CN115976073A - Gene FAEs for coding feruloyl esterase, recombinant vector, recombinant strain and application - Google Patents
Gene FAEs for coding feruloyl esterase, recombinant vector, recombinant strain and application Download PDFInfo
- Publication number
- CN115976073A CN115976073A CN202310171404.6A CN202310171404A CN115976073A CN 115976073 A CN115976073 A CN 115976073A CN 202310171404 A CN202310171404 A CN 202310171404A CN 115976073 A CN115976073 A CN 115976073A
- Authority
- CN
- China
- Prior art keywords
- gene
- faes
- feruloyl esterase
- recombinant
- recombinant vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides gene FAEs for coding feruloyl esterase, a recombinant vector, a recombinant strain and application, and belongs to the technical field of genetic engineering, wherein the nucleotide sequence of the gene FAEs for the feruloyl esterase is shown as SEQ ID No.1, the gene FAEs are from Lactobacillus reuteri A4-2, the Lactobacillus reuteri A4-2 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation number is CGMCC No.24966. The ferulic acid esterase FAE1 from the lactobacillus reuteri A4-2 has the advantages of high specific activity, high enzymolysis efficiency, high stability, metal ion resistance, salt tolerance and the like, and has important application prospects in the fields of medicine and health care, food, feed, biological energy and the like.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to gene FAEs for coding feruloyl esterase, a recombinant vector, a recombinant strain and application.
Background
The Qinghai-Tibet plateau honored as the third pole of the earth breeds unique and abundant biological germplasm resources due to the special geographical position and climatic environment, and researches show that some special probiotic bacteria exist in the grass silage of the Qinghai-Tibet plateau due to the extreme climate environmental influences of alpine, hypoxia, strong ultraviolet rays and the like of the Qinghai-Tibet plateau, and the special probiotic bacteria have extremely special biological function, and are valuable and unique lactic acid bacteria germplasm resources for human beings in this kind of precious land, and the development and industrial utilization value of the bacteria resources is extremely high.
Lignocellulose generally refers to biomass comprising lignin and cellulose and hemicellulose, mainly the poorly utilized cell wall components that make up woody, herbaceous plants. The lignocellulose contains a lot of xylose and arabinose five-carbon sugars in hemicellulose which is second to the content of the cellulose, the five-carbon sugars are difficult to be utilized by most microorganisms, and how to effectively utilize a carbon source in a fiber raw material is the problem to be solved firstly for improving the effective utilization of the fiber raw material. The high-fiber raw material is rich in cellulose, hemicellulose and lignin, and the cellulose hydrolysis by cellulase is severely limited by crosslinking and crystallization between the hemicellulose and the lignin, so that a great problem is brought to lignocellulose pretreatment.
Feruloyl esterase (FAE) is one of carbohydrate esterase subfamilies, can hydrolyze ester bonds between ferulic acid and polysaccharide in plant cell walls, and researches show that the feruloyl esterase is a key action enzyme for releasing ferulic acid in plant cell walls, and can effectively release ferulic acid or ferulic acid dimer in matrixes such as wheat bran, corn straws and the like under the synergistic action of endo-xylanase and the like, so that the lignocellulose conversion rate is improved.
The research on feruloyl esterase mainly focuses on the aspects of screening and application of strains at present; the clones reported to date concerning the ferulic acid esterase gene have also been obtained mainly from fungi or yeasts. However, genes from fungi and yeasts often contain introns, so that the genes need to be modified to remove the introns during subsequent gene expression, and the construction process of the bacterial high-expression vector is more complicated. Therefore, the ferulic acid esterase gene selected from the bacterial source is more suitable for constructing bacterial high-expression vectors. However, few reports on the molecular cloning of bacterial ferulic acid esterase gene are reported at present. The study of the cloning of the ferulic acid esterase gene from Lactobacillus reuteri is not reported.
Disclosure of Invention
In view of the above, the present invention aims to provide a gene FAEs encoding feruloyl esterase, a recombinant vector, a recombinant strain and an application thereof, the present invention clones the encoding gene of feruloyl esterase FAE1 from the Lactobacillus reuteri A4-2, and expresses the recombinant vector thereof through Escherichia coli to obtain pure feruloyl esterase; solves the technical problems of the prior art that the strain for producing the ferulic acid esterase is deficient and no bacterial source ferulic acid esterase gene is cloned.
