WO2024032486A1

WO2024032486A1 - Crept mutant and use thereof in inhibition of tumor growth

Info

Publication number: WO2024032486A1
Application number: PCT/CN2023/111173
Authority: WO
Inventors: 常智杰; 任芳丽; 王银银; 褚君
Original assignee: 清华大学
Priority date: 2022-08-12
Filing date: 2023-08-04
Publication date: 2024-02-15
Also published as: CN116003566A

Abstract

The present invention relates to a CREPT mutant and use thereof in the inhibition of tumor growth. In particular, the present invention relates to a protein obtained by replacing a residue at position 134 of SEQ ID NO: 4 with a residue that cannot be phosphorylated, a nucleic acid encoding the protein, a vector and a cell comprising the nucleic acid, and use of the protein, the nucleic acid, or the vector in the preparation of a reagent for inhibiting the proliferation and/or migration of eukaryotic cells and an anti-cancer medicament. The present invention further relates to a method for treating cancers and a method for identifying whether a substance is a phosphorylation inhibitor for an S134 site of the CREPT protein or not.

Description

CREPT mutants and their application in inhibiting tumor growth

Technical field

The present invention relates to the field of molecular biology, and more specifically, to the S134A mutant of CREPT protein and its application in inhibiting tumor growth.

Background technique

The transitions between different stages of the cell cycle are the result of regulation by multiple proteins. The most important regulatory protein is CDK (cyclin-dependent kinase), which is a type of serine/threonine that is in different active states at different stages of cell division. Protein kinase. When these kinases are in an activated state, they can phosphorylate downstream substrates to regulate the cell cycle. Different stages of cell division require different expression levels of Cyclin. The formation of Cyclin D1/2/3 and CDK4/6 complexes is necessary for cells to enter the G1 phase. The formation of the complex between Cyclin E and CDK2 determines whether cells can enter S phase through G1 phase. The combination of Cyclin A and CDK2 is necessary for cells to be in S phase. At the end of G2 phase and the beginning of M phase, the combination of Cyclin A and CDK1 is necessary to promote cells to complete the G2-M phase transition. After cells enter the M phase, the combination of Cyclin B1 and CDK1 is necessary again. In the late M phase, the degradation of Cyclin B1 is necessary for cells to leave the M phase and enter the next G1 phase.

The cell cycle is closely related to tumorigenesis. In the search for tumor-related genes, researchers discovered a new tumor-related gene CREPT (cell-cycle related and expression-elevated protein in tumor, patent number ZL200510135513.4). This gene can bind to the key enzyme in transcription, RNA polymerase II, on the Cyclin D1 gene, and cause the Cyclin D1 gene to form a ring structure, and the formation of this ring structure may promote gene transcription. CREPT is a cell cycle positive regulatory protein that exists and is very conserved in a variety of eukaryotes (such as humans, yeast, mice, chickens, toads, zebrafish, Drosophila, nematodes or Arabidopsis); Moreover, researchers have confirmed that CREPT protein is highly expressed in a variety of tumor cells and tumor tissues (Li et al., 2021; Lu et al., 2012).

However, it is unclear how CREPT participates in the regulation of cell cycle.

Contents of the invention

The inventors found that the phosphorylation state of residue 134 of the human CREPT protein is important for cell growth and cell growth. Cell cycle regulation plays a very important role, and it was further discovered that the S134A mutant of CREPT protein cannot be phosphorylated, can inhibit the proliferation and migration of eukaryotic cells, inhibit the growth and metastasis of tumors, and cause cancer cell death, thus completing the present invention.

In a first aspect of the present invention, there is provided a protein obtained by replacing residue 134 of the amino acid sequence of wild-type human CREPT (SEQ ID NO: 4) with a non-phosphorylatable residue. In one embodiment, the non-phosphorylatable residue is alanine or glutamine. In one embodiment, the amino acid sequence of the protein is SEQ ID NO: 2 (hereinafter referred to as "CREPT S134A"). In one embodiment, the protein is obtained by changing serine at position 134 of human CREPT to alanine.

The present invention also provides a protein that has more than 75% sequence identity with any of the above-mentioned proteins, and the residue at the position corresponding to position 134 of SEQ ID NO:4 is the non-phosphorylatable residue. .

The present invention also provides proteins in which a tag sequence or a guide sequence is connected to the N-terminus and/or C-terminus of the protein described in any of the above embodiments.

The present invention also provides nucleic acids encoding any of the above-mentioned proteins. In one embodiment, the sequence of the nucleic acid is SEQ ID NO: 1.

The invention also provides vectors comprising the nucleic acids and cells comprising the vectors.

In a second aspect of the present invention, the use of the above-mentioned protein, nucleic acid or vector in preparing a reagent for inhibiting the proliferation and/or migration of eukaryotic cells is provided. In one embodiment, the eukaryotic cell is a human, yeast, mouse, chicken, toad, zebrafish, Drosophila, nematode or Arabidopsis thaliana cell, preferably a human cell, more preferably a human cancer cell.

In a third aspect of the present invention, the use of the above-mentioned protein, nucleic acid or vector in preparing anti-cancer drugs is provided. In one embodiment, the anti-cancer drugs include drugs that inhibit cancer cell proliferation, inhibit cancer cell metastasis, or kill cancer cells. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, gastric cancer, or colorectal cancer (eg, colon cancer). In one embodiment, the anti-cancer agent further includes small molecule anti-cancer agents and/or antibody anti-cancer agents.

