CN115976032A - Gene for expressing camel lactoferrin antibacterial peptide, antibacterial peptide and application - Google Patents

Abstract

The invention relates to a gene for expressing camel lactoferrin antibacterial peptide, antibacterial peptide and application. The nucleotide sequence of the gene for expressing camel lactoferrin antibacterial peptide is shown in SEQ ID No. 1. The amino acid sequence of the antibacterial peptide is shown in SEQ ID NO. 2. Compared with the prior art, the invention screens out the lactoferrin sequence in the camel body through the NCBI database for the first time and predicts the conserved region in the camel body so as to obtain the nucleotide sequence, and obtains the antibacterial peptide with antibacterial activity through genetic engineering.

Description

Gene for expressing camel lactoferrin antibacterial peptide, antibacterial peptide and application

Technical Field

The invention belongs to the technical field of antibacterial peptides, and particularly relates to a gene for expressing camel lactoferrin antibacterial peptide, antibacterial peptide and application.

Background

Camel lactoferrin peptide CM-1 is a small molecular bioactive peptide obtained by pepsin hydrolysis in an acidic environment, has various biological activities, has good heat resistance, non-antigenicity, immunoregulatory activity, broad-spectrum antibacterial and antiviral activities, and can be widely used as a food preservative, an antioxidant, a nutritional additive and the like. CM-1 molecular weight 3716.33 Da, in the bacteriostatic process, CM-1 amphiphilic structure is combined with membrane lipopolysaccharide, hydrophobic residue interacts with lipophilic part of membrane, so that cell membrane forms perforation, cell content leaks out to play the bacteriostatic and bactericidal action, and drug resistance is not generated.

At present, the influence of antibiotic resistance on human health has serious threat, and the characteristic of no resistance of CM-1 shows that the antibiotic is an antibacterial drug with great potential. In the current situation, some mainstream purification preparation processes such as enzymatic separation and purification are difficult and chemical synthesis methods are expensive, so that the production of antibiotics by using molecular biotechnology has become the mainstream trend.

Disclosure of Invention

The purpose of the invention is as follows: in order to solve the problem of drug resistance in the existing antibacterial drugs, the invention provides a gene for expressing camel lactoferrin antibacterial peptide, the antibacterial peptide and application.

The technical scheme is as follows: in order to achieve the purpose, the invention adopts the following technical scheme:

the invention firstly provides a gene for expressing camel lactoferrin antibacterial peptide, and the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

The invention also provides a bacteriostatic peptide, and the amino acid sequence of the bacteriostatic peptide is coded by the nucleotide sequence shown as SEQ ID NO. 1.

The amino acid sequence of the antibacterial peptide is shown in SEQ ID NO. 2.

The invention also provides a plasmid which contains a nucleotide sequence shown as SEQ ID NO. 1.

Preferably, the plasmid comprises the expression vector pPIC9K.

The invention also provides application of the antibacterial peptide in preparation of an antibacterial agent.

Preferably, the antimicrobial agent is capable of inhibiting staphylococcus aureus and/or escherichia coli.

The invention finally provides a bacteriostatic composition, and the effective component of the bacteriostatic composition comprises the bacteriostatic peptide.

Has the advantages that: compared with the prior art, the invention screens out the lactoferrin sequence in the camel body through the NCBI database for the first time and predicts the conserved region in the camel body so as to obtain the nucleotide sequence, and obtains the antibacterial peptide with antibacterial activity through genetic engineering.

Drawings

FIG. 1 shows the Camelus-F/R fusion band.

FIG. 2 shows the amplified fragment Cam-LF-F/R.

FIG. 3 shows the double restriction enzyme digestion verification of the fragment and the vector.

FIG. 4 shows the verification of the CM-1 small peptide fragment ligation vector.

FIG. 5 shows the validation of the CM-1 small peptide fragment after transfer into yeast.

FIG. 6 shows Tricine-SDS-PAGE protein gel validation of small peptides.

FIG. 7 shows the 3% galactose concentration of E.coli fermented for 1-5 days.

FIG. 8 shows that the D.aureus galactose concentration is 3% and the fermentation is carried out for 1-5 days.

FIG. 9 shows that E.coli galactose concentration was 1-5% fermented for 3 days.

FIG. 10 shows that the D.aureus galactose concentration is 1-5% and the fermentation is carried out for 3 days.

FIG. 11 shows the 3% galactose concentration of E.coli fermented for 3 days.

FIG. 12 shows the fermentation of 3% galactose concentration of Staphylococcus aureus for 3 days.

Detailed Description

The present invention will be described in further detail with reference to specific examples. It is to be understood that the following examples are only illustrative and explanatory of the present invention and should not be construed as limiting the scope of the present invention. All the technologies realized based on the above-mentioned contents of the present invention are covered in the protection scope of the present invention.