The invention provides a gene FAEs for coding feruloyl esterase, wherein the nucleotide sequence of the gene FAEs for the feruloyl esterase is shown as SEQ ID No. 1.
The invention provides a recombinant vector for expressing the gene FAEs, which comprises an initial vector and the gene FAEs.
The invention provides a preparation method of the recombinant vector, which comprises the following steps:
1) Extracting the genome DNA of the lactobacillus reuteri A4-2;
2) Performing PCR amplification by taking the genomic DNA obtained in the step 1) as a template to obtain an amplification product;
3) Connecting the amplification product with an initial vector to obtain a recombinant vector;
the primer pair used in the PCR amplification of the step 2) comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3;
the Lactobacillus reuteri A4-2 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCCNo.24966.
Preferably, the PCR amplification system in step 2) comprises the following components in 50 μ L:
the PCR amplification procedure described in step 2) is as follows: pre-denaturation at 94 deg.C for 5min; denaturation at 94 ℃ for 1min, annealing at 58 ℃ for 1min, and extension at 72 ℃ for 1.5min, wherein the denaturation, annealing and extension are carried out for 30 cycles; finally, extension is carried out for 10min at 72 ℃.
The invention provides a recombinant strain for expressing the gene FAEs, wherein the recombinant strain takes escherichia coli DH5 alpha as a host strain and is transformed with the recombinant vector.
The invention provides gene FAEs for coding feruloyl esterase, and application of the recombinant vector or the recombinant strain in preparation of feruloyl esterase.
Compared with the prior art, the invention has the following beneficial effects:
the invention clones the encoding gene of the feruloyl esterase FAE1 from the lactobacillus reuteri A4-2, and expresses the recombinant vector thereof through escherichia coli to obtain pure enzyme; experiments prove that the ferulic acid esterase FAE1 from the lactobacillus reuteri A4-2 has the advantages of high specific activity, high enzymolysis efficiency, high stability and the like, and has important application prospects in the fields of medicine and health care, food, feed, biological energy and the like.
Biological preservation Instructions
The Lactobacillus reuteri A4-2 is preserved in China general microbiological culture Collection center (CGMCC), the preservation number is CGMCC No.24966, and the preservation date is 26/5 at 2022; the preservation address is No.3 of Xilu No.1 of Beijing, chaoyang, china.
Drawings
FIG. 1 is a standard curve of the variation of the peak area of ferulic acid corresponding to different concentrations of ferulic acid;
FIG. 2 shows the optimum reaction pH (a) and pH stability (b) of a crude enzyme solution of Lactobacillus reuteri A4-2;
FIG. 3 shows the optimum reaction temperature (a) and temperature stability (b) of a crude enzyme solution of Lactobacillus reuteri A4-2;
FIG. 4 is a gel electrophoresis of the target gene FAEs, wherein lane M is Takara 2000bp DNA marker, and lanes 1, 2 and 3 are the target genes;
FIG. 5 shows PCR electrophoresis of bacterial suspension.
Detailed Description
The invention provides a gene FAEs for coding feruloyl esterase, wherein the nucleotide sequence of the gene FAEs for feruloyl esterase is shown as SEQ ID No.1, and specifically comprises the following steps:
GCCGTTGAAAACGCCGCCCAGGAATTGTAATCGGCTCCCTATAGG CGAATTGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCGGCCGCGGGAATTCGATTTAAGAAGGAGATATACATATGGAAATAACAATCAAACGAGATGGTCTAAAACTATATGGCCTTCTTGAAGGAACAACGACGATTAAAAACGATACGGTTGCAATTCTGATGCATGGCTTTAAGGGCAATCTGGGATATGATGATTCTAAAATTCTATATGCTCTTTCGCACTATTTAAACCAACAAGGAATTCCAACGTTACGCTTTGACTTTGATGGAACTGGCCATAGTGATGGTGAATTCAAGAATATGACAGTTTTCAGTGAAATCCTGGATGGAATGAAAATCATTGACTATGCTCATACCACTATGCAAGCAAAGAAGATTTACCTTATTGGTCATTCGCAAGGTGGGGTAGTTGCTTCGATGCTGGCGGCTTATTATCGCGATATTATTACAAAACTGGTACTGCTGGCATCTGCTGCAACCTTGAAAGATGATGCGCTAAAAGGAGTTTGTCAGGGAAGCCAATATGACCCTAACCATATACCAGAAACGGTTGATGTGCATGGCTTTACCGTTGGTGGCGACTACTTTCGAACGGCGCAGCTTTTACCAATTTACGAAACAGCACAGCATTATAGTGGACCGACACTGCTAATTCATGGGTTAGGTGATAATGTAGTTTCCTCGGAAGCTTCAAAGAAATATAATGTGATCATGCCTAACAGTGAGTTGCATTTAATTCCGGAAGAAGGGCATATGTTTAATGGCTCACAACGCCAAGAAATTTTGGAACTGGTAGCTAACTTTTTAAAAAATCTCGAGCACCACCACCACCACAATCACTAGTGAATTCGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGGCACCTAAATAGCTTGGCGGAATCATGGGCATAGCTGGTTCCTGGGGGAAATGGTATCC。
the invention also provides a recombinant vector for expressing the gene FAEs, which comprises an initial vector and the gene FAEs.