In a fourth aspect of the present invention, a method for treating cancer is provided, the method comprising administering an effective amount of the above-mentioned protein, nucleic acid or vector to a subject; or, the method comprising utilizing CRISPR/Cas9-based gene editing technology The CRPET gene in the genome of the subject's cancer cell is edited so that the cancer cell expresses any of the above-mentioned proteins. In one embodiment, the subject is a mammal, preferably a human. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, gastric cancer, or colorectal cancer. In one embodiment, the method further comprises administering to the subject a small molecule anti-cancer agent and/or an antibody anti-cancer agent. In one embodiment, the The method also includes subjecting the subject to radiation therapy and/or chemotherapy. In one embodiment, the method further includes reducing or eliminating wild-type CREPT in cancer cells of the subject before, during or after administering an effective amount of the protein, nucleic acid or vector to the subject. Express.

In a fifth aspect of the present invention, a method for identifying whether a substance is a phosphorylation inhibitor of the S134 site of the CREPT protein is provided, wherein the inhibitor maintains the S134 site of the CREPT protein in a non-continuous manner in eukaryotic cells. Phosphorylation state; the amino acid sequence of the CREPT protein is SEQ ID No: 4, and the method includes: S1) treating eukaryotic cells expressing the CREPT protein with the substance to be identified; S2) using anti-phosphorylated antibodies to perform immunoprecipitation. Check the phosphorylation level of the S134 site of the CREPT protein in the cells treated in step S1; compared with the phosphorylation level of the S134 site of the CREPT protein in the control cells not treated with the substance, if treated with the substance If the phosphorylation level of the S134 site of the CREPT protein in the treated cells decreases, for example, by more than 10%, more than 20%, more than 30%, or more than 40%, the substance is identified as the phosphorylation level of the S134 site of the CREPT protein. lation inhibitor, otherwise the substance was identified as not being a phosphorylation inhibitor of the S134 site of the CREPT protein. In one embodiment, before step S1, the method includes: using prediction tools SwissTargetPrediction and SEA to design the substance to be identified for CREPT. In one embodiment, step S1 is performed by incubating the substance to be identified and the eukaryotic cell under conditions that allow phosphorylation. In one embodiment, step S2 includes performing immunoprecipitation with an anti-CREPT antibody that recognizes the CREPT protein and an anti-phosphorylated antibody that recognizes the phosphorylation of the 134 site of the CREPT protein, thereby determining the phosphorylation level of the S134 site of the CREPT protein. Perform quantification. In one embodiment, the phosphorylation level is the relative value of the amount of S134 phosphorylated protein to the total amount of CREPT protein.

Description of drawings

The specific embodiments of the present invention will now be described with reference to the accompanying drawings, but neither the accompanying drawings nor the following detailed description should be construed as limiting the scope of the present invention. In the accompanying drawings:

Figure 1 shows the effect of CREPT S134A on tumor cell growth. A and C in Figure 1 are cell migration experiments, and B and D in Figure 1 are colony formation experiments. MOCK is a normal cell blank control; CREPT (WT) is a cell line that stably expresses wild-type CREPT; CREPT (S134A) is a cell line that stably expresses CREPT S134A protein.

Figure 2 shows the effect of CREPT S134A on melanoma lung metastasis. MOCK is the normal cell blank control; CREPT (WT) is the cell line stably expressing wild-type CREPT; CREPT (S134A) is the stable expression Cell lines for CREPT S134A protein.

Figure 3 shows the effect on lung metastasis in mice after the B16 cell line in which the CREPT gene has been knocked out and then transformed into wild-type CREPT. CREPT (KO) refers to the control of pcDNA3.1-HA empty vector transferred into B16 cells with CREPT gene knocked out; KO-CREPT (WT) refers to the transformation of pcDNA3.1-HA- into B16 cells with CREPT gene knocked out. The CREPT plasmid is a cell line that stably expresses wild-type CREPT; KO-CREPT (S134E) is a cell line that stably expresses the CREPT S134E mutant protein by transforming the pcDNA3.1-HA-CREPT (S134E) plasmid into B16 cells with the CREPT gene knocked out. Tie.

Figure 4 shows the effect on tumor cell growth after the CREPT gene has been knocked out in the DLD1 cell line and then transformed into wild-type CREPT. CREPT (KO) refers to the control of pcDNA3.1-HA empty vector transferred into DLD1 cells with CREPT gene knocked out; KO-CREPT (WT) refers to the transformation of pcDNA3.1-HA- into DLD1 cells with CREPT gene knocked out. The CREPT plasmid is a cell line that stably expresses wild-type CREPT; KO-CREPT (S134E) is a cell line that stably expresses the CREPT S134E mutant protein by transforming the pcDNA3.1-HA-CREPT (S134E) plasmid into DLD1 cells with the CREPT gene knocked out. Tie.

Figure 5 is the screening results of CREPT phosphorylation inhibitors. #1 to #5 above represent cells treated with candidate compounds #1 to #5, and the numbers in the middle (0 to 1.1) are the relative phosphorylation levels of each sample relative to background.

Figure 6 shows the effects of CREPT phosphorylation inhibitor candidate compounds #1 to #5 on the proliferation of DLD1 cells (A) and MGC803 cells (B).

Detailed ways

definition

The term "human CREPT protein" or "CREPT protein" or "human CREPT" used herein refers to human wild-type CREPT protein, unless otherwise specified, and its amino acid sequence is shown in SEQ ID NO: 4.

The term "CREPT protein mutant" or "CREPT mutant" used herein refers to a protein variant obtained by carrying out amino acid mutations on the basis of wild-type CREPT protein.

The term "non-phosphorylatable residue" as used herein is a protein residue that remains in an unphosphorylated state in eukaryotic cells. Non-phosphorylatable residues cannot be phosphorylated by kinase systems in eukaryotic cells.

The following will describe in detail the specific embodiments of the present invention.

