CN114806978B - Lactobacillus johnsonii SXDT-23 and application thereof - Google Patents

Abstract

The invention relates to the field of microorganisms, in particular to lactobacillus johnsonii SXDT-23 and application thereof. The invention separates and obtains the lactobacillus johnsonii from the horse body pig manureLactobacillus johnsonii) SXDT-23, the strain has good inhibition effect on escherichia coli and salmonella; can be planted in animal bodies, and has strong tolerance to artificial bile salts, artificial gastric acid and artificial intestinal juice; can promote animal growth, improve colon inflammation, reduce diarrhea rate, improve intestinal immunity, and improve intestinal health.

Description

Lactobacillus johnsonii SXDT-23 and application thereof

Technical Field

The invention relates to the field of microorganisms, in particular to lactobacillus johnsonii SXDT-23 and application thereof.

Background

Stress caused by early weaning is mainly expressed as diarrhea of piglets, so that the growth performance of the piglets is reduced, and the death rate is improved. Although antibiotics have significantly improved the therapeutic effect of diarrhea in the past decades, the generation, spread and residue of antibiotics in foods, which often lead to resistant strains, have become a serious problem. Thus, many countries are gradually banning the use of antibiotics in animal production. However, disability results in a dramatic increase in the incidence of diarrhea and mortality in piglets. Thus, there is an urgent need to develop a green, safe, efficient, non-toxic treatment for diarrhea.

At present, the search for antibiotic substitutes has become a research hotspot in the livestock industry, where probiotics have great potential for replacing antibodies. The probiotics play an important role in promoting animal growth, enhancing organism immunity, resisting infection of digestive tracts, regulating intestinal microecological balance and the like.

Lactic acid bacteria are the core flora in the pig intestine, and in particular in healthy local pigs, a large enrichment often occurs. Wherein lactobacillus johnsonii is used as resident of animal intestinal canal, which can effectively inhibit pathogenic microorganism from growing in intestinal canal, improve animal intestinal canal immunity, relieve animal colon inflammation, reduce animal diarrhea and death rate, improve animal intestinal canal health, and improve animal growth performance.

Disclosure of Invention

The invention aims to provide lactobacillus johnsoniiLactobacillus johnsonii)SXDT-23。

It is still another object of the present invention to provide the above Lactobacillus johnsoniiLactobacillus johnsonii) Use of SXDT-23.

It is still another object of the present invention to provide a biological agent.

It is a further object of the present invention to provide a feed additive.

Lactobacillus johnsonii of the inventionLactobacillus johnsonii) SXDT-23 with a preservation number of CGMCC No. 24726.

The invention provides a preparation containing Lactobacillus johnsoniiLactobacillus johnsonii) Bacterial agent of SXDT-23. The microbial agent can be liquid microbial agent or solid microbial agent, and can be prepared by adding auxiliary materials allowed in the field of microbial preparations by adopting a conventional technical means.

The invention provides lactobacillus johnsoniiLactobacillus johnsonii) Use of SXDT-23 for the preparation of the following formulations:

inhibiting pathogenic microorganisms;

preparation for promoting animal growth

A formulation for treating colon inflammation;

a diarrhea rate reducing agent; or (b)

A preparation for improving intestinal immunity.

Preferably, the pathogenic microorganism is a bacterium. More preferably gram negative bacteria.

As one embodiment of the present invention, the pathogenic microorganism is E.coli or Salmonella.

The animal feed additive according to the present invention comprises the above Lactobacillus johnsoniiLactobacillus johnsonii) SXDT-23 or Lactobacillus johnsoniiLactobacillus johnsonii) SXDT-23 was prepared.

The above animal feed additive or animal feed can be prepared from Lactobacillus johnsonii SXDT-23, specifically Lactobacillus johnsonii @Lactobacillus johnsonii) And fermenting SXDT-23 to obtain the bacterial cells.

The invention has the beneficial effects that:

the invention separates and obtains the lactobacillus johnsonii from the horse body pig manureLactobacillus johnsonii) SXDT-23, the strain has good inhibition effect on escherichia coli and salmonella; can be planted in animal bodies, and has strong tolerance to artificial bile salts, artificial gastric acid and artificial intestinal juice; establishing a colon inflammation injury model of a mouse by using Dextran Sodium Sulfate (DSS), and finding that the strain can relieve and treat colon inflammation of the mouse and relieve weight reduction and colon length shortening of the mouse caused by the DSS; it was also shown in a feeding trial for piglets of age 7-30 days, lactobacillus johnsonii @Lactobacillus johnsonii) SXDT-23 can obviously reduce diarrhea rate of piglets, can improve 21-day-old and 30-day-old weight of piglets, can promote animal growth, improve colon inflammation, reduce diarrhea rate, improve intestinal immunity and improve intestinal health.

