out to stably express CREPT S134E mutant protein.

FIG. 5 is a screening result of CREPT phosphorylation inhibitors. The upper #1 to #5 represent cells treated with candidate compounds #1 to #5, with the middle numbers (0 to 1.1) being the relative phosphorylation levels of each sample relative to background.

Fig. 6 shows the effect of CREPT phosphorylation inhibitor candidate compounds #1 to #5 on proliferation of DLD1 cells (a) and MGC803 cells (B).

Detailed Description

Definition of the definition

The term "human CREPT protein" or "human CREPT" as used herein refers to a human wild-type CREPT protein having the amino acid sequence shown in SEQ ID NO. 4, unless otherwise specified.

The term "CREPT protein mutant" or "CREPT mutant" as used herein refers to a protein variant obtained by subjecting a wild-type CREPT protein to amino acid mutation.

The term "non-phosphorylable residue" as used herein is a protein residue which remains in a non-phosphorylated state in eukaryotic cells, the non-phosphorylable residue being unable to be phosphorylated by a kinase system in eukaryotic cells.

Hereinafter, embodiments of the present invention will be described in detail.

It is known in the art that the phosphorylation of specific sites (typically serine, threonine, tyrosine) on proteins is a key element of cell signaling, while the essence of the phosphorylation signaling is the state of charge of the corresponding residues. Thus, by mimicking the phosphorylation state (i.e., negatively charged) of the corresponding site, the effect of phosphorylation is often achieved. The simulation of the phosphorylation/non-phosphorylation state is typically accomplished using amino acid mutations or chemical modifications. For example, sustained activating mutations (i.e., mutations that mimic the phosphorylation state) include mutations of residues to aspartic acid (D) or glutamic acid (E), as these two amino acids are the only two negatively charged amino acids; whereas sustained inhibitory mutations (i.e., mutations that mimic the non-phosphorylated state) are most commonly mutations in serine to alanine (a), because alanine is positively charged and is able to continuously inhibit the activity of the residue site; in other cases, the inhibitory mutation may also be a mutation into glutamine (Q) or phenylalanine (F). On the other hand, the activating chemical modifier (i.e., chemical modifier that mimics the phosphorylation state) may include phosphate donors such as acetyl phosphate, phosphoric acid amide salts, carbamoyl phosphate, and sodium pyrophosphate, and beryllium trifluoride. In addition, some small molecule inhibitors of CDK4/6 specificity, such as Palbociclib, ribociclib or Abemaciclib, can also achieve the effect of keeping the protein non-phosphorylated (Maiani et al 2021;Simoneschi et al, 2021).

The inventors have found that a plurality of amino acid sites on CREPT proteins are all serine after sequence analysis of CREPT, and considered that the regulation of tumor by CREPT proteins may be related to phosphorylation of these serine. The inventors predicted the phosphorylation site of CREPT protein using the phosphorylation site on-line analysis tool (http:// kinasephos. Mbc. Nctu. Edu. Tw/prediction. Php), found that the S134 site of CREPT protein is a potential phosphorylation site, and its corresponding protein kinase is the CDK family.

The inventors mutated serine at position 134 of the CREPT protein to alanine to obtain the S134A mutation to mimic the non-phosphorylated state of this site. As a result, it was found that the S134A mutation of CREPT protein was able to inhibit proliferation and migration of mouse embryonic fibroblasts as compared to the control (fig. 1); can effectively inhibit metastasis of mouse tumor cells (figure 2), and can kill mouse tumor cells (figure 3).

In view of this, the present invention provides a protein obtained by replacing residue 134 of the amino acid sequence (SEQ ID NO: 4) of human CREPT with a non-phosphorylable residue. In one embodiment, the non-phosphorylatable residue is alanine or glutamine. In one embodiment, the amino acid sequence of the protein is SEQ ID NO. 2. In a preferred embodiment, the protein is obtained by converting serine at position 134 of human CREPT to alanine; this means that the protein retains the post-translational modification of human CREPT except for amino acid 134.

The present invention also provides a protein having 75% or more, 80% or more, 90% or more, preferably 95% or more, more preferably 98% or more, or 99% or more sequence identity to any of the above proteins, and the residue at the position corresponding to position 134 of SEQ ID NO. 4 is the non-phosphorylable residue.