It is known in the art that phosphorylation of specific sites on proteins (usually serine, threonine, and tyrosine) is a key link in cell signaling, and the essence of phosphorylation signaling lies in the charge state of the corresponding residues. Therefore, by Simulating the phosphorylation state of the corresponding site (i.e., negatively charged) can often achieve the effect of phosphorylation. Simulation of phosphorylated/unphosphorylated states is usually achieved using amino acid mutations or chemical modifications. For example, persistent activating mutations (i.e., mutations that mimic the phosphorylation state) include mutating residues to aspartic acid (D) or glutamic acid (E), since these two amino acids are the only negatively charged amino acids; The most common persistent inhibitory mutation (that is, a mutation that simulates a non-phosphorylated state) is to mutate serine to alanine (A), because alanine is positively charged and can continuously inhibit the activity of this residue site; In other cases, suppressor mutations may be to glutamine (Q) or phenylalanine (F). On the other hand, activating chemical modifiers (i.e., chemical modifiers that mimic the phosphorylation state) can include phosphate donors such as acetyl phosphate, phosphoramide salts, carbamoyl phosphate, and sodium pyrophosphate, as well as beryllium trifluoride. In addition, some CDK4/6-specific small molecule inhibitors such as Palbociclib, Ribociclib or Abemaciclib can also achieve the effect of keeping the protein non-phosphorylated (Maiani et al., 2021; Simoneschi et al., 2021).

After conducting sequence analysis on CREPT, the inventor found that multiple amino acid sites on the CREPT protein are all serine, and believed that the regulatory effect of CREPT protein on tumors may be related to the phosphorylation of these serines. The inventor used the phosphorylation site online analysis tool (http://kinasephos.mbc.nctu.edu.tw/predict.php) to predict the phosphorylation site of CREPT protein and found that the S134 site of CREPT protein is a potential phosphorylation site. lation site, and its corresponding protein kinase is the CDK family.

The inventor mutated serine at position 134 of the CREPT protein to alanine to obtain the S134A mutation to simulate the non-phosphorylated state of this site. The results showed that compared with the control, the S134A mutation of CREPT protein can inhibit the proliferation and migration of mouse embryonic fibroblasts (Figure 1); it can effectively inhibit the metastasis of mouse tumor cells (Figure 2), and can make mouse tumors Cell death (Figure 3).

In view of this, the present invention provides a protein obtained by replacing residue 134 of the amino acid sequence of human CREPT (SEQ ID NO: 4) with a non-phosphorylatable residue. In one embodiment, the non-phosphorylatable residue is alanine or glutamine. In one embodiment, the amino acid sequence of the protein is SEQ ID NO: 2. In a preferred embodiment, the protein is obtained by changing serine at position 134 of human CREPT to alanine; this means that the protein retains the post-translational modification of human CREPT except for amino acid at position 134.

The present invention also provides a protein that has a sequence identity of more than 75%, more than 80%, more than 90%, preferably more than 95%, more preferably more than 98% or more than 99% with any of the above proteins, and in a sequence corresponding to The residue at position 134 of SEQ ID NO:4 is the non-phosphorylatable residue.

The present invention also provides proteins in which a tag sequence or a guide sequence is connected to the N-terminal and/or C-terminal of the above-mentioned protein. In one embodiment, the protein is a fusion protein. In one embodiment, the tag sequence may be, for example, a purification tag, a fluorescent tag, a solubilization tag, an affinity tag, an epitope tag, or the like. In one embodiment, the guide sequence may be a polypeptide sequence that guides the protein across the cell membrane into the cell, including, for example, cell-penetrating peptides that are not based on endocytosis, and peptide sequences that are themselves prone to enter cells via endocytosis. or protein sequence.

The present invention also provides nucleic acids encoding the above-mentioned proteins. In one embodiment, the sequence of the nucleic acid is SEQ ID NO: 1, but the invention is not limited thereto. Those skilled in the art know that the sequence of the nucleic acid can be optimized for different expression environments based on codon degeneracy rules.

The invention also provides vectors comprising said nucleic acids. In one embodiment, the vector may be a plasmid or viral vector.

The invention also provides cells comprising said vector. In one embodiment, the cells are capable of stably expressing the above-mentioned protein.

The method of introducing a target protein (such as CREPT S134A of the present invention) into a target cell (such as a cancer cell) may include introducing a vector expressing the target protein into the target cell through transfection, infection or other means, or chemically modified mRNA may also be used (modRNA) to achieve the expression of target proteins in target cells. In addition, the target protein can be directly introduced into cells using, for example, the guide sequence described above. However, the present invention is not limited to this. For example, precision gene editing technology (such as prime editors) can be used to directly mutate target sites in the tumor genome (Anzalone, et al., 2019), such as mutating the corresponding bases of CREPT in the genome to allow cells to express CREPT S134A.

The present invention also provides the use of the above-mentioned protein, nucleic acid or vector in preparing a reagent for inhibiting the proliferation and/or migration of eukaryotic cells. In one embodiment, the eukaryotic cell is a human, yeast, mouse, chicken, toad, zebrafish, Drosophila, nematode or Arabidopsis thaliana cell, preferably a human cell, more preferably a human cancer cell.

The present invention also provides the use of the above-mentioned protein, nucleic acid or vector in the preparation of anti-cancer drugs. In one embodiment, the anti-cancer drugs include drugs that inhibit cancer cell proliferation, inhibit cancer cell metastasis, and/or kill cancer cells. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, gastric cancer, or colorectal cancer. In one embodiment, the anti-cancer agent also includes other small molecule anti-cancer agents and/or antibody anti-cancer agents. These small molecule anti-cancer agents and/or antibody anti-cancer agents may be known in the art.