In the present invention, the initial vector is preferably pGEM-T Easy or pET-22b; in the present invention, the gene FAEs is preferably cloned in the multiple cloning site of lacZ on pGEM-T Easy of the initial vector.
The invention also provides a preparation method of the recombinant vector, which comprises the following steps: 1) Extracting the genome DNA of the lactobacillus reuteri A4-2; 2) Performing PCR amplification by using the genomic DNA obtained in the step 1) as a template to obtain an amplification product; 3) And connecting the amplification product with an initial vector to obtain a recombinant vector.
The method firstly extracts the genome DNA of the lactobacillus reuteri A4-2, and the method for extracting the genome DNA is not particularly limited, and can be realized by adopting a conventional method for extracting the genome DNA in the field. In the present invention, the concentration of the genomic DNA is preferably 80 to 120 ng/. Mu.L, more preferably 90 to 110 ng/. Mu.L, and still more preferably ng/. Mu.L.
After the genomic DNA is extracted and obtained, the obtained genomic DNA is taken as a template to carry out PCR amplification to obtain an amplification product; in the invention, the primer pair used for PCR amplification comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3; the method comprises the following specific steps:
an upstream primer:
TAAGAAGGAGATATACATATGGAAATAACAATCAAACG(SEQ ID No.2)；
a downstream primer:
GTGGTGGTGGTGGTGCTCGAGATTTTTTAAAAAGTTAGCTAC(SEQ ID No.3)。
in the present invention, the amplification system for PCR amplification is calculated by 50. Mu.L, and preferably comprises the following components:
the amplification procedure for the PCR amplification is preferably as follows: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 1min, annealing at 58 ℃ for 1min, and extension at 72 ℃ for 1.5min, wherein the denaturation, annealing and extension are carried out for 30 cycles; finally, extension is carried out for 10min at 72 ℃.
After obtaining the amplification product, the present invention preferably further comprises a step of identifying and recovering the amplification product. In the invention, the identification is preferably carried out by agarose gel electrophoresis, then the electrophoresis band is cut and recovered, and the recovered product is sequenced to obtain the gene sequence shown as SEQ ID No. 1.
In the present invention, it is preferable that the electrophoresis band is cut and recovered, and then ligated with an initial vector to obtain a recombinant vector.
In the invention, the connecting system is calculated by 10 mu L and comprises the following components:
in the present invention, the temperature of the joining is preferably 4 ℃ and the time of the joining is preferably 12 hours.
The invention provides a recombinant strain for expressing the gene FAEs, wherein the recombinant strain takes escherichia coli DH5 alpha as a host strain and is transformed with the recombinant vector.
In the present invention, the method for preparing the recombinant strain comprises the following steps: and mixing the ligation product, namely the recombinant vector, with competent cells of Escherichia coli DH5 alpha, carrying out heat shock, and culturing to obtain the recombinant strain. In the present invention, the recombinant vector is preferably mixed with competent cells of E.coli DH 5. Alpha. In a volume ratio of 1: (5-10); in the invention, after the mixing, the mixed system is placed on ice for 25 to 35min, preferably 28 to 32min, and more preferably 30min. In the present invention, the temperature of the heat shock is preferably 42 ℃, and the time of the heat shock is preferably 90s. After the heat shock, the invention is immediately placed on ice for cooling for 1-2 min. In the present invention, the culture preferably uses SOB or LB culture medium, the temperature of the culture is preferably 37 ℃, and the time of the culture is preferably 45-60 min. After the culture, the invention preferably further comprises a step of verifying the recombinant strain, and the step of verifying preferably comprises the steps of coating the cultured recombinant strain on an LB plate containing antibiotics for culture, selecting a single colony for liquid culture, and carrying out colony PCR on the obtained culture solution. The colony PCR step is not particularly limited in the present invention, and a conventional colony PCR step in the art may be employed.