The invention also provides a protein with a tag sequence or a guide sequence connected to the N-terminal and/or the C-terminal of the protein. In one embodiment, the protein is a fusion protein. In one embodiment, the tag sequence may be, for example, a purification tag, a fluorescent tag, a solubilization tag, an affinity tag, or an epitope tag, or the like. In one embodiment, the targeting sequence may be a polypeptide sequence that directs the protein into the cell across the cell membrane, including, for example, cell-penetrating peptides that are not endocytosis-based, and peptide sequences or protein sequences that are themselves readily accessible to cells by endocytosis.

The invention also provides nucleic acids encoding the proteins. In one embodiment, the sequence of the nucleic acid is SEQ ID NO. 1, but the present invention is not limited thereto. The person skilled in the art knows that the sequence of the nucleic acid can be optimized for different expression environments according to the rules of codon degeneracy.

The invention also provides a vector comprising the nucleic acid. In one embodiment, the vector may be a plasmid or viral vector.

The invention also provides cells comprising the vector. In one embodiment, the cell is capable of stably expressing the protein described above.

Methods of introducing a protein of interest (e.g., CREPT S134A of the invention) into a target cell (e.g., a cancer cell) can include introducing a vector expressing the protein of interest into the target cell by transfection, infection, or other means, or can employ chemically modified mRNA (modRNA) to effect expression of the protein of interest in the target cell. In addition, the target protein may be introduced directly into the cell using, for example, the above-described guide sequences. But the present invention is not limited thereto. For example, mutations (Anzalone, et al 2019) at target sites in the tumor genome can be directly made using precise gene editing techniques (e.g., prime editors), such as mutating the corresponding bases of genomic CREPT to cause the cell to express CREPT S134A.

The invention also provides application of the protein, the nucleic acid or the vector in preparing a reagent for inhibiting proliferation and/or migration of eukaryotic cells. In one embodiment, the eukaryotic cell is a cell of a human, yeast, mouse, chicken, toad, zebra fish, drosophila, nematode or arabidopsis thaliana, preferably a human cell, more preferably a human cancer cell.

The invention also provides application of the protein, the nucleic acid or the vector in preparing anticancer drugs. In one embodiment, the anti-cancer agent comprises an agent that inhibits proliferation of cancer cells, an agent that inhibits metastasis of cancer cells, and/or an agent that kills cancer cells. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, stomach cancer, or colorectal cancer. In one embodiment, the anti-cancer agent further comprises other small molecule anti-cancer agents and/or antibody anti-cancer agents. These small molecule anticancer agents and/or antibody anticancer agents may be known in the art.

The invention also provides a method of treating cancer comprising administering to a subject an effective amount of a protein, nucleic acid or vector as described above; alternatively, the method comprises editing a CRPET gene in the genome of a cancer cell of a subject using CRISPR/Cas 9-based gene editing techniques to cause the cancer cell to express any of the above proteins. In one embodiment, the subject is a mammal, preferably a human. In one embodiment, the method further comprises administering a small molecule anti-cancer agent and/or an antibody anti-cancer agent to the subject. These small molecule anticancer agents and/or antibody anticancer agents may be known in the art. In one embodiment, the method further comprises administering radiation and/or chemotherapy to the subject. In one embodiment, the method further comprises: the expression of wild-type CREPT in the target cancer cells is reduced or eliminated, e.g., knocked out or knocked down by siRNA or gene editing techniques, prior to, during or after administration of an effective amount of the above-described proteins, nucleic acids or vectors to a subject.

Furthermore, the present invention relates to a method for identifying whether a substance is an inhibitor of phosphorylation of the S134 site of CREPT protein, wherein the inhibitor maintains the S134 site of CREPT protein in a sustained non-phosphorylated state in eukaryotic cells; the amino acid sequence of the CREPT protein is SEQ ID No. 4, and the method comprises the following steps: s1) treating eukaryotic cells expressing CREPT proteins with a substance to be identified; s2) immunoprecipitation with an anti-phospho antibody to examine the level of phosphorylation at the S134 site of CREPT protein in the treated cells in step S1; wherein if the level of phosphorylation of the S134 site of the CREPT protein in the cells treated with the agent is decreased by more than 10%, more than 20%, more than 30% or more than 40%, more preferably by more than 50%, more than 60%, more than 70%, more than 80%, more than 90% or more than 95% compared to the level of phosphorylation of the S134 site of the CREPT protein in control cells not treated with the agent, the agent is identified as an inhibitor of phosphorylation of the S134 site of the CREPT protein, otherwise the agent is identified as not an inhibitor of phosphorylation of the S134 site of the CREPT protein.