The present invention also provides a method for treating cancer, which method includes administering an effective amount of the above-mentioned protein, nucleic acid or vector to a subject; or, the method includes editing the subject's cancer using gene editing technology based on CRISPR/Cas9 CRPET gene in the cell genome so that the cancer cells express any of the above proteins. In one embodiment, the subject is a mammal, preferably a human. In one embodiment, the method further Including administering to the subject a small molecule anti-cancer agent and/or an antibody anti-cancer agent. These small molecule anti-cancer agents and/or antibody anti-cancer agents may be known in the art. In one embodiment, the method further includes subjecting the subject to radiation therapy and/or chemotherapy. In one embodiment, the method further includes: reducing or eliminating expression of wild-type CREPT in the target cancer cells before, during or after administering an effective amount of the above-mentioned protein, nucleic acid or vector to the subject, for example, by siRNA or gene editing technology knocks down or knocks down wild-type CREPT in target cancer cells.

In addition, the present invention also relates to a method for identifying whether a substance is a phosphorylation inhibitor of the S134 site of the CREPT protein, wherein the inhibitor keeps the S134 site of the CREPT protein in a continuous non-phosphorylated state in eukaryotic cells. The amino acid sequence of the CREPT protein is SEQ ID No: 4, and the method includes: S1) treating eukaryotic cells expressing the CREPT protein with the substance to be identified; S2) performing immunoprecipitation with an anti-phosphorylated antibody to check step S1 The phosphorylation level of the S134 site of the CREPT protein in the treated cells; wherein, compared with the phosphorylation level of the S134 site of the CREPT protein in the control cells not treated with the substance, if treated with the substance The phosphorylation level of the S134 site of the CREPT protein in the cells is reduced, for example, by more than 10%, more than 20%, more than 30%, or more than 40%, more preferably by more than 50%, more than 60%, more than 70%, or more than 80%. % or more, 90% or 95%, then the substance is identified as a phosphorylation inhibitor of the S134 site of the CREPT protein; otherwise, the substance is identified as not a phosphorylation inhibitor of the S134 site of the CREPT protein.

In one embodiment, before step S1, the method includes designing the substance to be identified for CREPT using prediction tools SwissTargetPrediction and SEA. The substance can then be synthesized artificially.

In one embodiment, step S1 is performed by incubating the substance to be identified and the eukaryotic cell under conditions that allow phosphorylation. The "conditions that allow phosphorylation" include, but are not limited to, the presence of a kinase system sufficient to phosphorylate CREPT S134 under factors such as suitable environmental temperature, pH, ionic strength, etc., such that in the absence of phosphorylation inhibitors or kinase inhibition CREPT S134 can be phosphorylated in the presence of an agent (e.g., normal eukaryotic cell environment).

In one embodiment, step S2 includes performing immunoprecipitation with an anti-CREPT antibody that recognizes the CREPT protein and an anti-phosphorylated antibody that recognizes the phosphorylation of the 134 site of the CREPT protein, thereby determining the phosphorylation level of the S134 site of the CREPT protein. Perform quantification. Specifically, the CREPT protein can be precipitated with an anti-CREPT antibody, and the total amount of CREPT protein can be measured as the background amount. For the protein immunoprecipitated with the anti-CREPT antibody, anti-phosphorylation that specifically recognizes the phosphorylation of the CREPT134 site can be used. Antibodies to detect phosphorylated proteins Whiten and quantify it. At this time, the phosphorylation level can be the ratio of the amount of phosphorylated protein to the background amount of CREPT protein.

In one embodiment, the eukaryotic cell expressing CREPT protein is a cell containing a kinase system that phosphorylates S134 of wild-type CREPT, for example, human, yeast, mouse, chicken, toad, etc. that can naturally express CREPT protein. Zebrafish, Drosophila, C. elegans, or Arabidopsis cells, or cells genetically modified to express or overexpress a kinase system with the same function.

The invention also relates to the following compounds:

As well as the use of the above compounds in preparing phosphorylation inhibitors of CREPT 134 site and in preparing drugs for treating cancer. In one embodiment, the cancer is melanoma, liver cancer, kidney cancer, gastric cancer, or colorectal cancer. In one embodiment, the hydroxyl group (-OH) in the above compound #3 can be replaced by other leaving groups, such as halogen, -OCOR, -OTs, -ONO ₂ , etc., where R can be C _1-6 alkyl Or C _1-4 alkyl.

Sequence description:

SEQ ID NO:1 Nucleic acid sequence encoding CREPT S134A mutant protein;

SEQ ID NO:2CREPT Amino acid sequence of S134A mutant protein;

SEQ ID NO:3 Coding nucleic acid sequence of wild-type CREPT;

SEQ ID NO:4 Amino acid sequence of wild-type CREPT.

Example

In the following examples, the experimental methods used are conventional methods unless otherwise specified; the materials used, Reagents, etc., unless otherwise specified, can be obtained from commercial sources or can be prepared by conventional methods; the quantitative tests conducted were conducted in triplicate experiments, and the results were averaged.

Example 1. Obtaining CREPT S134A mutant protein and its encoding gene

1. Selection of mutation sites

Based on tool predictions and the interaction between the cell cycle positive regulatory protein CREPT and the cell cycle protein kinase CDK6, the inventors selected conserved sequence sites that are consistent with CDK6 phosphorylation downstream substrates as mutation sites. The mutation site selected in the present invention is the 134th amino acid of the cell cycle positive regulatory protein CREPT.

2. Design of site-directed mutagenesis primers

Design site-directed mutation primers based on the mutation sites. The designed site-directed mutation primer sequences are as follows:

Forward primer: GCCCCTCCCCCCAAAGCAACA;

Reverse primer: CTTGGAGTCCTCCATAGACAG.