The invention provides gene FAEs for coding feruloyl esterase, a recombinant vector and application of a recombinant strain in preparation of feruloyl esterase.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
A bacterial strain for producing feruloyl esterase is Lactobacillus reuteri A4-2 with the preservation number of CGMCC No.24966, which is preserved in China general microbiological culture Collection center (CGMCC) at 26 months and 5 months in 2022, and the address of No.3 Hospital No.1 Xilu north Chen of Chaoyang district, beijing City, china.
The lactobacillus reuteri A4-2 strain is separated from pasture silage, and the screening steps are mainly divided into a primary screening process and a secondary screening process, wherein the primary screening process comprises the following steps: lactobacillus reuteri A4-2 strain is finally screened by placing the collected sample in a conical flask containing normal saline, and then separating the lactic acid bacteria by an MRS plate.
Selecting lactobacillus reuteri A4-2, and detecting the activity of the ferulic acid esterase, wherein the specific steps are as follows: collecting thalli after overnight culture of the selected strain, re-suspending the thalli by using normal saline, inoculating the thalli into a fermentation culture medium, carrying out fermentation culture at 37 ℃ for two days with the inoculation amount of 2%, centrifuging, taking the supernatant to obtain a crude enzyme solution, and then detecting the content of ferulic acid released by degrading ferulic acid methyl ester by the crude enzyme solution by using a high performance liquid chromatography to indirectly test the enzyme activity.
The specific detection steps are as follows:
accurately weighing 0.1000g of trans-ferulic acid, dissolving in absolute ethyl alcohol, and fixing the volume to 100ml to obtain a trans-ferulic acid standard solution with the concentration of 1.00mg/ml, wherein 5ml, 10ml, 15ml, 20ml and 25ml are respectively taken from the trans-ferulic acid standard solution as a mother solution to fix the volume to 100ml to obtain the trans-ferulic acid standard solutions with the concentrations of 50, 100, 150, 200 and 250 mug/ml. The resulting mixture was filtered through a 0.22 μm filter and subjected to liquid chromatography. And (4) taking the concentration (mu g/ml) of the ferulic acid as a horizontal coordinate and the peak area as a vertical coordinate, and making a standard curve to obtain a linear regression equation.
2.5ml of the crude enzyme solution is taken to react with an equal amount of MFA solution in a water bath at 30 ℃ for 30min, and the reaction is stopped in a boiling water bath for 10min. Centrifuging at 8000rpm for 10min, and collecting supernatant to obtain enzymatic hydrolysate. The blank control was a boiling inactivated enzyme solution. The ferulic acid content in the enzymolysis solution is determined by High Performance Liquid Chromatography (HPLC), and the chromatographic conditions are as follows: c18 chromatography column (Synergi 4 μm Hydro-RP 80, 250X 4.6 mm); mobile phase: methanol-B1% glacial acetic acid (28; the column temperature is 40 ℃, the detection wavelength is 320nm, the sample injection amount is 10 mu l, and the flow rate is 0.6ml/min.
The results are shown in Table 1.
TABLE 1 Feruloyl esterase relative enzyme Activity
| Strain of bacillus | Enzyme activity (mU/ml) | Enzyme activity (mU/mg) |
| A4-2 | 8.68 | 34.76 |
Example 2
1. Determination of Ferulic acid Standard Curve
Accurately weighing 0.1000g of trans-ferulic acid, dissolving in absolute ethyl alcohol, and fixing the volume to 100ml to obtain a trans-ferulic acid standard solution with the concentration of 1.00mg/ml, wherein 5ml, 10ml, 15ml, 20ml and 25ml are respectively taken from the trans-ferulic acid standard solution as a mother solution to fix the volume to 100ml to obtain the trans-ferulic acid standard solutions with the concentrations of 50, 100, 150, 200 and 250 mug/ml. The resulting mixture was filtered through a 0.22 μm filter and subjected to liquid chromatography. And (3) taking the concentration mu g/ml of the ferulic acid as a horizontal coordinate and the peak area as a vertical coordinate, and making a standard curve to obtain a linear regression equation.