In one embodiment, prior to step S1, the method comprises designing the substance to be identified for CREPT using prediction tools swistargetprediction and SEA. The material can then be synthesized artificially.

In one embodiment, step S1 is performed by incubating the substance to be identified and the eukaryotic cell under conditions that allow for phosphorylation. The "conditions that allow phosphorylation" include, but are not limited to, the presence of a kinase system sufficient to phosphorylate the CREPT S134 in the presence of suitable environmental temperature, pH, ionic strength, and the like, such that the CREPT S134 can be phosphorylated in the absence of a phosphorylation inhibitor or kinase inhibitor (e.g., normal eukaryotic intracellular environment).

In one embodiment, step S2 comprises immunoprecipitation with an anti-CREPT antibody recognizing CREPT protein and an anti-phosphorylated antibody recognizing the phosphorylation of CREPT protein 134 site, thereby quantifying the level of phosphorylation of CREPT protein S134 site. Specifically, CREPT protein may be precipitated with an anti-CREPT antibody, and the total amount of CREPT protein may be determined as a background amount, and for a protein immunoprecipitated with an anti-CREPT antibody, phosphorylated protein may be detected and quantified using an anti-phospho antibody specifically recognizing the phosphorylation of CREPT134 site, where the level of phosphorylation may be the ratio of the amount of phosphorylated protein to the background amount of CREPT protein.

In one embodiment, the eukaryotic cell expressing the CREPT protein is a cell containing a kinase system that phosphorylates S134 of wild type CREPT, e.g., a cell of a human, yeast, mouse, chicken, toad, zebra fish, drosophila, nematode or Arabidopsis thaliana that is capable of naturally expressing the CREPT protein, or a cell of a kinase system that is genetically engineered to express or overexpress the same function.

The invention also relates to the following compounds:

and the application of the compound in preparing a phosphorylation inhibitor of CREPT134 site and in preparing a medicine for treating cancer. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, stomach cancer, or colorectal cancer. In one embodiment, the hydroxyl (-OH) group of compound #3 described above may be replaced with another leaving group, such as halogen, -OCOR, -OTs, -ONO ₂ Etc., wherein R may be C _1-6 Alkyl or C _1-4 An alkyl group.

Sequence description:

SEQ ID NO. 1 nucleic acid sequence encoding CREPT S134A mutein;

the amino acid sequence of the 2CREPT S134A mutant protein;

SEQ ID NO. 3 encoding nucleic acid sequence of wild type CREPT;

SEQ ID NO. 4 amino acid sequence of wild type CREPT.

Examples

In the following examples, the experimental methods used, unless otherwise specified, were all conventional; the materials, reagents and the like used, unless otherwise specified, may be obtained commercially or may be prepared by conventional methods; the quantitative tests were carried out by setting three repeated tests, and the results were averaged.

EXAMPLE 1 CREPT S134A mutant protein and obtaining of coding gene thereof

1. Selection of mutation sites

Based on tool predictions and interactions of the cyclin CREPT with cyclin kinase CDK6, the inventors selected conserved sequence sites that correspond to CDK6 phosphorylating downstream substrates as mutation sites. The mutation site selected by the invention is the 134 th amino acid of the cell cycle forward regulation protein CREPT.

2. Design of site-directed mutagenesis primer

And designing a site-directed mutagenesis primer according to the mutation site, wherein the designed site-directed mutagenesis primer has the following sequence:

forward primer GCCCCTCCCCCCAAAGCAACA;

reverse primer CTTGGAGTCCTCCATAGACAG.

3. PCR amplification

And (3) taking pcDNA3.1-HA-CREPT (WT) plasmid as a template, and adopting the primer designed in the step (2) to carry out PCR amplification to obtain a PCR amplification product.

4. Sequencing

Sequencing the PCR product obtained in the step 3. Sequencing results showed that: the nucleotide sequence shown in SEQ ID NO. 1 is obtained by PCR amplification, and the gene shown in SEQ ID NO. 1 is named CREPT S134A gene. The amino acid sequence of the protein coded by the CREPT S134A gene is shown as SEQ ID NO. 2. The protein shown in SEQ ID NO. 2 is designated CREPT S134A protein.