3. PCR amplification

Use the pcDNA3.1-HA-CREPT (WT) plasmid as the template and use the primers designed in step 2 to perform PCR amplification to obtain the PCR amplification product.

4. Sequencing

Sequence the PCR product obtained in step 3. The sequencing results showed that the nucleotide sequence shown in SEQ ID NO:1 was obtained by PCR amplification, and the gene shown in SEQ ID NO:1 was named CREPT S134A gene. The amino acid sequence of the protein encoded by the CREPT S134A gene is shown in SEQ ID NO:2. The protein shown in SEQ ID NO:2 is named CREPT S134A protein.

CREPT S134A protein is a protein obtained by mutating serine (Ser) at position 134 of the cell cycle positive regulatory protein CREPT to alanine (Ala), while keeping other sequences of the protein CREPT unchanged; the CREPT S134A gene encodes the cell cycle A gene obtained by mutating the codon AGC of serine 134 of the positive regulatory protein CREPT to GCC encoding alanine, while keeping other sequences of the protein CREPT encoding gene unchanged. The amino acid sequence of wild-type CREPT is shown in SEQ ID NO:4, and its coding sequence is shown in SEQ ID NO:3.

Example 2. Preparation of CREPT S134A mutant

1. Construction of recombinant plasmid

Use the CREPT S134A gene shown in SEQ ID NO: 1 to replace the small fragment between the kpnI and EcoRV restriction sites of the pcDNA3.1-HA plasmid (purchased from Clontech) to obtain the expression of pcDNA3.1-HA-CREPT (S134A) Plasmid S134A;

Use the CREPT gene shown in SEQ ID NO:3 to replace the small fragment between the kpnI and EcoRV restriction sites of the pcDNA3.1-HA plasmid to obtain the pcDNA3.1-HA-CREPT expression plasmid WT.

2. Packaging of recombinant plasmid

The pcDNA3.1-HA-CREPT (S134A) expression plasmid S134A and the pcDNA3.1-HA-CREPT expression plasmid WT plasmid were packaged to obtain pcDNA3.1-HA-CREPT (S134A) and pcDNA3.1 containing lentiviral particles respectively. -Supernatant of HA-CREPT. The specific steps are as follows (taking one well of a six-well plate as an example):

1) One day before transfection, inoculate an appropriate amount of HEK293T cells (ATCC, CRL-3216) until the cell density is 60-80% at the time of transfection.

2) Add 5 μg of plasmid (the packaging virus is a 3-plasmid system, pMD2G: PSApX2: target plasmid = 1:1.5:2.5) into 100 μL of 0.9% NaCl, and mix by pipetting.

3) Take 2 μL of Vigofect transfection reagent, add 100 μL of 0.9% NaCl, mix gently, and leave at room temperature for 5 minutes.

4) Add the diluted plasmid in step 2) to the diluted transfection reagent in step 3), mix gently by pipetting, and leave at room temperature for 15 minutes.

5) Add the transfection working solution drop by drop to the cell culture medium, mix the culture medium gently, and place it in the cell culture incubator.

6) After 4-6 hours, replace with 2mL of fresh culture medium.

7) Change to fresh culture medium after 24 hours, and collect the 72-hour supernatant containing the virus.

3. Infection of target cells

The supernatants containing lentiviral particles pcDNA3.1-HA-CREPT (S134A) and pcDNA3.1-HA-CREPT (WT) were added to mouse melanoma cells B16 (ATCC, CRL-6475) to obtain the following mutants. : B16 cell line stably expressing CREPT S134A protein and B16 cell line stably expressing wild-type CREPT protein. Specific steps are as follows:

(1) Pour B16 cells into a six-well cell culture plate and culture them at 37°C and 5% CO _2. The culture medium is RPMI1640 (Gibco, 11875093).

(2) Carry out lentiviral transfection when the density reaches 30-50% on the second day of culture. Four wells were selected from the five wells as the experimental group, and the remaining one well was selected as the control group.

Experimental group: Aspirate 1 mL of culture medium, add 1 mL of virus supernatant and 2 μL of polybrene (Sigma Aldrich, 107689) to each well, so that the final concentration of polybrene in the system is 5 ng/μL. Draw a "figure 8" on the operating table and mix gently.

Control group: Aspirate 1 mL of culture medium and add 1 mL of complete culture medium to each well.

(3) 24 hours after transfection, transfer the cells to a 100mm culture dish. After 24 hours, add the corresponding antibiotic (neomycin 1mg/ml) for selection and culture for 7-10 days. Use a pipette tip to pick clones to a 24-well plate and continue. Positive clone cells were detected after culture.

According to the above method, the supernatant containing lentiviral particles pcDNA3.1-HA-CREPT (S134A) and pcDNA3.1-HA-CREPT (WT) was added to the mouse embryonic fibroblast cell line NIH3T3 (ATCC, CRL-1658). and mouse melanoma cell line B16 (ATCC, CRL-6322), and the following mutants were obtained: NIH3T3 and B16 cell lines stably expressing CREPT S134A, and NIH3T3 and B16 cell lines stably expressing wild-type CREPT.

Example 3. Effect of CREPT S134A mutant on cell migration ability

1) Use a ruler and marker to draw horizontal lines evenly on the back of the 6-well plate, about every 0.5-1cm, across the holes. Pass at least 5 lines through each hole. Add about 5 × 10 ⁵ NIH3T3 or B16 cells, which are the NIH3T3 or B16 cell line that stably expresses CREPT S134A, the NIH3T3 or B16 cell line that stably expresses wild-type CREPT, and the NIH3T3 or B16 cell line that stably expresses pcDNA3.1-HA. .