Drawings

FIG. 1 shows Lactobacillus johnsonii in example 2 of the present inventionLactobacillus johnsonii) Growth curve of SXDT-23;

FIG. 2 shows Lactobacillus johnsonii in example 2 of the present inventionLactobacillus johnsonii) Oil microscopic image of SXDT-23 after malachite green staining;

FIG. 3 shows Lactobacillus johnsonii in example 2 of the present inventionLactobacillus johnsonii) SXDT-23; colony morphology map;

FIG. 4 is a diagram showing the implementation of the mouse test protocol in example 3 of the present invention;

FIG. 5 is a graph showing weight change of the test mice in example 3 of the present invention throughout the test period;

FIG. 6 shows the weight change of the test mice in example 3 of the present invention at day 7 after the start of the test;

FIG. 7 shows the weight change of the test mice of example 3 according to the present invention at day 13 after the start of the test;

FIG. 8 shows the weight change of the test mice of example 3 according to the present invention at day 18 after the start of the test;

FIG. 9 shows colon length of test mice in example 3 of the present invention;

FIG. 10 shows colon HE staining patterns and pathology scores according to colon HE staining of test mice in example 3 of the present invention;

FIG. 11 shows weight change of piglets at 21 st and 30 th days of example 4 of the invention;

figure 12 shows the statistics of diarrhea rate of piglets in example 4 of the invention over the whole test period.

Lactobacillus johnsonii(Lactobacillus johnsonii) The strain SXDT-23 is preserved in China general microbiological culture Collection center (CGMCC) for 4 months and 19 days in 2022, and has the classification name of Lactobacillus johnsonii (post code 100101) of the national institute of microbiology, national academy of sciences of China, including North Silu 1, 3, the area of Korea of Beijing, and the address thereofLactobacillus johnsonii）The preservation number is CGMCC No. 24726.

Detailed Description

The following examples are illustrative of the invention and are not intended to limit the scope of the invention.

EXAMPLE 1 Lactobacillus johnsonii ]Lactobacillus johnsonii) Isolation of (C) and 16S rRNA identification

Isolation and identification of lactobacillus johnsonii:

lactobacillus johnsonii(Lactobacillus johnsonii) Is separated from horse body and pig manure in northern four-season pasture in ancient city and town in Qing dynasty county in Dazhou province of Shanxi province.

1. Collecting feces: collecting 1g of feces of 20 fattening pigs, adding 20ml of sterile physiological saline containing 20% glycerol, vortex mixing, and packaging into sterile freezing tubes with 1ml of each tube. After the treatment was completed, the solution was placed in dry ice and returned to the laboratory for storage in a-80 ℃ refrigerator until use.

2. Isolation of strains: taking 1mL of horse body pig manure sample, carrying out 10-time gradient dilution by using sterile normal saline, absorbing 0.1mL of diluent with proper dilution, uniformly coating on MRS agar, culturing at 37 ℃ for 48 hours, and inoculating the grown colony to a new MRS solid culture medium through plate streaking for purifying culture for 48 hours.

3. Enrichment of strains: the purified and cultured strains were inoculated one by one into a sterile MRS broth medium with an inoculating loop on a sterile operating table, placed in a shaking table, cultured at 37℃for 48 hours, subjected to 16S rRNA identification, and the remaining portion was mixed with physiological saline containing 50% glycerol and stored in a-80℃refrigerator.

4. 16S rRNA identification: the enriched bacterial solution was purified using bacterial universal primer 27F: agagttttgatcctggcttag; 1492R: GGTTACCTTGTTACGACTT, performing colony PCR amplification, performing 16S rDNA sequencing identification, and comparing the 16S rDNA sequences of each strain with the 16S rDNA sequences of all bacteria determined in database at NCBI, wherein 6 strains of bacteria belonging to the genus Lactobacillus are foundLactobacillus johnsoniiThe 16S rDNA sequence of DSM20016 has the highest homology, and the 7 strains are determined to be about Lactobacillus johnsoniiLactobacillus johnsonii)。

EXAMPLE 2 Lactobacillus johnsoniiLactobacillus johnsonii) Characteristic detection of (a)