The CREPT S134A protein is obtained by mutating serine (Ser) at position 134 of a cell cycle forward regulation protein CREPT into alanine (Ala) and keeping other sequences of the protein CREPT unchanged; the CREPT S134A gene is obtained by mutating the codon AGC of the 134 th serine of the CREPT of the cell cycle forward regulation protein into the GCC of the alanine, and keeping other sequences of the CREPT coding gene unchanged. The amino acid sequence of the wild CREPT is shown as SEQ ID NO. 4, and the coding sequence is shown as SEQ ID NO. 3.

EXAMPLE 2CREPT Preparation of S134A mutant

1. Construction of recombinant plasmids

Replacing the small fragment between the kpnI and EcoRV cleavage sites of the pcDNA3.1-HA plasmid (purchased from Clontech) with the CREPT S134A gene shown in SEQ ID NO. 1 to give pcDNA3.1-HA-CREPT (S134A) expression plasmid S134A;

the small fragment between the kpnI and EcoRV cleavage sites of the pcDNA3.1-HA plasmid was replaced with the CREPT gene shown in SEQ ID NO. 3 to give pcDNA3.1-HA-CREPT expression plasmid WT.

2. Packaging of recombinant plasmids

Packaging pcDNA3.1-HA-CREPT (S134A) expression plasmid S134A and pcDNA3.1-HA-CREPT expression plasmid WT plasmids respectively to obtain supernatants containing lentiviral particles pcDNA3.1-HA-CREPT (S134A) and pcDNA3.1-HA-CREPT respectively. The specific procedure is as follows (taking one well of a six-well plate as an example):

1) The day before transfection, appropriate amount of HEK293T cells (ATCC, CRL-3216) was inoculated to a cell density of 60-80% at the time of transfection.

2) Mu.g of plasmid (packaging virus 3 plasmid system, pMD2G: PSAPX2: destination plasmid = 1:1.5:2.5 100. Mu.L of 0.9% NaCl, and mixing by blowing.

3) mu.L of Vigofect transfection reagent was taken, added to 100. Mu.L of 0.9% NaCl, gently mixed, and left at room temperature for 5min.

4) Adding the plasmid diluted in the step 2) into the transfection reagent diluted in the step 3), gently blowing and mixing, and standing for 15min at room temperature.

5) The transfection working solution is added into the cell culture medium drop by drop, the culture medium is gently mixed, and the mixture is placed into a cell culture box.

6) After 4-6 hours, 2mL of fresh medium was changed.

7) After 24 hours, the culture medium is changed into fresh culture medium, and the virus-containing supernatant is collected for 72 hours.

3. Infection of cells of interest

The supernatants containing lentiviral particles pcDNA3.1-HA-CREPT (S134A) and pcDNA3.1-HA-CREPT (WT) were added to mouse melanoma cells B16 (ATCC, CRL-6475) to give the following mutants, respectively: a B16 cell line stably expressing the CREPT S134A protein and a B16 cell line stably expressing the wild-type CREPT protein. The method comprises the following specific steps:

(1) B16 cells were plated into six well cell culture plates at 37 ℃, 5% co ₂ Culturing was performed under the conditions, and the medium was RPMI1640 (Gibco, 11875093).

(2) Lentiviral transfection was performed when the culture was continued until the next day at a density of 30-50%. Four wells were selected from the five wells as experimental groups, and the remaining one well was used as control group.

Experimental group: 1mL of the medium was aspirated, and 1mL of virus supernatant and 2. Mu.L of polybrene (Sigma Aldrich, 107689) were added to each well to give a final polybrene concentration of 5 ng/. Mu.L in the system. Drawing an 8-shaped character on an operation table, and gently mixing.

Control group: 1mL of medium was aspirated off, and 1mL of complete medium was added to each well.

(3) After 24 hours of transfection, the cells were transferred to a 100mm dish, after 24 hours, the corresponding antibiotics (neomycin 1 mg/ml) were added for selection and culture for 7-10 days, the cells were cloned into 24 well plates with a gun head, and positive cloned cells were detected after continued culture.

Following the procedure described above, supernatants containing lentiviral particles pcDNA3.1-HA-CREPT (S134A) and pcDNA3.1-HA-CREPT (WT) were added to the mouse embryonic fibroblast line NIH3T3 (ATCC, CRL-1658) and the mouse melanoma cell line B16 (ATCC, CRL-6322), respectively, to give the following mutants: NIH3T3 and B16 cell lines stably expressing CREPT S134A and NIH3T3 and B16 cell lines stably expressing wild-type CREPT.