2) After culturing overnight, use the tip of the pipette to compare with the ruler, and try to make the scratch perpendicular to the horizontal line on the back. The tip of the pipette should be vertical and not tilted. Wash the cells three times with PBS to remove floating cells after scratching, and then add serum-free medium.

3) Place it in a 37°C, 5% _CO2 incubator for culture. Samples were taken and photographed after 0 and 24 hours of culture.

The results are shown in Figure 1, A and C. The results showed that mutating the 134th position of CREPT protein to alanine inhibited cell migration.

Example 4. Effect of CREPT S134A mutant on cell proliferation ability

1) Take cells in the logarithmic growth phase (NIH3T3 or B16 cell line), digest them with 0.25% trypsin and pipet gently to turn them into single cells, count viable cells, and use DMEM culture medium containing 20% fetal bovine serum. Adjust the cell density to 1×10 ⁶ cells/L. Then lay the plates according to the experimental requirements.

2) After adding 4 mL of culture medium and 4 mL of cell diluent in a 1:1 ratio, add 2 mL of the mixture into each well of the six-well plate, with a total of 3 replicate wells. Place in a 37°C, 5% _CO2 incubator for 7 to 14 days.

3) When the clone size is appropriate, discard the cell clone supernatant, add 0.1% crystal violet solution for staining for 30 minutes, and wash away the excess dye solution with running water.

4) Place the plate on the scanner and observe the number of cell clones.

The results are shown in Figure 1, B and D. The results showed that after the 134th position of CREPT protein was mutated to alanine, Inhibits the formation of cell clones.

The above results indicate that CREPT S134A protein has the function of inhibiting cell migration and proliferation, and the serine position 134 of CREPT is crucial for CREPT to maintain its function of promoting colony formation.

Example 5. Effect of CREPT S134A mutant on the metastasis ability of tumor cells

The C57BL/6J mouse lung metastasis experiment was used to detect the effect of CREPT S134A mutant on the metastasis ability of cancer cells. The specific steps are as follows: respectively, separate the B16 cell line that stably expresses pcDNA3.1-HA (MOCK), the B16 cell line that stably expresses wild-type CREPT (CREPT-WT), and the B16 cell line that stably expresses CREPT S134A protein (CREPT-S134A). C57BL/6J mice (the mice were purchased from Vital Lever Company, B6J JAX Lab) were inoculated by tail vein injection. The inoculation dose was 1×10 ⁵ cells/200 μL/mouse. The mice were sacrificed 21 days after inoculation. , and take out the lungs of mice to observe the occurrence of lung tumors.

The results are shown in Figure 2. As can be seen from the figure: cells in the MOCK group can cause mice to develop tumors in the lungs. When mice are inoculated with the B16 cell line CREPT-WT, which stably expresses wild-type CREPT protein, lung tumors increase significantly, and when mice are inoculated with When the B16 cell line CREPT-S134A stably expresses the CREPT S134A protein, lung tumors were significantly reduced compared with the other two groups. This shows that the 134th serine position of CREPT is crucial for CREPT to promote tumor metastasis, and the CREPT S134A mutant can effectively inhibit tumor metastasis.

Example 6. Effect of CREPT S134A mutant protein on CREPT-knockout tumor cells

The C57BL/6J mouse melanoma lung metastasis experiment was used to detect the effect of CREPT S134A mutant protein on the metastatic ability of CREPT-deficient tumor cells. The specific steps are as follows: First, a cell line stably expressing pcDNA3.1-HA (CREPT-KO) and a cell line stably expressing wild-type CREPT (KO-CREPT-WT) were established based on the CREPT-knocked-out B16 cell line. , a cell line that stably expresses CREPT S134E protein (KO-CREPT-S134E) and a cell line that stably expresses CREPT-S134A protein (KO-CREPT-S134A). Based on the tumor-suppressing effect of CREPT S134A mutant protein, we tried to restore CREPT S134A in the CREPT-knocked-out tumor cell line B16 (KO CREPT). The results showed that the cells died, resulting in the failure to successfully establish a cell line stably expressing the CREPT S134A protein (KO- CREPT-S134A).

Then, the above-mentioned successfully established cell lines CREPT-KO, KO-CREPT-WT and KO-CREPT-S134E were injected into C57BL/6J mice (the mice were purchased from Viton Lever Company, B6J JAX Lab) through the tail vein. Methods: The inoculation dose was 1×10 ⁵ cells/200 μL/mouse. The mice were sacrificed 21 days after inoculation, and the lungs of the mice were taken out to observe the occurrence of lung tumors.

The results are shown in Figure 3. Cells in the CREPT-KO group were unable to cause tumors in the lungs of mice. When mice were inoculated Lung tumors were significantly increased when KO-CREPT-WT cell line and KO-CREPT-S134E cell line. This shows that CREPT serine 134 is crucial for CREPT to promote tumor metastasis. In addition, it was also found that the CREPT S134E mutant protein can simulate the phosphorylation state of wild-type CREPT at position 134, so it will not inhibit or kill tumor cells; while the CREPT-S134A mutant protein simulates the non-phosphorylation state of wild-type CREPT at position 134. , thereby inhibiting or killing tumor cells.

Example 7. Effect of CREPT S134A mutant protein on CREPT-knockout tumor cells

Colony formation assay was used to detect the effect of CREPT S134A mutant protein on the growth of CREPT-deficient tumor cells. The specific steps are as follows: First, based on the CREPT-knocked-out DLD1 cell line, a cell line stably expressing pcDNA3.1-HA (CREPT-KO) and a cell line stably expressing wild-type CREPT (KO-CREPT-WT) were established. , a cell line that stably expresses CREPT S134E protein (KO-CREPT-S134E) and a cell line that stably expresses CREPT-S134A protein (KO-CREPT-S134A). Based on the tumor-suppressing effect of CREPT S134A mutant protein, an attempt was made to restore CREPT S134A in the CREPT-knocked-out tumor cell line DLD1 (KO CREPT). The results showed that the cells died, resulting in the failure to successfully establish a cell line stably expressing the CREPT S134A protein (KO- CREPT-S134A).

