CN112358999A

CN112358999A - Lactobacillus reuteri and application thereof

Info

Publication number: CN112358999A
Application number: CN202011357177.9A
Authority: CN
Inventors: 马曦; 吴建民; 王娴; 赵莹; 鲁琳
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2020-11-26
Filing date: 2020-11-26
Publication date: 2021-02-12
Anticipated expiration: 2040-11-26
Also published as: CN112358999B

Abstract

The invention relates to the technical field of probiotics, and particularly relates to lactobacillus reuteri and application thereof. The invention provides Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12, which is preserved in the China general microbiological culture Collection center with the preservation number of CGMCC No. 20121. The lactobacillus reuteri SLZX19-12 can be fixedly planted in the animal body and has strong acid resistance and cholate resistance; has better inhibiting effect on escherichia coli and salmonella; can produce feruloyl esterase, promote the release and digestion of fiber in the feed in the digestive tract; the lactobacillus reuteri SLZX19-12 is prepared into a microbial inoculum and fed to animals, so that the intestinal flora can be improved, the intestinal immunity can be improved, the intestinal health can be improved, and the effect is safe and reliable.

Description

Lactobacillus reuteri and application thereof

Technical Field

The invention relates to the technical field of probiotics, and particularly relates to lactobacillus reuteri and application thereof.

Background

With the widespread use of antibiotics, their drawbacks in animal husbandry have gradually emerged. The biggest disadvantage of the use of antibiotics is the generation of drug-resistant strains, and then a series of problems such as drug residues, disturbance of human and animal intestinal flora, endogenous infection and double infection of livestock and poultry, public environmental pollution and the like. The overuse of antibiotics poses serious threats to human health, and has attracted extensive attention and attention worldwide. The method has important significance in finding green, safe, efficient and nontoxic antibiotic substitutes.

Currently, probiotics have a history of only a short 20 years in the feed industry, but show great potential in breeding and disease treatment. The probiotics play an important role in promoting the growth of animals, enhancing the immunity of organisms, resisting bacterial infection, regulating the microecological balance of intestinal tracts and the like, and is an ideal antibiotic substitute.

Lactobacillus is one of the core genera of porcine intestinal flora. Lactobacillus reuteri (Lactobacillus reuteri), also known as Lactobacillus reuteri. The lactobacillus reuteri fed to animals can increase diversity of intestinal flora of piglets, improve the antioxidant property and unsaturated fatty acid metabolism of organisms, promote proliferation of intestinal epithelial cells, repair intestinal mucosa injury, inhibit the injury of escherichia coli and citrobacter to intestinal tracts, and reduce morbidity and mortality.

Escherichia coli (also known as Escherichia coli) was discovered by Escherichia in 1885. Escherichia coli is a conditional pathogen widely existing in intestinal tracts, and can cause tissue and organ infection of human and various animal gastrointestinal tracts and the like when flora imbalance or exogenous pathogenic bacteria attack in the intestinal tracts. Salmonella (Salmonella) is a common food-borne pathogenic bacterium, and comprises a plurality of serotypes which respectively infect human beings, livestock, mice and poultry, and the common serotypes comprise Salmonella choleraesuis, Salmonella typhimurium, Salmonella paratyphi and the like.

Disclosure of Invention

The invention aims to provide a Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 which has the functions of resisting acid and bile salt, inhibiting bacteria, producing ferulic acid esterase and improving animal intestinal flora and intestinal health.

The invention provides Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12, which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms (CGMCC for short, the address: No. 3 of West Lu 1 of Beijing city sunward area, Microbiol research institute of China academy of sciences, postal code 100101) 6.22.2020, and is classified and named as Lactobacillus reuteri with the preservation number of CGMCC No. 20121.

Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 was isolated from Tibetan pig feces of Tibetan pig Breeding Cooperation, Xizang, Shannan City, Longzi county, Xizang autonomous region.

The microbiological properties of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 are as follows:

(1) colony morphology: the diameter of a single colony is about 1-2 mm, the color is white and opaque, the surface of the colony is smooth and slightly convex, and the edge is regular.