EXAMPLE 3 CREPT Effect of S134A mutant on cell migration ability

1) A straight ruler and a Mark pen are used for uniformly scribing transverse lines behind the 6-hole plate, and the transverse lines cross the through holes at intervals of about 0.5 cm to 1 cm. Each hole passes through at least 5 lines. About 5X 10 is added ⁵ The NIH3T3 or B16 cells are a NIH3T3 or B16 cell line stably expressing CREPT S134A, a NIH3T3 or B16 cell line stably expressing wild type CREPT, and a NIH3T3 or B16 cell line stably expressing pcDNA3.1-HA, respectively.

2) After overnight incubation, the gun head was scratched as perpendicular to the back transverse line as possible with a ruler, and the gun head was not inclined vertically. The cells were washed 3 times with PBS, the scraped floating cells were removed, and then serum-free medium was added.

3) Placing in 37 ℃ and 5% CO ₂ Culturing in an incubator. Samples were taken after incubation for 0 and 24 hours, respectively, and photographs were taken.

The results are shown in fig. 1 a and C. The results show that: the 134 th site of CREPT protein is mutated into alanine to inhibit migration of cells.

EXAMPLE 4 CREPT Effect of S134A mutant on cell proliferation potency

1) Taking cells in logarithmic growth phase (NIH 3T3 or B16 cell line), digesting with 0.25% trypsin, gently blowing to obtain single cells, counting living cells, and adjusting cell density to 1×10 with DMEM culture medium containing 20% foetal calf serum ⁶ cells/L. And then plated according to experimental requirements.

2) After adding 4mL of the culture solution and 4mL of the cell dilution in a ratio of 1:1, 2mL of the mixture was added to each well of the six-well plate, and 3 duplicate wells were added in total. Placing at 37deg.C and 5% CO ₂ Culturing in an incubator for 7-14 days.

3) When the clone size is proper, discarding the cell clone supernatant, adding 0.1% crystal violet solution for dyeing for 30min, and washing the excess dye solution with running water.

4) The plate was placed on a scanner and the number of cell clones was observed.

The results are shown in FIGS. 1B and D. The results show that: mutation of CREPT protein 134 to alanine inhibited the formation of cell clones.

The above results indicate that CREPT S134A protein has the function of inhibiting cell migration and proliferation, and the 134 th serine site of CREPT is critical for CREPT to maintain its function of promoting clone formation.

EXAMPLE 5 CREPT Effect of S134A mutant on tumor cell metastatic Capacity

The effect of CREPT S134A mutant on cancer cell metastasis ability was examined by C57BL/6J mouse lung metastasis assay. The method comprises the following specific steps: c57BL/6J mice (mice were purchased from Vetolihua Co., ltd., B6J JAX Lab) were inoculated with a tail vein injection method using a respective B16 cell line (MOCK) stably expressing pcDNA3.1-HA, a B16 cell line (CREPT-WT) stably expressing wild-type CREPT, and a B16 cell line (CREPT-S134A) stably expressing CREPT S134A protein, at an inoculum size of 1X 10 ⁵ Cells/200 μl/mouse, mice were sacrificed 21 days after inoculation, and the lungs of the mice were removed and observed for lung tumor development.

The results are shown in FIG. 2. As can be seen from the figures: MOCK group cells were able to cause tumors in the lungs of mice that increased significantly when mice were vaccinated with B16 cell line CREPT-WT stably expressing wild type CREPT protein, and decreased significantly when mice were vaccinated with B16 cell line CREPT-S134A stably expressing CREPT S134A protein. It is shown that the 134 th serine site of CREPT is important for promoting tumor metastasis, and CREPT S134A mutant can effectively inhibit tumor metastasis.

EXAMPLE 6 CREPT Effect of S134A muteins on tumor cells knocked out CREPT

The effect of the CREPT S134A mutein on the metastatic ability of tumor cells knocked out of CREPT was examined using a C57BL/6J mouse melanoma lung metastasis assay. The method comprises the following specific steps: first, a cell line stably expressing pcDNA3.1-HA (CREPT-KO), a cell line stably expressing wild-type CREPT (KO-CREPT-WT), a cell line stably expressing CREPT S134E protein (KO-CREPT-S134E), and a cell line stably expressing CREPT-S134A protein (KO-CREPT-S134A) were established, respectively, on the basis of the CREPT-knocked-out B16 cell line. Based on the tumor-inhibiting effect of CREPT S134A muteins, it was attempted to supplement CREPT S134A back on CREPT-knocked-out tumor cell line B16 (KO CREPT), and as a result, it was found that the cells died, resulting in failure to establish a cell line stably expressing CREPT S134A protein (KO-CREPT-S134A).

The established cell lines CREPT-KO, KO-CREPT-WT and KO-CREPT-S134E were inoculated into C57BL/6J mice (mice were purchased from Vetong Lehua Co., B6J JAX Lab) by tail vein injection at an inoculation dose of 1X 10 ⁵ Cells/200 μl/mouse, mice were sacrificed 21 days after inoculation, and the lungs of the mice were removed and observed for lung tumor development.

As shown in FIG. 3, the CREPT-KO group cells were unable to tumor the lungs of the mice, and the lung tumors were significantly increased when the mice were vaccinated with the KO-CREPT-WT cell line and the KO-CREPT-S134E cell line. It is shown that the 134 th serine site of CREPT is important for CREPT to promote tumor metastasis. In addition, it was found that the CREPT S134E mutein mimics the phosphorylation state of wild-type CREPT at position 134 and thus does not inhibit or kill tumor cells; whereas the CREPT-S134A mutein mimics the non-phosphorylated state of wild-type CREPT at position 134, thereby being able to inhibit or kill tumor cells.

EXAMPLE 7 CREPT Effect of S134A muteins on tumor cells knocked out CREPT

The effect of CREPT S134A mutein on the growth of tumor cells knocked out of CREPT was examined using a colony formation assay. The method comprises the following specific steps: first, a cell line stably expressing pcDNA3.1-HA (CREPT-KO), a cell line stably expressing wild-type CREPT (KO-CREPT-WT), a cell line stably expressing CREPT S134E protein (KO-CREPT-S134E), and a cell line stably expressing CREPT-S134A protein (KO-CREPT-S134A) were established, respectively, on the basis of a CREPT-knocked-out DLD1 cell line. Based on the tumor-inhibiting effect of CREPT S134A muteins, it was attempted to supplement CREPT S134A back on CREPT-knocked-out tumor cell line DLD1 (KO CREPT), and as a result, it was found that cells died, resulting in failure to establish a cell line stably expressing CREPT S134A protein (KO-CREPT-S134A).

Cloning experiments were then performed using the successfully established cell lines CREPT-KO, KO-CREPT-WT and KO-CREPT-S134E as described above, following the procedure of example 4.

As a result, as shown in FIG. 4, the KO-CREPT-WT cell line and the KO-CREPT-S134E cell line produced significantly higher numbers of clones than the CREPT-KO group cells. The 134 th serine site of CREPT is important for promoting the growth of tumor cells.

The technical idea and the specific embodiments of the present invention are described above, but it should be understood that the above specific embodiments do not limit the scope of the present invention in any way. It will be appreciated by persons skilled in the art that numerous modifications and/or variations may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. Accordingly, the embodiments of the present invention are merely illustrative and not restrictive.

EXAMPLE 8 screening of phosphorylation inhibitors of CREPT

8.1 prediction of Small molecule Compounds as potential CREPT phosphorylation inhibitors

The small molecule phosphorylation inhibitors of CREPT were predicted together using the prediction tool SwissTargetPresection (http:// www.swisstargetprediction.ch /) and SEA (Similarity ensemble approach; https:// SEA. Bkslab. Org /), resulting in the synthesis of 5 candidate small molecule compounds #1 to #5.

8.2 Effect of candidate Small molecule Compounds on CREPT phosphorylation

1) HEK293T cells were first passaged into dishes, transfected with plasmids of HA-CREPT (S134A) and HA-CREPT (WT) the next day when the cells reached 60% -80% density, 1 part of HA-CREPT (S134A) was transfected as a negative control, and 7 parts of HA-CREPT (WT) was transfected to verify the effect of different candidate small molecules and controls on the phosphorylation of CREPT134 site.

2) After 4 hours of transfection, the transfected cells were subjected to pipetting, and except for 1 part of the pipetting of HA-CREPT (S134A) and HA-CREPT (WT) were used as a normal medium, 6 parts of the cells transfected with HA-CREPT (WT) were each pipetting into a normal medium containing DMSO or small molecules #1, #2, #3, #4, #5, and the working concentrations of all small molecules were uniformly set at 5. Mu.M.