Then, the clone formation experiments were performed according to the steps of Example 4 using the successfully established cell lines CREPT-KO, KO-CREPT-WT and KO-CREPT-S134E.

The results are shown in Figure 4. The number of clones produced by the KO-CREPT-WT cell line and the KO-CREPT-S134E cell line was significantly higher than that of the CREPT-KO group cells. This shows that the serine position at position 134 of CREPT is crucial for CREPT to promote tumor cell growth.

The technical ideas and specific implementations of the present invention have been described above, but it should be understood that the above specific implementations do not limit the scope of the present invention in any way. Those skilled in the art can understand that various modifications and/or changes can be made to the invention shown in the specific embodiments without departing from the essence of the invention, and the modified and/or changed embodiments are also covered by this invention. within the scope of the invention. Accordingly, the embodiments of the present invention are illustrative only and not restrictive.

Example 8. Screening of CREPT phosphorylation inhibitors

8.1 Prediction of small molecule compounds as potential CREPT phosphorylation inhibitors

The prediction tools SwissTargetPrediction (http://www.swisstargetprediction.ch/) and SEA (Similarity ensemble approach; https://sea.bkslab.org/) were used to predict small molecule phosphorylation inhibitors of CREPT, and 5 was obtained and synthesized. candidate small molecule compounds #1 to #5.

8.2 Effect of candidate small molecule compounds on CREPT phosphorylation

1) First, pass the CREPT-knocked-out HEK293T cells into a culture dish. When the cells reach a density of 60%-80% the next day, the cells are transfected with HA-CREPT (S134A) and HA-CREPT (WT) plasmids. Among them, one transfection of HA-CREPT (S134A) was used as a negative control, and seven transfections of HA-CREPT (WT) were used to verify the effects of different candidate small molecules and controls on the phosphorylation of CREPT 134 site.

2) After 4 hours of transfection, the medium of the transfected cells was changed. Except for 1 part transfected with HA-CREPT (S134A) and HA-CREPT (WT), the medium was replaced with normal medium, and the other 6 parts were replaced with normal medium. The cells transfected with HA-CREPT (WT) were replaced with normal culture medium containing DMSO or small molecules #1, #2, #3, #4, and #5. The working concentration of all small molecules was uniformly set to 5 μM. .

3) The drug treatment time is 24 hours. Cells are lysed and the proteins are harvested. Immunoprecipitation experiments are performed using HA tag protein antibodies. The immunoprecipitated tag proteins are detected using antibodies that specifically recognize the phosphorylation of CREPT134 site. At the same time, the tag antibodies are used. Detect the background amount of CREPT protein, and then perform grayscale analysis to obtain the amount of phosphorylated protein relative to the background amount, thereby quantifying the phosphorylation level.

The results are shown in Figure 5. It was found that HA-CREPT(S134A) was used as a negative control and no phosphorylation signal could be detected, while an obvious phosphorylation signal could be detected in the DMSO control of HA-CREPT(WT). Grayscale analysis results confirmed that candidate small molecule compounds #1, #2 and #5 did not affect the phosphorylation of HA-CREPT(WT) at position 134, while #3 and #4 significantly reduced HA-CREPT(WT) Phosphorylation level at position 134. The structural formulas of compounds #3 and #4 are as follows:

8.3 Effect of candidate small molecule compounds on cell proliferation

1) Take DLD1 (human colorectal adenocarcinoma epithelial cells) or MGC803 (human gastric cancer cells) in the logarithmic growth phase, digest it with 0.25% trypsin and pipet gently to turn it into single cells, count the viable cells, and use The cell density was adjusted to 1×10 ⁴ cells/L in DMEM culture medium containing 10% fetal calf serum.

2) After adding 10 mL of culture medium and 10 mL of cell diluent in a 1:1 ratio, add 0.2 mL of the mixed solution to each well of the 96-well plate, with a total of 3 replicate wells. Place in a 37°C, 5% _CO2 incubator for 12 hours.

3) Take the above five candidate small molecule compounds #1 to #5 and dissolve them in DMSO. The initial screening concentration of each compound is 10 μM (DLD1 cells) or 5 μM (MGC803 cells). Each compound was run in triplicate; each compound was incubated for 3 days at a concentration of 10 μM (DLD1 cells) or 5 μM (MGC803 cells), and cell proliferation was measured using CCK. Before measurement, each well was replaced with 10 μl of mixed CCK-8 solution and 90 μl of complete culture medium (the wells with corresponding amounts of CCK-8 solution and cell culture medium were added as blank controls). Incubate at 37°C for 3 hours. Measure the absorbance at a wavelength of 450 nm. The results were calculated and statistically drawn and graphed. The results are shown in Figure 6 A (DLD1 cells) and B (MGC803 cells).

It can be seen that compound #4, which is a CREPT phosphorylation inhibitor, significantly inhibits cell proliferation, which shows that the inhibition of the phosphorylation of CREPT S134 site in cells by the test concentration of compound #4 leads to the inhibition of cell proliferation, which is consistent with the implementation of The results of Example 4 are consistent. Namely, Compound #4 can exhibit effects similar to the CREPT S134A mutation.

references

Anzalone,A.V.,Randolph,P.B.,Davis,J.R.et al.(2019)Search-and-replace genome editing without double-strand breaks or donor DNA.Nature 576,149–157.