2. Determination of enzyme Activity
FAE activity was calculated from the FA content released by crude enzyme fluid degradation of MFA. 2.5ml of the crude enzyme solution was reacted with an equal amount of MFA solution in a water bath at 30 ℃ for 30 minutes, and the reaction was terminated in a boiling water bath for 10 minutes. Centrifuging at 8000rpm for 10min, and collecting supernatant to obtain enzymatic hydrolysate. The blank control was a boiling inactivated enzyme solution. The content of ferulic acid in the enzymatic hydrolysate is determined by High Performance Liquid Chromatography (HPLC), and the chromatographic conditions are as follows: c18 chromatography column (Synergi 4 μm Hydro-RP 80, 250X 4.6 mm; mobile phase: methanol-B1% glacial acetic acid (28; the column temperature is 40 ℃, the detection wavelength is 320nm, the sample injection amount is 10 mu l, and the flow rate is 0.6ml/min.
Definition of enzyme activity: the amount of enzyme required to degrade MFA at 30 ℃ per minute to produce 1. Mu. Mol of FA was one enzyme activity unit (U).
The protein content is measured by Coomassie brilliant blue method and bovine serum albumin to prepare standard protein solution.
Feruloyl esterase specific activity (U/mg) =1 enzyme activity unit (U)/1 mg enzyme protein.
3. Optimum pH and pH stability
The effect of pH on FAE enzyme activity was studied using MFA as a substrate. Determination of optimum pH: mixing the crude enzyme solution with buffers with different pH values (3.6-8) in equal amount, standing at 30 ℃ for 0.5h, and determining the FAE enzyme activity under other conditions, wherein the highest enzyme activity is 100%, and calculating the relative enzyme activity.
Determination of pH stability: and mixing the prepared buffer solutions with different pH values (3.6-8) with the crude enzyme solution in equal amount, placing the buffer solutions in a refrigerator at 4 ℃ for 0, 0.5, 1, 2, 3, 4, 6, 8 and 20 hours, measuring the residual enzyme activity, and calculating the relative enzyme activity by taking the initial enzyme activity of each pH value as 100 percent. The buffer solution is acetic acid-sodium acetate buffer solution with pH of 3.6, 4.0, and 4.6, na with pH of 5.0, 5.6, 6.0, 6.4, and 7.0 2 HPO 4-citric acid buffer, tris-HCl buffer pH 8.0.
4. Optimum temperature and temperature stability
And (3) determining the influence of temperature on the activity of the FAE enzyme of the bacteria by taking MFA as a substrate.
Measurement of optimum reaction temperature: 2.5ml of MFA-containing enzyme solution is mixed with the buffer solution with the optimum pH in equal amount, and after the temperature is kept at 25-65 ℃ (25, 30, 37, 40, 45, 50, 55 and 65 ℃) for 0.5h, the residual enzyme activity is measured. The highest enzyme activity was defined as 100%, and the relative enzyme activities at the remaining temperatures were calculated. Determination of temperature stability: in the most suitable buffer solution, the enzyme solution is respectively placed at the temperature of 25-65 ℃ for 0, 0.5, 1, 2, 3, 4, 6, 8 and 20 hours, the residual enzyme activity is determined, and the relative enzyme activity is calculated by taking the initial enzyme activity as 100 percent.
As shown in FIGS. 1 to 3, the ferulic acid esterase FAE1 of Lactobacillus reuteri A4-2 has the advantages of high specific activity, high enzymolysis efficiency, high stability and the like, and has important application prospects in the fields of medicine and health care, food, feed, biological energy and the like.
Example 3
The method for extracting the feruloyl esterase gene FAEs from the feruloyl esterase producing strain Lactobacillus reuteri A4-2 comprises the following steps:
1) Screening target genes: carrying out analysis and research on the whole genome of Lactobacillus reuteri A4-2 generating feruloyl esterase, comparing conserved structural domains of proteins by BLAST, and screening esterase gene sequences;
2) Target gene verification: respectively designing primers according to the screened esterase gene sequences in the step 1), and verifying the amplified fragments through a sequencing result.
The gene expression vector construction constructs the expression vector of the ferulic acid esterase gene by a molecular cloning technology, and comprises the following steps:
1) Extracting genome DNA by using a genome DNA extraction kit;
2) PCR amplification (50. Mu.l system) was performed on the extracted genomic DNA,
and (3) PCR system:
PCR procedure:
pre-denaturation at 94 ℃ for 5min, (denaturation at 94 ℃ for 1min, annealing at 58 ℃ for 1min) extension at 72 ℃ for 1.5min x 30cycles, and final extension at 72 ℃ for 10min.