1. Antibacterial ability detection

The pathogen indicator is 2 common pathogens: coli @Escherichia coli) BW25113 and Salmonella typhimuriumSalmonella typhimurium)ATCC14028。

The antibacterial activity of the strain was measured by oxford cup method. Escherichia coli BW25113 and Salmonella typhimuriumSalmonella typhimurium) ATCC14028 was inoculated into LB broth, and cultured in a 37℃incubator for 12-18 hours. Coli is treated with%Escherichia coli) BW25113 and Salmonella typhimuriumSalmonella typhimurium) ATCC14028 strain concentrationThe degrees are respectively adjusted to 1X 10 by using sterile physiological saline ⁸ CFU/mL, respectively, uniformly coating 200 μl of each on LB agar medium, uniformly and lightly placing sterilized oxford cup on LB medium, adding 200 μl of activated bacteria solution with concentration of 1×10 into oxford cup ⁸ CFU/mL of bacteria solution with MRS broth. Placed in a 37℃incubator for 12h of incubation. And measuring the size of the inhibition zone by using a vernier caliper and evaluating the inhibition effect. The results show (Table 1) that compared with the other 6 strains of Lactobacillus johnsonii, lactobacillus johnsonii @Lactobacillus johnsonii) SXDT-23 against Escherichia coliEscherichia coli) BW25113 and Salmonella typhimuriumSalmonella typhimurium) ATCC14028 has strong inhibition effect and obtains the maximum inhibition zone diameter. In the process of treating salmonella typhimuriumSalmonella typhimurium) In the bacteriostatic effect of ATCC14028, the diameter of the bacteriostatic circle of the SXDT-23 strain is obviously higher than that of SXDT-25, SXDT-26 and SXDT-36 (p)<0.05). In the process of treating colibacillusEscherichia coli) In the antibacterial effect of BW25113, the diameter of the antibacterial circle of the SXDT-23 strain is obviously higher than that of SXDT-17, SXDT-25, SXDT-26, SXDT-34 and SXDT-36 (p)<0.05）。

TABLE 1 inhibitory Capacity of Lactobacillus johnsonii against pathogenic bacteria

Strain numbering	Salmonella bacteria	Coli bacterium
			SXDT-17	18.03±0.20 ab	14.16±0.32 c
SXDT-20	17.87±0.40 ab	15.60±0.16 ab
			SXDT-23	18.69±0.54 a	15.85±0.13 a
SXDT-25	14.11±0.22 c	14.31±0.08 c
			SXDT-26	16.48±0.54 b	15.03±0.17 b
SXDT-34	17.78±0.36 ab	14.01±0.13 c
			SXDT-36	16.53±1.11 b	13.74±0.42 c

Note that: the values are the diameter of the inhibition zone, and the unit is mm.

2. Bile salt resistance detection

Activated and the concentration of the bacterial liquid is 1 multiplied by 10 ⁸ 1mL of the bacterial liquid of CFU/mL is inoculated into 9mL of sterile physiological saline with the concentration of pig bile salt of 0.3g/100mL respectively, and after 1h, the number of viable bacteria is measured by adopting a flat plate coating method.

The results show (Table 2) that at a bile salt concentration of 0.3g/100mL, lactobacillus johnsonii @ was compared with the other 6 strains of Lactobacillus johnsonii @Lactobacillus johnsonii) SXDT-23 has the best resistanceBile salt potential, and is significantly higher than other strains (p<0.05 The survival rate can reach about 26.13 percent.

TABLE 2 survival of Lactobacillus johnsonii at 0.3% concentration of Strong bile salts%

Strain numbering	Survival rate
		SXDT-17	3.07±0.47 f
SXDT-20	9.57±0.29 cd
		SXDT-23	26.13±0.99 a
SXDT-25	13.66±1.46 b
		SXDT-26	11.73±0.24 bc
SXDT-34	5.33±0.20 e
		SXDT-36	9.07±0.24 d

3. Artificial gastric juice resistance detection

Activated and bacterial liquidThe concentration is 1X 10 ⁸ 1mL of each CFU/mL bacterial liquid was inoculated into 9mL of artificial gastric juice with pH=1.5, and after 1 hour, the number of viable bacteria was measured by a plate coating method.

The results show (Table 3) that after 1h of artificial gastric juice at pH=1.5, lactobacillus johnsonii @ is @Lactobacillus johnsonii) SXDT-20, SXDT-23 and SXDT-25 have better artificial gastric juice resistance.