3) The medicine treatment time reaches 24 hours, cells are respectively lysed, proteins are harvested, an immunoprecipitation experiment is carried out by utilizing an HA tag protein antibody, immunoprecipitated tag proteins are detected by utilizing an antibody specifically recognizing the phosphorylation of the CREPT134 site, the background quantity of the CREPT proteins is detected by utilizing the tag antibody, and then gray level analysis is carried out to obtain the quantity of phosphorylated proteins relative to the background quantity, so that the phosphorylation level is quantified.

As a result, as shown in FIG. 5, it was found that HA-CREPT (S134A) was not able to detect a phosphorylation signal as a negative control, whereas HA-CREPT (WT) was able to detect a significant phosphorylation signal in DMSO control. The gray scale analysis results confirm that candidate small molecule compounds #1 and #2 and #5 do not affect the phosphorylation of the 134 site of HA-CREPT (WT), while #3 and #4 significantly reduce the phosphorylation level of the 134 site of HA-CREPT (WT). The structural formulas of compounds #3 and #4 are as follows:

/>

8.3 Effect of candidate Small molecule Compounds on cell proliferation

1) Taking DLD1 (human colorectal adenocarcinoma epithelial cells) or MGC803 (human gastric carcinoma cells) in logarithmic phase, digesting with 0.25% trypsin, gently blowing to obtain single cells, counting living cells, and adjusting cell density to 1×10 with DMEM culture medium containing 10% fetal bovine serum ⁴ cells/L.

2) After 10mL of the culture solution and 10mL of the cell dilution were mixed in a ratio of 1:1, 0.2mL of the mixture was added to each well of the 96-well plate, and 3 duplicate wells were added in total. Placing at 37deg.C and 5% CO ₂ Incubate in incubator for 12 hours.

3) The above 5 candidate small molecule compounds #1 to #5 were taken and dissolved in DMSO, each compound having a primary screening concentration of 10 μm (DLD 1 cells) or 5 μm (MGC 803 cells). 3 replicates of each compound were made; each compound was incubated at a concentration of 10. Mu.M (DLD 1 cells) or 5. Mu.M (MGC 803 cells) for 3 days, and then cell proliferation was measured using CCK. Before measurement, each well was replaced by 10. Mu.l of CCK-8 solution and 90. Mu.l of complete medium (wells with corresponding amounts of CCK-8 solution and cell culture broth added as blank). Incubate at 37℃for 3 hours. The absorbance at a wavelength of 450nm was measured. The results were calculated and counted and plotted as shown in FIG. 6A (DLD 1 cells) and B (MGC 803 cells).

It can be seen that compound #4, which is a CREPT phosphorylation inhibitor, significantly inhibited cell proliferation, indicating that inhibition of CREPT S134 site phosphorylation in cells by compound #4 at the tested concentration resulted in inhibition of cell proliferation, consistent with the results of example 4. That is, compound #4 may exhibit an effect similar to the CREPT S134A mutation.

Reference to the literature

Anzalone,A.V.,Randolph,P.B.,Davis,J.R.et al.(2019)Search-and-replace genome editing without double-strand breaks or donor DNA.Nature 576,149–157.

Li,M.D.,Ma,D.H.,and Chang,Z.J.(2021).Current understanding of CREPT and p15RS,carboxyterminal domain(CTD)-interacting proteins,in human cancers.Oncogene 40,705-716.

Lu,D.,Wu,Y.,Wang,Y.,Ren,F.,Wang,D.,Su,F.,Zhang,Y.,Yang,X.,Jin,G.,Hao,X.,et al.(2012).CREPT accelerates tumorigenesis by regulating the transcription of cell-cycle-related genes.Cancer Cell 21,92-104.

Maiani,E.,Milletti,G.,Nazio,F.,Holdgaard,S.G.,Bartkova,J.,Rizza,S.,Cianfanelli,V.,Lorente,M.,Simoneschi,D.,Di Marco,M.,et al.(2021).AMBRA1 regulates cyclin D to guard S-phase entry and genomic integrity.Nature 592,799-+.

Simoneschi,D.,Rona,G.,Zhou,N.,Jeong,Y.T.,Jiang,S.W.,Milletti,G.,Arbini,A.A.,O'Sullivan,A.,Wang,A.A.,Nithikasem,S.,et al.(2021).CRL4(AMBRA1)is a master regulator of D-type cyclins.Nature 592,789-+.