And (3) identifying the PCR product:
1) The PCR product was identified by agarose gel electrophoresis, and the results are shown in FIG. 1, lane M is Takara 2000bp DNAmarker, and lanes 1, 2, and 3 are the target genes;
2) Sequencing the PCR product obtained in the step by using a sanger method (sequencing primers are an 'upstream primer' and a 'downstream primer' provided by the invention and are completed by Beijing Rui Boxing Ke Biotechnology Co., ltd.), so as to obtain a nucleic acid sequence of the ferulic acid esterase gene disclosed by the invention, wherein the nucleic acid sequence is shown as SEQ ID NO. 1;
3) The nucleic acid sequence is translated into a protein sequence according to the triplet codon, and the protein sequence is subjected to NCBI Blast alignment search, so that the obtained sequence with the highest homology is a protein sequence recorded under Genbank WP _047822973.1 and has 82.71 percent of amino acid homology.
4) And (3) glue recovery:
the bands of interest in the PCR product of step 1 were recovered by tapping using an Omega gel recovery kit, cat # D2500-01. The concentration of the PCR product of the gene after gel recovery was adjusted to 50 ng/. Mu.l and used as a substrate for the subsequent ligation reaction with the T-vector.
5) A connection system:
6) And (3) conversion of a connecting product:
a. pipette the ligation product (volume 10. Mu.L) into 100. Mu.L of competent cells, mix gently, and place on ice for 30min;
b. placing the centrifuge tube in 42 deg.C water bath, thermally shocking for 90s (strictly controlling thermal shock time), taking out, rapidly placing on ice, and cooling for 2min;
c. adding 5 times volume of SOB (or LB) liquid culture medium into the centrifuge tube, and performing shake culture at 37 ℃ for 60min;
d.8000rpm centrifugates for 30s, removes part of supernatant, leaves 100 microliter of culture solution, blows and evenly mixes the solution by a pipette gun, spreads the solution on an LB plate containing antibiotic resistance by using a triangular coating rod, and inverts the culture dish to culture colonies for 14h at 37 ℃;
e. and selecting a single colony, inoculating the single colony into a resistant LB liquid culture medium, shaking the single colony at 37 ℃ for overnight culture, and carrying out colony PCR verification.
The colony PCR verification results are shown in FIG. 5, where wells 1-12 are all single clones picked on the same plate, and lane 8 is false positive.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Claims (6)
1. A gene FAEs for coding feruloyl esterase, which is characterized in that the nucleotide sequence of the gene FAEs for coding feruloyl esterase is shown as SEQ ID No. 1.
2. A recombinant vector for expressing the gene FAEs of claim 1, comprising an initial vector and the gene FAEs of claim 1.
3. The method for producing the recombinant vector according to claim 2, comprising the steps of:
1) Extracting the genome DNA of the lactobacillus reuteri A4-2;
2) Performing PCR amplification by using the genomic DNA obtained in the step 1) as a template to obtain an amplification product;
3) Connecting the amplification product with an initial vector to obtain a recombinant vector;
the primer pair used in the PCR amplification of the step 2) comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3;
the Lactobacillus reuteri A4-2 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation number is CGMCC No.24966.
4. The method according to claim 3, wherein the PCR-amplified amplification system of step 2) comprises the following components in 50 μ L:
the PCR amplification procedure described in step 2) is as follows: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 1min, annealing at 58 ℃ for 1min, and extension at 72 ℃ for 1.5min, wherein the denaturation, annealing and extension are carried out for 30 cycles; finally, extension is carried out for 10min at 72 ℃.
5. A recombinant strain expressing the gene FAEs of claim 1, wherein the recombinant strain is a host strain of Escherichia coli DH5 a transformed with the recombinant vector of claim 2.