Table 3 survival of lactobacillus johnsonii in artificial gastric juice at ph=1.5%

Strain numbering	Survival rate
		SXDT-17	1.62±0.25 d
SXDT-20	11.89±0.36 ab
		SXDT-23	11.46±0.43 b
SXDT-25	13.71±1.47 a
		SXDT-26	10.14±0.21 bc
SXDT-34	3.25±0.12 d
		SXDT-36	8.47±0.38 c

4. Artificial intestinal juice resistant detection

Activated and the concentration of the bacterial liquid is 1 multiplied by 10 ⁸ 1mL of each CFU/mL bacterial liquid was inoculated into 9mL of artificial gastric juice with pH=6.8, and after 4 hours, the number of viable bacteria was measured by a plate coating method.

The results show (Table 4) that after 4 hours of artificial intestinal juice, there are 6 strains of Lactobacillus johnsonii, lactobacillus johnsonii @Lactobacillus johnsonii) SXDT-23 has the best artificial intestinal juice resistance, and the survival rate is obviously higher than that of SXDT-17, SXDT-25, SXDT-26 and SXDT-34 (p)<0.05 The survival rate reaches about 12.98 percent.

TABLE 4 survival rate of Lactobacillus johnsonii in artificial intestinal juice%

Strain numbering	Survival rate
		SXDT-17	1.18±0.14 e
SXDT-20	12.09±0.66 ab
		SXDT-23	12.98±0.42 a
SXDT-25	10.46±0.17 bc
		SXDT-26	9.74±0.83 c
SXDT-34	6.91±0.46 d
		SXDT-36	12.88±0.73 a

5. Growth curve determination

From a concentration of 1X 10 at 1% inoculum size ⁸ A quantitative bacterial solution is sucked from the Lactobacillus johnsonii SXDT-23 bacterial solution of CFU/mL, inoculated into MRS broth culture medium and placed into a shaking table at 37 ℃. Measuring the OD of the fermentation liquor at intervals of 1h by using an enzyme-labeled instrument ₆₀₀ Is a value of (2). The results show (FIG. 1), lactobacillus johnsonii SXDT-23 strain can enter logarithmic phase after 4h, and enter platform phase after 14h, and the maximum viable count reaches 2.7X10 ⁸ CFU/mL。

6. Morphology and colony observation

The cells were smeared on a slide glass and dried, stained with malachite green containing 1% for 3 minutes, slowly rinsed with deionized water after staining was completed, and the excess staining solution was washed off, dried, and then placed under a microscope for observation and photographing, and the result is shown in fig. 2. The colony morphology was observed after streaking the MRS agar medium with the loop of the inoculating solution and culturing at 37℃for 48 hours, and the results are shown in FIG. 3.

Lactobacillus johnsoniiLactobacillus johnsonii) The microbiological properties of SXDT-23 are as follows:

(1) Colony morphology: the single colony presents an irregular round shape with the diameter of about 2-4 mm, presents milky white, semitransparent and regular edges.

(2) The bacteria form after staining is rod-shaped, has no flagella and does not move.

(3) Growth characteristics: placing in MRS liquid culture medium, shake culturing at 37deg.C, starting logarithmic phase after 6 hr, and entering platform phase for 11 hr, with maximum viable count of 1.0X10 ⁸ CFU/mL。

Example 3 influence of Lactobacillus johnsonii SXDT-23 on intestinal health in DSS-model mice

Through the experiments, the Lactobacillus reuteri is determinedLactobacillus johnsonii) The SXDT-23 strain has the best stress-resistant probiotic properties. Therefore, the Lactobacillus reuteri is reservedLactobacillus johnsonii) The SXDT-23 strain was used for the subsequent experiments.

1. Experimental method

1. 36 ICR male mice of 20 days old were selected and kept in animal center of animal science institute of national academy of agricultural sciences. In the test process, the temperature of the rat room is controlled at 21+/-2 ℃, the illumination/darkness time is 12 hours, and the rat room can eat and drink water freely.

2. A model of colon inflammatory injury in mice was established with Dextran Sodium Sulfate (DSS), and all mice were randomized into three groups: con group, DSS group, L.j +DSS group. Con group: during the test, the stomach is irrigated once a day with 0.1ml of physiological saline for 18 days; DSS group: during the test, 0.1ml of physiological saline (NS) was infused once daily for 18 days, and the mice were consumed tap water containing 3% dss for 6 days on days 8-13 of the test; l.j +dss group: during the test, the concentration of 0.1ml per day of gastric lavage was 1X 10 ⁸ CFU/mL of bacterial liquid was used for 18 days, and on days 8-13 of the test, mice were given tap water containing 3% DSS for 6 days. The specific test protocol is shown in FIG. 4. In the test process, the weight of the mice is measured every day, the states of the mice are observed and recorded, the survival condition is present, and clinical abnormal symptoms exist or not. After the test, the colon length was measured and tissue samples were collected, stored in 4% formaldehyde solution for HE staining, the colon morphology of the mice was observed and pathology scored.

2. Experimental results

1. Growth conditions: the change in mouse growth throughout the trial is shown in fig. 5, with no significant differences in mouse body weight between groups on day 7 (fig. 6); on day 13, the Con group mice had significantly higher body weight than the mice of the DSS group and L.j +dss group, with no significant difference in body weight between the L.j +dss group and the DSS group (fig. 7); on day 18, the L.j +dss group mice had no significant difference in body weight from the Con group and were significantly higher than the DSS group (fig. 8).

2. Colon length: as shown in fig. 9, while the Con group had a significant difference in colon length from the L.j +dss group, the L.j +dss group had a significantly higher colon length than the DSS group.

3. Colon morphology and pathology score: as shown in fig. 10, the colon intestinal tract of the DSS mice showed severe inflammatory cell infiltration, the goblet cells were damaged, severe inflammation occurred, and the intestinal tract of the L.j +dss mice showed local inflammation; pathology scores showed that DSS component values were significantly higher than L.j +dss groups.

These results indicate that Lactobacillus johnsonii SXDT-23 strain can well relieve and treat colon inflammation of mice and promote intestinal health.

Example 4 influence of Lactobacillus johnsonii SXDT-23 on intestinal health of piglets

1. Experimental method

40 healthy sows (3-4 years old, 5-6 fetuses) produced in a certain farm in Tangshan in Hebei and the temporary piglets are selected. Before weaning, all sows with nursing piglets are respectively housed in a closed delivery room, and commercial feed and free drinking water are provided. The pigsty environment is kept clean, ventilated and regularly disinfected.

All sows were randomly divided into a control group (Con) and a bacterial fluid fed group (L.j). Each group of 20 sows, and each litter selects 14 piglets. The initial body weights of the two groups of piglets were similar (initial bw=1.73±0.03 kg) and weaned at 21 days of age. Con group: feeding the piglets with commercial creep feed from 7 days of age, so that the piglets can eat freely, and ending the test until 30 days of age; l.j group: starting from 7 days of piglet, the feed for piglet additionally contains 5×10 ¹⁰ CFU/kg Lactobacillus johnsoniiLactobacillus johnsonii) The same brand commercial creep feed of SXDT-23 is allowed to freely feed until the test is finished at 30 days of age. In the test process, the weight of the piglets is measured on days 21 and 30, the states of the piglets are observed and recorded, and the diarrhea rate of the piglets is counted.

2. Experimental results

1. Weight status of piglets: as shown in fig. 11, the weight of the L.j group piglets was higher at 21 days of age than the Con group, and significantly higher at 30 days of age than the Con group.

2. Diarrhea rate: as shown in fig. 12, the diarrhea rate of the L.j group piglets was significantly lower than that of the Con group.

While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Claims (5)

1. Lactobacillus johnsoniiLactobacillus johnsonii) SXDT-23, characterized in that the Lactobacillus johnsonii is ]Lactobacillus johnsonii) The preservation number of SXDT-23 is CGMCC No. 24726.

2. Comprising the Lactobacillus johnsonii of claim 1Lactobacillus johnsonii) Microbial agent of SXDT-23.

3. The microbial agent of claim 2, wherein the microbial agent is a liquid microbial agent or a solid microbial agent.

4. The Lactobacillus johnsonii strain of claim 1Lactobacillus johnsonii) Use of a microbial agent of SXDT-23 for the preparation of:

an agent that inhibits escherichia coli or salmonella;

a formulation that promotes weight gain in an animal;

a formulation for treating colon inflammation;

a formulation for reducing diarrhea rate.

5. An animal feed additive comprising Lactobacillus johnsonii of claim 1Lactobacillus johnsonii) SXDT-23, or from Lactobacillus johnsoniiLactobacillus johnsonii) And fermenting SXDT-23 to obtain the final product.

Images