Li,MD,Ma,DH,and Chang,ZJ(2021).Current understanding of CREPT and p15RS,carboxyterminal domain(CTD)-interacting proteins,in human cancers.Oncogene 40,705-716.

Lu,D.,Wu,Y.,Wang,Y.,Ren,F.,Wang,D.,Su,F.,Zhang,Y.,Yang,X.,Jin,G.,Hao,X., et al.(2012).CREPT accelerates tumorigenesis by regulating the transcription of cell-cycle-related genes.Cancer Cell 21,92-104.

Maiani,E.,Milletti,G.,Nazio,F.,Holdgaard,S.G.,Bartkova,J.,Rizza,S.,Cianfanelli,V.,Lorente,M.,Simoneschi,D.,Di Marco,M., et al.(2021).AMBRA1 regulates cyclin D to guard S-phase entry and genomic integrity.Nature 592,799-+.

Simoneschi,D.,Rona,G.,Zhou,N.,Jeong,YT,Jiang,SW,Milletti,G.,Arbini,AA,O'Sullivan,A.,Wang,AA,Nithikasem,S.,et al .(2021).CRL4(AMBRA1)is a master regulator of D-type cyclins.Nature 592,789-+.

Claims

A protein obtained by replacing residue 134 of SEQ ID NO:4 with a non-phosphorylatable residue.
The protein of claim 1, wherein the non-phosphorylatable residue is alanine or glutamine.
The protein according to claim 1, whose amino acid sequence is shown in SEQ ID NO: 2.
The protein of claim 3, which is obtained by changing serine at position 134 of human CREPT protein to alanine.
A protein having more than 75% sequence identity with the protein of any one of claims 1 to 4, and the residue at the position corresponding to position 134 of SEQ ID NO:4 is as described Non-phosphorylatable residues.
A protein with a tag sequence or a guide sequence connected to the N-terminus and/or C-terminus of the protein according to any one of claims 1 to 5.
Nucleic acid encoding the protein of any one of claims 1 to 6.
The nucleic acid as claimed in claim 7, whose sequence is SEQ ID NO: 1.
An expression vector comprising the nucleic acid of claim 7 or 8.
A cell comprising the vector of claim 9.
Use of the protein according to any one of claims 1 to 6, the nucleic acid according to claim 7 or 8, or the vector according to claim 9 in the preparation of a reagent for inhibiting the proliferation and/or migration of eukaryotic cells.
The application as claimed in claim 11, wherein the eukaryotic cell is a human, yeast, mouse, chicken, toad, zebrafish, fruit fly, nematode or Arabidopsis thaliana cell, preferably a human cell, more preferably a human cancer cell. cell.
Use of the protein according to any one of claims 1 to 6, the nucleic acid according to claim 7 or 8, or the vector according to claim 9 in the preparation of anticancer drugs.
The application according to claim 13, wherein the anti-cancer drugs include drugs that inhibit cancer cell proliferation, inhibit cancer cell metastasis, or kill cancer cells.
The use of claim 13, wherein the cancer is melanoma, liver cancer, kidney cancer, gastric cancer or colorectal cancer.
The application according to claim 13, wherein the anti-cancer drug further includes a small molecule anti-cancer agent and/or an antibody anti-cancer agent.
A method of treating cancer, the method comprising:

i) administering to a subject an effective amount of the protein of any one of claims 1 to 6, the nucleic acid of claim 7 or 8, or the vector of claim 9, or

ii) Using CRISPR/Cas9-based gene editing technology to edit the CRPET gene in the genome of the subject's cancer cells, so that the cancer cells express the protein of any one of claims 1 to 5.
The method of claim 17, wherein the subject is a mammal, preferably a human.
The method of claim 17, further comprising administering to the subject a small molecule anti-cancer agent and/or an antibody anti-cancer agent.
The method of claim 17, further comprising subjecting the subject to radiation therapy and/or chemotherapy.
The method of claim 17, wherein i) further comprises: reducing or eliminating cancer cells in the subject before, during or after administering an effective amount of the protein, nucleic acid or vector to the subject Expression of wild-type CREPT.
The method of claim 17, wherein the cancer is melanoma, liver cancer, kidney cancer, gastric cancer or colorectal cancer.
A method for identifying whether a substance is a phosphorylation inhibitor of the S134 site of the CREPT protein, wherein the inhibitor keeps the S134 site of the CREPT protein in a continuous non-phosphorylated state in eukaryotic cells; The amino acid sequence is SEQ ID No: 4, and the method includes:

S1. Treat eukaryotic cells expressing CREPT protein with the substance to be identified,

S2. Use anti-phosphorylated antibodies to perform immunoprecipitation to check the phosphorylation level of the S134 site of the CREPT protein in the cells treated in step S1;

Compared with the phosphorylation level of the S134 site of the CREPT protein in control cells not treated with the substance, if the phosphorylation level of the S134 site of the CREPT protein in cells treated with the substance decreases, for example, by 10% Above, above 20%, above 30% or above 40%, the substance will be identified as a phosphorylation inhibitor of the S134 site of the CREPT protein; otherwise, the substance will be identified as not a phosphorylation inhibitor of the S134 site of the CREPT protein. Inhibitors.
The method of claim 23, wherein before step S1, the method further includes: using prediction tools SwissTargetPrediction and SEA to design the substance to be identified for CREPT.
The method of claim 23, wherein step S1 is performed by incubating the substance to be identified and the eukaryotic cell under conditions that allow phosphorylation.
The method of claim 23, wherein step S2 includes using an antibody that recognizes CREPT protein CREPT antibodies and anti-phosphorylation antibodies that recognize the phosphorylation of CREPT protein at site 134 were used to perform immunoprecipitation, thereby quantifying the phosphorylation level of S134 site of CREPT protein.