Claims

1. A protein obtained by replacing residue 134 of SEQ ID NO. 4 with a non-phosphorylable residue.

2. The protein of claim 1, wherein the non-phosphorylatable residue is alanine or glutamine.

3. The protein of claim 1, wherein the amino acid sequence is shown in SEQ ID NO. 2.

4. A protein according to claim 3, obtained by converting serine at position 134 of the human CREPT protein to alanine.

5. A protein having 75% or more sequence identity to the protein of any one of claims 1 to 4, and the residue at the position corresponding to position 134 of SEQ ID No. 4 is the non-phosphorylable residue.

6. A protein having a tag sequence or a guide sequence attached to the N-terminus and/or C-terminus of the protein of any one of claims 1 to 5.

7. A nucleic acid encoding the protein of any one of claims 1 to 6.

8. The nucleic acid according to claim 7, wherein the sequence is SEQ ID NO. 1.

9. An expression vector comprising the nucleic acid of claim 7 or 8.

10. A cell comprising the vector of claim 9.

11. Use of a protein according to any one of claims 1 to 6, a nucleic acid according to claim 7 or 8 or a vector according to claim 9 for the preparation of an agent for inhibiting proliferation and/or migration of eukaryotic cells.

12. Use according to claim 11, wherein the eukaryotic cell is a cell of a human, yeast, mouse, chicken, toad, zebra fish, drosophila, nematode or arabidopsis thaliana, preferably a human cell, more preferably a human cancer cell.

13. Use of a protein according to any one of claims 1 to 6, a nucleic acid according to claim 7 or 8 or a vector according to claim 9 for the preparation of an anticancer agent.

14. The use of claim 13, wherein the anticancer agent comprises an agent that inhibits proliferation of cancer cells, an agent that inhibits metastasis of cancer cells, or an agent that kills cancer cells.

15. The use of claim 13, wherein the cancer is melanoma, liver cancer, kidney cancer, stomach cancer or colorectal cancer.

16. The use of claim 13, wherein the anticancer agent further comprises a small molecule anticancer agent and/or an antibody anticancer agent.

17. A method of treating cancer, the method comprising:

i) Administering to a subject an effective amount of the protein of any one of claims 1 to 6, the nucleic acid of claim 7 or 8, or the vector of claim 9, or

ii) editing the CRPET gene in the genome of a subject cancer cell using CRISPR/Cas 9-based gene editing techniques to cause the cancer cell to express the protein of any one of claims 1 to 5.

18. The method of claim 17, wherein the subject is a mammal, preferably a human.

19. The method of claim 17, further comprising administering a small molecule anticancer agent and/or an antibody anticancer agent to the subject.

20. The method of claim 17, further comprising subjecting the subject to radiation and/or chemotherapy.

21. The method of claim 17, wherein the i) further comprises: the expression of wild-type CREPT in cancer cells of a subject is reduced or eliminated prior to, during, or after administration of an effective amount of the protein, nucleic acid, or vector to the subject.

22. The method of claim 17, wherein the cancer is melanoma, liver cancer, kidney cancer, stomach cancer, or colorectal cancer.

23. A method of identifying whether a substance is an inhibitor of phosphorylation of the S134 site of a CREPT protein, wherein the inhibitor maintains the S134 site of the CREPT protein in a sustained non-phosphorylated state in eukaryotic cells; the amino acid sequence of the CREPT protein is SEQ ID No. 4, and the method comprises the following steps:

s1, treating eukaryotic cells expressing CREPT proteins with substances to be identified,

s2, performing immunoprecipitation with an anti-phosphorylation antibody to check the phosphorylation level of the S134 site of the CREPT protein in the treated cells in the step S1;

if the level of phosphorylation of the S134 site of the CREPT protein in the cells treated with the agent is reduced by more than 10%, more than 20%, more than 30% or more than 40% as compared to the level of phosphorylation of the S134 site of the CREPT protein in control cells not treated with the agent, the agent is identified as a phosphorylation inhibitor of the S134 site of the CREPT protein, otherwise the agent is identified as not being a phosphorylation inhibitor of the S134 site of the CREPT protein.

24. The method of claim 23, wherein prior to step S1, the method further comprises: the substances to be identified were designed for CREPT using the prediction tools SwissTargetPrediction and SEA.

25. The method of claim 23, wherein step S1 is performed by incubating the substance to be identified and the eukaryotic cell under conditions that allow phosphorylation.

26. The method of claim 23, wherein step S2 comprises immunoprecipitation with an anti-CREPT antibody recognizing CREPT protein and an anti-phosphorylated antibody recognizing CREPT protein 134 site, thereby quantifying the level of phosphorylation of CREPT protein S134 site.