Unless otherwise indicated, the raw materials and reagents used in the following examples are all commercially available products or can be prepared by known methods.

Example 1

Camelid in vivo lactoferrin sequences were screened by NCBI database and conserved regions therein predicted:

ser Lys Cys Ala Gln Trp Gln Arg Arg Met Lys Lys Val Arg Gly Pro Ser Val Thr Cys Val Lys Lys Thr Ser amino acid sequences in conserved regions of lactoferrin peptide were converted to base sequences according to NCBI sequence alignment (base and primer synthesis was done by tokensry biotechnology limited, south kyo):

TCAAAATGTGCCCAATGGCAACGGAGGATGAAAAAAGTGCGTGGTCCCTCTGTCACCTGCGTAAAGAAGACATCT

then, designing a fusion primer to perform fusion PCR (with subscript sequence as EcoR1/Not1 enzyme cutting site):

Camelus-F:CCGGAATTCTCAAAATGTGCCCAATGGCAACGGAGGATGAAAAAAGTGCGTGGTCCCTC

Camelus-R:AATAGGATGCGGCCGCAGATGTCTTCTTTACGCAGGTGACAGAGGGACCACGCACTTTTTTCATCCTCCG

Cam-LF-F:CCGGAATTCATGTCAAAATGTGCCCAATGGC

Cam-LF-R:AATAGGATGCGGCCGCAGATGTCTTCTTTAC

the fusion system was as follows (50. Mu.l):

dNTP 5μl

5X Buffer 10μl

Camelus-F 15μl

Camelus-R 15μl

deionized water 4. Mu.l

Star enzyme 1. Mu.l.

dNTP, 5X Buffer and Star enzyme were purchased from Takara Inc., and the procedure was set up with reference to Takara Star enzyme Specification: 5min at 95 ℃; 30s at 95 ℃, 30s TM value 30s, 30min at 72 ℃,15cycs and 7min at 72 ℃. The obtained fragment of about 100bp is used as a template, agarose gel electrophoresis is carried out by taking 2000maker as reference to detect the correctness of a product band, and a PCR product is recovered according to the instruction of the PCR product recovery kit.

Then performing PCR amplification by using Cam-LF-F/Cam-LF-R and high-fidelity enzyme with the upper-round PCR product as a template.

The PCR amplification system was as follows (50. Mu.l):

dNTP 5μl

5X Buffer 10μl

Cam-LF-F 2μl

Cam-LF-R 2μl

deionized water 29. Mu.l

Star enzyme 1. Mu.l

Template 1. Mu.l.

The procedure was set up with reference to Takara Star enzyme Specification: 5min at 95 ℃; 30s at 95 ℃, 30s at TM value, 30min at 72 ℃,35cycs, and 7min at 72 ℃. Obtaining a fragment of about 150bp, detecting the correctness of a product band by agarose gel electrophoresis with 2000maker as reference, and recovering a PCR product according to the instruction of the gel recovery kit.

The PCR recovery product of the amplified target band and the pPIC9K vector were subjected to double digestion with restriction enzymes (purchased from Takara) respectively, and the PCR reaction program was set as follows: 30min at 37 ℃; 5min at 65 ℃. (X was calculated from the recovered concentration and 1000ng was added depending on the measured concentration).

The double enzyme digestion system is as follows:

EcoR I/Not I1. Mu.l each

Vector plasmid template/fragment recovery product X. Mu.l

Buffer 2μl

The deionized water was made up to 20ul.

The double-enzyme digestion fragment and the recovered and purified gel product after gel running of the vector are connected overnight (T4 ligase and Buffer are purchased from Takara company) and are connected for 18h at 16 ℃, and the connection system is as follows:

recovery product of target fragment gel 6. Mu.l

T4DNABuffer 1μl

1. Mu.l of T4DNA ligase

The product was recovered in 2. Mu.l of carrier gel.

The preparation steps of the competent cells are as follows:

(1) Selecting a DH5a clone from a fresh LB plate, inoculating the clone into 6ml of non-resistant LB, and carrying out amplification culture at 37 ℃ and 220rpm overnight;

(2) Inoculating 1ml of the expanded bacterial liquid into 100ml of non-antibiotic LB at 37 ℃, and culturing at 220rpm until the OD600 is about 0.5-0.6;

(3) Placing the shake flask in ice for ice bath for 30min, and centrifuging at 4000rpm for 20min at 4 ℃;

(4) Discarding the supernatant, adding pre-cooled 15ml,10% glycerol for resuspending the thalli, and centrifuging at 4 ℃ and 4000rpm for 20min;

(5) Repeating the step (4) once;

(6) Discarding the supernatant, adding pre-cooled 15ml,10% glycerol for resuspension of the thalli, centrifuging at 4 ℃ and 3500rpm for 15min;

(7) Carefully removing the supernatant, adding precooled 3ml, and resuspending the thalli by 10% glycerol;

(8) The mixture was stored in a refrigerator at-80 ℃ immediately after being dispensed into 100. Mu.l.

The ligation product was transformed into DH5a competent cells by the following steps:

(1) Placing the competent cells on ice for 5min;

(2) Adding 10 μ l of the ligation product into the competent cells, and carrying out ice bath for 30min;

(3) Thermally exciting the competent cells subjected to ice bath for 90s in a 42-degree metal bath;

(4) Adding 1ml of non-resistant LB culture medium into the heat inactivated competent cells, culturing at 37 ℃ and 220rpm for 1h, and centrifuging to collect bacteria and coating the bacteria on plates.

And (3) coating the ampicillin Amp resistant solid culture dish for overnight culture, selecting a monoclonal on the next day for identifying the recombinant vector, and extracting the plasmid for later use after identifying the recombinant vector without errors.

After plasmid extraction, the cells were transferred to INVSC1 yeast competent cells, as follows:

(1) Taking 100 mu l of ice-thawed INVSC1 competent cells, adding 2-5 mu g of precooled target plasmid, 10 mu l of Carrier DNA (heating at 95-100 ℃ for 5min, quickly performing ice bath and repeating once) and 500 mu l of PEG/LIAc, blowing and beating uniformly for several times, and performing water bath at 30 ℃ for 30min;

(2) Water bath at 42 deg.C for 15min;

(3) Centrifuging at 5000rpm for 40s, discarding the supernatant, reselecting with 400 μ l deionized water, centrifuging for 30s, and discarding the supernatant;

(4) Reselecting 50 mul of deionized water, smearing on an SD-U medium plate, and culturing for 72h at 29 ℃.

After the transformation is finished, the positive clone is cultured with 10ml of SD culture medium at 29 ℃ and 220rpm/min for 16-20h to obtain seed liquid after PCR identification, then the seed liquid is collected and centrifuged, the SC culture medium is used for re-suspension, after repeated elution, thalli in the seed liquid are added into 50ml of SC culture medium, and the initial OD is 0.5. Galactose was added for induction, and the culture was carried out at 29 ℃ and 220 rpm/min. In order to explore the influence of different galactose induction concentrations and fermentation time on the activity of the antibacterial peptide, a gradient experiment is adopted. The galactose concentration is respectively set to be 1%, 2%, 3%, 4% and 5%, and the fermentation time is respectively set to be 24h, 48h, 72h, 96h and 120h. Collecting the fermentation broth supernatant with different time and concentration for freeze-drying treatment.

Detecting antibacterial activity of the supernatant of the fermentation liquid by using agar diffusion method, adding 150 mul of thallus with the concentration of 10 ⁸ Respectively inoculating CFU/ml activated Escherichia coli and Staphylococcus aureus in LB agar culture medium, mixing well to prepare flat plate, perforating with 5mm sterile puncher after the flat plate is solidified, adding 70 μ l fermentation supernatant per hole, using ampicillin Amp resistance as positive control, blank hole as negative control, culturing at 37 deg.C for 16-20h, and analyzing activity of antibacterial peptide.

Collecting fermentation supernatant, filtering with 3 kDa ultrafiltration tube, collecting 5ml filtrate, lyophilizing, concentrating by 30 times, redissolving, and detecting Tricine-SDS-PAGE protein gel, wherein the supernatant obtained under the same fermentation condition of plasmid-untransformed INVSC1 yeast is blank control.

Finally, according to the result obtained by the agar diffusion method, the galactose concentration is 3 percent, and the galactose concentration is concentrated by 30 times after being fermented for 72 hours to achieve the best effect.

Claims (8)

1. A gene for expressing camel lactoferrin antibacterial peptide has a nucleotide sequence shown in SEQ ID No. 1.

2. An antibacterial peptide, the amino acid sequence of which is coded by the nucleotide sequence shown in SEQ ID NO. 1.

3. The cecropin according to claim 2, wherein the amino acid sequence of the cecropin is shown in SEQ ID No. 2.

4. A plasmid, which contains a nucleotide sequence shown as SEQ ID NO. 1.

5. The plasmid according to claim 4, wherein the plasmid comprises the expression vector pPIC9K.

6. Use of a bacteriostatic peptide according to claim 2 for the preparation of an antibacterial agent.

7. Use according to claim 6, wherein the antibacterial agent is capable of inhibiting Staphylococcus aureus and/or Escherichia coli.

8. A bacteriostatic composition, wherein the effective component of the bacteriostatic composition comprises the bacteriostatic peptide as claimed in claim 2.

Images