(2) Bacterial morphology after staining: gram positive, short rod-like, without flagellum, no movement.

(3) Growth characteristics: culturing in MRS liquid culture medium at 37 deg.C for 4h to start logarithmic growth phase and 14h to plateau phase with maximum viable count of 1 × 10⁸CFU/mL。

The invention provides a microbial inoculum containing Lactobacillus reuteri (Lactobacillus reuteri) SLZX 19-12.

The microbial inoculum can be a liquid microbial inoculum or a solid microbial inoculum, and can be prepared by adding auxiliary materials allowed in the field of microbial preparations by adopting conventional technical means.

The invention also provides a fermentation product of Lactobacillus reuteri (Lactobacillus reuteri) SLZX 19-12.

Experiments prove that the Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 has higher tolerance to acid and bile salt, can generate ferulic acid esterase, can effectively inhibit pathogenic microorganisms, can fix the plants in animal bodies, has good probiotic potential, and can improve the intestinal flora and the intestinal health.

Based on Lactobacillus reuteri, the invention also provides an animal feed additive or animal feed, which contains or is prepared from Lactobacillus reuteri SLZX 19-12.

The invention also provides a medicament which contains the Lactobacillus reuteri SLZX19-12 or is prepared from the Lactobacillus reuteri SLZX 19-12.

The animal feed additive, the animal feed or the medicament can be prepared from Lactobacillus reuteri (SLZX 19-12), and specifically, can be prepared from Lactobacillus reuteri (SLZX 19-12) fermented thalli or fermented products.

The animal feed additive or the medicament has any one of the following functions:

(1) inhibiting pathogenic microorganisms;

(2) the digestion and utilization capacity of the animals on the fiber in the feed is improved;

(3) increase the diversity of animal intestinal flora;

(4) improving the intestinal immunity of animals;

(5) improving the intestinal health of animals.

The pathogenic microorganism described in (1) above may be a bacterium or a fungus.

Preferably, the pathogenic microorganism is a bacterium. More preferably gram negative bacteria.

As an embodiment of the present invention, the pathogenic microorganism is escherichia coli or salmonella.

The invention provides application of the Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 or the microbial inoculum in preparation of animal feed additives, animal feed or medicaments.

In the above-mentioned use, the animal feed additive or the medicament has any one of the following functions:

(1) inhibiting pathogenic microorganisms;

(3) increase the diversity of animal intestinal flora;

(4) improving the intestinal immunity of animals;

(5) improving the intestinal health of animals.

Experiments prove that the Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 can secrete ferulic acid esterase which can promote the release and digestive utilization of fibers in feed in intestinal tracts.

The invention also provides the application of the Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 or the microbial inoculum in preparing ferulic acid esterase.

The invention has the beneficial effects that: the Lactobacillus reuteri (SLZX 19-12) strain is obtained by separating the Tibetan pig manure, can resist acid and bile salt, is fixedly planted in an animal body, has good probiotic potential, has strong inhibiting effect on pathogenic microorganisms such as escherichia coli and salmonella, can secrete feruloyl esterase, promotes digestion of fibers in feed, and promotes intestinal health.

The invention further verifies the influence of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 on the health of animal intestinal tracts, establishes an injury model by taking Salmonella typhimurium as a pathogenic bacterium, and finds that the strain can enhance the prevention effect of the mouse intestinal tracts on the Salmonella, increase the diversity of the mouse intestinal flora, increase the abundance of colon beneficial bacteria, inhibit the proliferation and translocation of harmful bacteria and protect the health of organisms.

Drawings

FIG. 1 is a colony morphology of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) in example 1 of the present invention.

FIG. 2 is a gram-stained microscopic image of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) in example 1 of the present invention.

FIG. 3 is a growth curve of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) in example 2 of the present invention.

FIG. 4 shows the viable cell count result of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) in example 2 of the present invention.

FIG. 5 shows the results of acid resistance detection of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) in example 2 of the present invention.

FIG. 6 shows the results of detection of bile salt resistance of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) in example 2 of the present invention.

FIG. 7 shows the result of detecting the decomposition of ferulic acid ethyl ester by Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) fermentation broth in example 2 of the present invention.

FIG. 8 shows the results of the biochemical identification test of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) in example 2 of the present invention.

FIG. 9 shows the result of detection of the enzyme activity of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) API-ZYM in example 2 of the present invention.

Fig. 10 is a graph showing the change in body weight after the administration of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) in example 3 of the present invention, wherein Con represents the control group, SL1344 represents the SL1344 group, and H _ l.reuteri + SL1344 represents the H _ l.reuteri + SL1344 group.

FIG. 11 is the organ index of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12(CGMCC No.20121) after administration in example 3 of the present invention.

FIG. 12 is a graph showing PCoA of intestinal microorganisms in mice of different test groups in example 3 of the present invention.

FIG. 13 is a diagram showing the analysis of differences in colony composition at the genus level of colonic microorganisms from different test groups in example 3 of the present invention.

FIG. 14 shows the measurement results of short-chain fatty acid content in feces of different test groups in example 3 of the present invention.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Example 1 isolation and characterization of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12

First, separation of the Strain SLZX19-12

Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 is separated from Tibetan pig feces of Tibetan pig breeding cooperative, belonging to Longzi county of south City of Shannan of Tibetan autonomous region, the specific separation method is as follows:

1. strain separation: taking 3g of Tibetan pig manure sample, carrying out gradient dilution by using sterile normal saline, selecting 0.1mL of diluent with proper dilution degree to contain 0.5 percent of light CaCO₃Uniformly coating the MRS agar, carrying out anaerobic culture at 37 ℃ for 48h, randomly selecting single colonies on a plate according to the size of a calcium dissolving ring and the colony morphology (size, color and the like), numbering, inoculating to an MRS solid plate, and streaking, purifying and culturing.

2. Primary screening: and (3) selecting a single colony, inoculating the single colony into an M-MRS test tube, placing the test tube in an anaerobic workstation, culturing for 48 hours at 37 ℃, observing the consumption condition of a test tube substrate, and measuring the content of the residual soluble starch in the supernatant.

3. Re-screening: and (3) centrifuging the lactobacillus liquid with the primary starch hydrolysis capacity to remove bacteria, determining the content of lactic acid in the supernatant by using an LD-lactic acid kit, and carrying out the operation steps according to the instruction.

The growth, starch content and lactic acid content of some strains tested during the screening process are shown in Table 1.

TABLE 1 starch and lactic acid content of the strains

Secondly, morphology and 16S rDNA identification of strains

The strain SLZX19-12 obtained by the above separation is subjected to morphology and 16S rDNA identification

1. The colony morphology of the strain on the culture dish is observed, and the size, the color, the transparency, the colony surface state and the colony edge state of the formed colony are described. The diameter of the single colony obtained by screening is about 1-2 mm, the color is white and opaque, the surface of the colony is smooth and slightly convex, and the edge is regular (figure 1).

2. The strain SLZX19-12 was gram-stained, and the morphology of the cells was observed by an optical microscope. The strain SLZX19-12 is a gram-positive bacterium, and is in the shape of a short rod with two blunt ends, and has no flagella and no movement (figure 2).

3. Single colonies of strain SLZX19-12 were picked and tested using bacterial universal primer 27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT, and after colony PCR amplification, the obtained product is sent to 16S rDNA sequencing and identification of biological engineering (Shanghai) GmbH. The 16S rDNA sequence of SLZX19-12 was aligned with the 16S rDNA sequences of all the determined bacteria in the database at NCBI, and the SLZX19-12 strain had the highest homology with the 16S rDNA sequence of Lactobacillus reuteri DSM 20016 of Lactobacillus, which was 99.72%, and the species was determined to be Lactobacillus reuteri (Lactobacillus reuteri).

The test result shows that the bacterium is lactobacillus reuteri. The strain is preserved in China general microbiological culture Collection center (CGMCC for short, the address is No. 3 of West Lu No. 1 of Beijing, south China, institute of microbiology, China academy of sciences, zip code 100101) in 22 days 6 years 2020, and is classified and named as Lactobacillus reuteri with the preservation number of CGMCC No. 20121.

Example 2 characterization of Lactobacillus reuteri SLZX19-12

Activating the seed liquid: inoculating Lactobacillus reuteri SLZX19-12 into sterilized MRS liquid culture medium, anaerobically standing at 37 deg.C for 14 hr, and taking out.

1. Growth Curve determination

And (3) absorbing a quantitative bacterial liquid from the seed liquid according to the inoculation amount of 1 percent, inoculating the bacterial liquid into an MRS liquid culture medium, placing the MRS liquid culture medium into an anaerobic workstation, and standing and culturing at 37 ℃. Measuring the OD of the fermentation liquor at intervals of 2h by using a microplate reader₆₀₀And preserving the fermentation liquor of each time period, and counting the viable bacteria.

The results show (FIGS. 3 and 4) that the strain L.reuteri SLZX19-12 enters the logarithmic growth phase at 4h and the plateau phase at 14h, and the maximum viable count reaches 1X 10⁸CFU/mL。

2. Acid resistance detection

Inoculating the seed culture solution of Lactobacillus reuteri SLZX19-12 into physiological saline with pH of 2.0, 3.0 and 4.0 respectively according to 1% inoculation amount, measuring viable count at 0h, 1h, 2h, 3h and 4h respectively by adopting a plate pouring method, and calculating the survival rate of bacteria.

The results show (FIG. 5) that the pH4 environment has less influence on the survival rate of Lactobacillus reuteri SLZX 19-12; the survival rate of the lactobacillus reuteri SLZX19-12 is more than 60 percent in 4 hours under the environment of pH 3; the influence of the lactobacillus reuteri SLZX19-12 in the environment with the pH value of 2 is large, the survival rate after 1 hour is about 49.9 percent, the survival rate after 2 hours is about 21.3 percent, and the bacteria basically die after 3 hours. The results show that the Lactobacillus reuteri SLZX19-12 has good acid resistance and can survive for 2-3 hours in an acid environment with the pH value of 2.

3. Bile salt resistance detection

The seed culture solution of the lactobacillus reuteri SLZX19-12 is respectively inoculated into physiological saline with the concentration of pig bile salt of 0.1, 0.2, 0.3 and 0.4g/100mL according to the inoculation amount of 1 percent, and the viable count is measured by adopting a plate pouring method after 4 hours.

The results show (FIG. 6) that the survival rates of Lactobacillus reuteri SLZX19-12 were about 13.3%, about 1.4% and about 1% at bile salt concentrations of 0.1, 0.2, 0.3 and 0.4g/100mL after 4h, respectively, while the survival rate of Lactobacillus reuteri was 0 at bile salt concentration of 0.4g/100 mL. The results show that the lactobacillus reuteri has certain bile salt resistance.

4. Detection of bacteriostatic ability

The pathogenic indicator bacteria are selected from Escherichia coli (E.coli) K88, K99, O157, 987P, Salmonella Pullorum (S.Pullulum) CVCC1791, Salmonella typhimurium (S.typhimurium) SL1344, Staphylococcus aureus (S.aureum) CVCC1881, and Citrobacter rodentium (C.rodentium) DBS 100.

Inoculating the seed liquid of the strain of lactobacillus reuteri SLZX19-12 into a liquid culture medium in an inoculation amount of 1%, culturing at 37 ℃ for 24h, taking a certain amount of bacterial liquid, centrifuging, taking supernatant, filtering and sterilizing the supernatant by using a 0.22 mu m microporous filter membrane, and uniformly mixing the residual bacterial precipitates with sterile normal saline in the same volume for later use.

The antibacterial activity of the strain is determined by an Oxford cup antibacterial method, Doxycycline Hydrochloride (Doxycycline Hydrochloride) with the content of 0.1mg/mL is prepared as a positive control, and sterile normal saline is prepared as a blank control. Adding 200 μ L of antibiotic solution, normal saline, sterile supernatant, and mixed bacteria solution into Oxford cup, respectively, and culturing in 37 deg.C incubator for 12-18 h. And measuring the size of the bacteriostatic zone by using a vernier caliper and evaluating the bacteriostatic effect. The results show (Table 2) that Lactobacillus reuteri SLZX19-12 has strong inhibitory effect on Escherichia coli K99, Salmonella pullorum CVCC1791 and Salmonella typhimurium SL 1344.

TABLE 2 results of the bacteriostatic test

5. Feruloyl esterase activity detection

Detecting whether the lactobacillus reuteri SLZX19-12 secretes ferulic acid esterase by adopting an agar diffusion method: 10.0g of tryptone, 5g of yeast powder, 15mL of 10% (g/mL) ferulic acid ethyl ester DMSO solution, 2.0g of triammonium citrate, 0.58g of magnesium sulfate, 0.25g of manganese sulfate, 3.12g of sodium acetate, 1.63g of disodium hydrogen phosphate, 2.25g of potassium acetate, 801 mL of tween, 1000mL of distilled water, 20.0g of agar, sterilization at 120 ℃ for 20 minutes, cooling to prepare the agar diffusion medium containing ferulic acid ethyl ester, and perforating by using an Oxford cup.

After the fermentation liquid of the lactobacillus reuteri SLZX19-12 strain is centrifuged, 200 mu L of supernatant is added into a hole of an agar diffusion medium containing ferulic acid ethyl ester, the mixture is kept stand for 36 hours at the temperature of 37 ℃, the culture medium is observed to find that the ferulic acid ethyl ester is hydrolyzed, and a transparent ring is formed at the periphery of the hole (figure 7), thereby proving that the lactobacillus reuteri can produce the ferulic acid esterase.

Inoculating Lactobacillus reuteri SLZX19-12 strain to the liquid culture medium containing ferulic acid ethyl ester, standing and culturing at 37 ℃ for 72 hours, centrifuging at 7500 Xg for 10min to collect thalli, repeatedly washing and centrifuging the bacteria for 3 times by using phosphate buffer solution with pH7.0, resuspending the bacteria by using 1mL phosphate buffer solution with pH7.0, carrying out ultrasonic crushing, centrifuging at 4 ℃ and 10000 Xg for 10min, and collecting supernatant, thus obtaining the prepared crude enzyme solution. And (3) taking ferulic acid ethyl ester as a substrate, and carrying out enzyme activity test. The reaction system is 1mL, and consists of 100 μ L DMSO solution containing 10mmol/L ferulic acid ethyl ester, 500 μ L0.1 mol/L sodium phosphate buffer solution with pH7.0 containing 2.5% (V/V) Triton X-100, and 400 μ L crude enzyme solution, which is pre-warmed at 39 ℃ for 15 minutes, and the whole reaction system is placed at 39 ℃ for reaction for 45 minutes. The yield of ferulic acid after the completion of the reaction was determined by liquid phase using a 0-50% linear gradient of methanol and 50mM sodium acetate solution (pH4.0) as mobile phase, C18(4.6 mM. times.25 cm; Water, USA) as column for 20 minutes at a flow rate of 1.0 mL/min and a detection wavelength of 320 nm. And (4) using the ferulic acid standard to prepare a standard curve, and detecting the protein concentration of the sample by using a BCA method. The enzyme activity is defined as that the enzyme quantity required for degrading ferulic acid ethyl ester to generate 1 mu mol of ferulic acid per minute is 1 enzyme activity unit U under the conditions of 39 ℃ and pH7.0. Detection shows that the unit of the activity of the ferulic acid esterase produced by the lactobacillus reuteri in the crude enzyme solution reaches 51.8mU/mg protein.

6. Biochemical identification test

Lactobacillus reuteri SLZX19-12 was inoculated into a biochemical identification tube and anaerobically cultured at 37 ℃ for 24 hours after completion of inoculation. As shown in FIG. 8, Lactobacillus reuteri SLZX19-12 was able to utilize cellobiose, maltose, sucrose, raffinose, and lactose as fermentation substrates.

7. API-ZYM enzyme activity detection

Lactobacillus reuteri SLZX19-12 was added to the wells of the test strip at 65. mu.L/well and the reaction was recorded after incubation at 37 ℃ for 4 h. As shown in FIG. 9, Lactobacillus reuteri SLZX19-12 was able to express alkaline phosphatase, lipase C4, lipase-like enzymes, leucine arylamine enzymes, valine arylamine enzymes, acid phospholipase enzymes, naphthol-AS-BI-phosphate hydrolase, α -galactosidase, α -glucosidase.

Example 3 Effect of Lactobacillus reuteri SLZX19-12 on intestinal health in mice

First, experiment method

1. Selecting about 12g of 18C 57BL/6J male mice, randomly dividing into three groups (Con group as control group, and sterile normal saline is administered, SL1344 group as pathogenic bacteria group, and sterile normal saline is administered on days 1-14, and 1 × 10 is administered on day 15⁶CFU/mL salmonella SL1344 bacterial liquid; the H _ L.reuteri + SL1344 group is a lactobacillus reuteri SLZX19-12 prevention group, and the drenching concentration on the 1 st to 14 th days is 1 × 10⁹CFU/mL Lactobacillus reuteri solution taken by drenching 1 × 10 on day 15⁶CFU/mL salmonella SL1344 bacterial solution), 6 mice per group.

2. The intragastric administration mode: gavage is performed for 1 time every two days on days 1-14, 200 μ L of Salmonella typhimurium is performed for each time, gavage is performed for 200 μ L of Salmonella typhimurium for 15 days, and chyme and tissue samples are collected after 7 days.

The laboratory mouse room controls the constant temperature and humidity, the natural illumination, the mouse freely takes food and drinks water, and the mouse cage is cleaned once every 7 days. During the test, the state, survival condition, presence or absence of clinical abnormality and the like of the mice were observed and recorded every day.

Secondly, detecting indexes:

1. during the test period, the body weight of the mice was counted daily.

2. Organ index: the whole liver and spleen were weighed and the liver index ═ liver wet weight/body weight × 100%, and spleen index ═ spleen wet weight/body weight × 100%, respectively, were calculated.

3. Collecting mouse colon chyme, putting the chyme into a 1.5mL centrifuge tube, putting the chyme into liquid nitrogen, quickly freezing the chyme, and then storing the chyme in a refrigerator at the temperature of minus 80 ℃ for analyzing the intestinal flora structure. After total DNA extraction, the samples were sent to Meiji Biomedicine technology, Inc., Shanghai for 16S rDNA sequence analysis.

Third, test results

1. Growth performance: as shown in fig. 10, there was no significant difference in weight gain between the three test groups on days 1 to 5 of the challenge, and the weight of mice in the SL1344 group decreased on day 5, and decreased significantly on days 6 to 7, compared to the control group, and the weight of mice in H _ l.reuteri + SL1344 group began to decrease on day 6 of the challenge, but the weight decrease was significantly lower than that in the SL1344 group.

2. Organ index: as can be seen from fig. 11, (1) the liver index of the SL1344 group was significantly increased compared to the control group, and the liver index of the H _ l. reuteri + SL1344 group was significantly decreased compared to the SL1344 group. (2) Spleen index was significantly increased in SL1344 group compared to control group, and spleen index was significantly decreased in H _ l. reuteri + SL1344 group compared to SL1344 group. This result preliminarily indicates that pre-administration of high dose of Lactobacillus reuteri SLZX19-12 is effective in preventing the Salmonella typhimurium SL1344 from causing excessive immune response.

3. FIGS. 12-13 show the results of sequencing analysis of gut microbes. Principal axis analysis (PCoA) is a common diversity analysis method, which visualizes the similarity and difference between data, and observes the difference degree between groups through the distance on the graph. As shown in fig. 12, feeding lactobacillus reuteri SLZX19-12 had a significant effect on the mouse gut microbiome, gut microbiome H _ l.reuteri + SL1344 group was distant from SL1344 group, while the sample H _ l.reuteri + SL1344 was substantially consistent with the Con group profile. The result shows that the feeding of the lactobacillus reuteri SLZX19-12 can prevent intestinal microbial disorder caused by pathogenic bacteria invasion and improve the stability and the anti-stress capability of mouse intestinal tracts.

At the level of the intestinal microorganisms, the genus Muribacteae, Prevotella, Exkermansia, Musulaceae, unidentified-Musulillum, Prevotella, Arthrobacter, Bacteroides, Mucistillus, Runtia, Dubosiella, Mucistilum, Blautia, Salmonella, etc. are mainly included. Analysis of species abundance differences at the genus level, as shown in fig. 13, revealed that salmonella drenched in group SL1344 decreased the abundance of muribacteriaceae, Dubosiella, increased the abundance of lachnospiraceae, leptospira, and the abundance of ruminococcus as compared to group Con; compared with the SL1344 group, the H _ L.reuteri + SL1344 group which is irrigated with the lactobacillus reuteri in advance can obviously improve the abundance of Murebacteriaceae, Prevotella and Dubosiella, but the abundance of the lachnospiraceae, Exxomyces and Ruminococcus is not obviously different. The result shows that the lactobacillus reuteri SLZX19-12 can effectively prevent intestinal flora imbalance caused by salmonella drenching and enhance the stability of the intestinal flora.

Analysis of short chain fatty acid content in mouse feces, as shown in fig. 14, showed that salmonella gavage group SL1344 reduced lactic acid, acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid levels compared to Con, with significant acetic acid, propionic acid and total short chain fatty acid reduction levels. Whereas, pre-instillation of lactobacillus reuteri + SL1344 group increased lactic acid, acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid levels with significant levels of propionic acid and total short chain fatty acids compared to SL1344 group. The results show that the lactobacillus reuteri SLZX19-12 taken by drenching can prevent the reduction of short chain fatty acid caused by dysbacteriosis consistent with the change trend of the flora.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> Lactobacillus reuteri and application thereof

<130> KHP201117097.8

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

agagtttgat cctggctcag 20

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggttaccttg ttacgactt 19

Claims

1. Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12, which is characterized in that the Lactobacillus reuteri SLZX is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No. 20121.

2. A microbial preparation comprising the Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 according to claim 1.

3. An animal feed additive or animal feed comprising Lactobacillus reuteri (SLZX 19-12) according to claim 1 or prepared from Lactobacillus reuteri (SLZX 19-12) according to claim 1.

4. A pharmaceutical preparation comprising the Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 of claim 1 or prepared from the Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 of claim 1.

5. The medicament of claim 4, wherein the medicament has any one of the following functions:

(1) inhibiting pathogenic microorganisms;

(3) increase the diversity of animal intestinal flora;

(4) improving the intestinal immunity of animals;

(5) improving the intestinal health of animals.

6. Pharmaceutical according to claim 5, characterized in that said pathogenic microorganisms are bacteria, preferably gram-negative bacteria, more preferably E.coli or Salmonella.

7. Use of Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 according to claim 1 or the bacterial agent according to claim 2 for the preparation of an animal feed additive, animal feed or medicament.

8. Use according to claim 7, wherein the animal feed supplement or the medicament has any of the following functions:

(1) inhibiting pathogenic microorganisms;

(3) increase the diversity of animal intestinal flora;

(4) improving the intestinal immunity of animals;

(5) improving the intestinal health of animals.

9. Use according to claim 8, characterized in that said pathogenic microorganisms are bacteria, preferably gram-negative bacteria, more preferably escherichia coli or salmonella.

10. Use of the Lactobacillus reuteri (Lactobacillus reuteri) SLZX19-12 of claim 1 or the microbial inoculum of claim 2 for the preparation of feruloyl esterase.