6. Use of gene FAEs encoding feruloyl esterase according to claim 1, recombinant vector according to claim 2 or recombinant strain according to claim 5 for the preparation of feruloyl esterase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310171404.6A CN115976073A (en) | 2023-02-28 | 2023-02-28 | Gene FAEs for coding feruloyl esterase, recombinant vector, recombinant strain and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310171404.6A CN115976073A (en) | 2023-02-28 | 2023-02-28 | Gene FAEs for coding feruloyl esterase, recombinant vector, recombinant strain and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115976073A true CN115976073A (en) | 2023-04-18 |
Family
ID=85961096
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310171404.6A Pending CN115976073A (en) | 2023-02-28 | 2023-02-28 | Gene FAEs for coding feruloyl esterase, recombinant vector, recombinant strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115976073A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9416354B1 (en) * | 2015-02-24 | 2016-08-16 | The United States Of America, As Represented By The Secretary Of Agriculture | Ferulate esterase isolated from Lactobaccillus fermentum |
| CN112358999A (en) * | 2020-11-26 | 2021-02-12 | 中国农业大学 | Lactobacillus reuteri and application thereof |
-
2023
- 2023-02-28 CN CN202310171404.6A patent/CN115976073A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9416354B1 (en) * | 2015-02-24 | 2016-08-16 | The United States Of America, As Represented By The Secretary Of Agriculture | Ferulate esterase isolated from Lactobaccillus fermentum |
| CN112358999A (en) * | 2020-11-26 | 2021-02-12 | 中国农业大学 | Lactobacillus reuteri and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| AN, X.等: ""Limosilactobacillus reuteri strain N3 scaffold69, whole genome shotgun sequence, VRYJ01000068.1"", NCBI GENBANK * |
| ZHENSHANG XU, 等: ""Comparison of enzyme secretion and ferulic acid production by Escherichia coli expressing different Lactobacillus feruloyl esterases"", FRONT. MICROBIOL., pages 1 * |
| 安晓娜 等: "比较基因组学分析不同来源罗伊氏乳杆菌基因多样性及生境适应性", 微生物学报, pages 1 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101558166B (en) | Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose | |
| KR102345899B1 (en) | Methods for generating bacterial hemoglobin libraries and uses thereof | |
| CN112813051B (en) | Low Wen Waiqie inulase mutant MutP124G with improved thermal adaptability and application | |
| KR102345898B1 (en) | Methods for generating glucose permeabilization enzyme libraries and uses thereof | |
| CN103361326B (en) | Partial glyceride lipase mutant with improved thermal resistance, mutant plasmid, recombination strain and preparation method | |
| CN109402087B (en) | Novel feruloyl esterase and preparation method and application thereof | |
| CN112899177B (en) | Recombinant yarrowia lipolytica expressing myrosinase TGG4 and application thereof | |
| CN104212757A (en) | Method for high-efficiently producing L-theanine through production of coli [gamma]-glutamylmethylamine synthetase with escherichia coli | |
| CN115976073A (en) | Gene FAEs for coding feruloyl esterase, recombinant vector, recombinant strain and application | |
| CN104878030B (en) | A kind of alginate lyase SHA-3 genes and its prokaryotic expression carrier | |
| CN104878031B (en) | A kind of alginate lyase SHA-2 genes and its expression vector | |
| CN113355334B (en) | Corn salt-tolerant gene and application thereof | |
| CN106929425B (en) | High-temperature-resistant acidic thermoascus thermophilus cellulase, and preparation method and application thereof | |
| CN102898512A (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN108265065A (en) | A kind of recombination 1 allergoid albumen of artemisia annua and its application | |
| CN116790544A (en) | Glycosyltransferase PpUGT5 for biosynthesis of rhizoma paridis saponin | |
| JP6103584B2 (en) | Filamentous fungal mutants in which the cre1 gene does not function | |
| CN113817758A (en) | Chitosan enzyme gene for encoding Bacillus belgii, chitosanase, preparation method and application thereof | |
| CN106701805B (en) | Encoding gene of endogenous β -glucosidase, encoded protein, expression vector and application thereof | |
| CN103562216A (en) | Enhanced fermentation of cellodextrins and beta-D-glucose | |
| KR101350955B1 (en) | Novel exoglucanase and the Use thereof | |
| CN105368802A (en) | Salt-tolerant esterase, coding gene of salt-tolerant esterase and application of salt-tolerant esterase | |
| CN112646797A (en) | Method for heterogeneously expressing stropharia rugoso-annulata beta-glucosidase gene | |
| Su et al. | Development and application of a novel screening method and experimental use of the mutant bacterial strain Clostridium beijerinckii NCIMB 8052 for production of butanol via fermentation of fresh cassava | |
| CN105255922B (en) | A kind of alginate lyase SHA-5 genes and its prokaryotic expression carrier |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |