CN103014006A - Bactrian camel lactoferrin gene, recombinant protein and cloning method thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering and discloses a bactrian camel lysozyme protein gene, a recombinant protein and a cloning method thereof. The gene is a gene which is closely related to a gene related to glycoprotein synthesis of controlling nonheme iron associative property in the transferring family. The bactrian camel lysozyme protein gene and an evolutionary tree thereof can intuitively prove the difference between the bactrian camel lysozyme protein sequence and the protein sequence of other species, experimental data are provided for the functions of researching transfer of bactrian camel iron, realizing the broad-spectrum antibacterial and anti-virus function, regulating the in-vivo iron balance, promoting myelopoiesis, promoting cell growth, enhancing the body immunity and disease resistance and suppressing the tumor cells and disease treatment, a certain theoretical basis is provided for researching regulation of certain inflammatory responses and body immunity systems of the bactrian camel, other species and humans, and a certain biological basis is provided for research of body immune defense system; and therefore, the bactrian camel lysozyme protein gene has high application value.

Description

Two-humped camel bovine lactoferrin gene, recombinant protein and cloning process thereof

Technical field

The present invention relates to gene engineering technology field, is a kind of two-humped camel bovine lactoferrin gene, recombinant protein and cloning process thereof.

Background technology

Lactoferrin (lactoferrin, LF) is a kind of nonheme iron associativity glycoprotein, belongs to Transferrins,iron complexes family.Be distributed widely in the Various Tissues and exocrine secretion of people and Mammals domestic animal.Research is found, LF is a kind of protein with various biological function, it not only participates in the transhipment of iron, and find that lactoferrin has more widely biological function, wherein mainly comprise broad-spectrum antimicrobial, antiviral, iron balance in the control agent, promote medullary cell to generate, Promote cell's growth, enhancing body immune disease-resistance ability, inhibition tumor cell, can act synergistically with Multiple Classes of Antibiotics and antifungal preparation, more effective treatment disease participates in some inflammatory reaction and body immune system is produced regulating effect, is a kind of important component in the immunity of organism system of defense.

The research of lactoferrin abroad is since the eighties in 20th century, and domesticly just really begins in recent years.Aspect structural research, nineteen eighty-two, G.Spik etc. have determined the lactoferrin primary structure, and in 1984, M.H.Metz-Boutigue etc. were studied the aminoacid sequence of human lactoferrin.1992, Bellamy etc. found lactoferrin molecule anti-microbial activity center, and called after breast iron element (lactoferricin, LFcin).These active centre of discovery such as D.A.Dionysius were comprised of 25 amino acid in 1997, and molecular weight is 3195.1997, the research such as S.A.Moore disclosed the three-D space structure of lactoferrin.

In biological characteristics and the function aspects of research lactoferrin, since it is found that lactoferrin, just furtherd investigate nineteen thirty-nine always.1975, Porath etc. found lactoferrin energy Adsorption of Heavy Metal Ions; Nagasaka in 1993 etc. report that also Bovinelactoferrin can stablize the iron ion of reduction-state, and other whey-protein is without this function.In addition, lactoferrin can also promote the propagation of protection of intestinal mucosal barrier cells, regulates the phagocytic function of scavenger cell in the intestinal mucosa; Regulate generation and body mucosa-immune function, adjustment body complement system activity and a series of biological activitys such as inflammatory reaction, the regeneration of stimulation N,O-Diacetylmuramidase of medullary cell.

Stefan Kapprler (1998) has carried out systematic research to dromedary Ruzhong lactoferrin, and the result shows that the content of lactoferrin is 5.10g/L in the newborn sample of female camel minute puerperium second day, and is 0.50g/ L in the cow's milk; During minute puerperium 30d in the bactrian camel milk content decrease of lactoferrin to 0.34g/L, at this moment in the cow's milk content decrease of lactoferrin to 0.06g/L.

Elagamy (2000) studies show that the content of lactoferrin is significantly higher than the content in cow's milk and the buffalo's milk in the bactrian camel milk, and its content is respectively cow's milk and buffalo's milk 2 times and 6 times.Duhaiman (1998) and Elagamy(2000) reported that respectively the molecular mass of lactoferrin is respectively 78ku and 79.5ku in the bactrian camel milk.Zhang etc. (2005) study report, and the molecular mass of Alashan Area, inner Mongolia Autonomous Region two-humped camel Ruzhong lactoferrin is 80ku; And the molecular mass of lactoferrin is 76.9ku in the cow's milk.Elagamy (2000) studies report, and the molecular weight of lactoferrin is 76ku in the cow's milk, studies show that further the activity of lactoferrin in the bactrian camel milk has stronger thermotolerance than cow's milk and buffalo's milk.

Lactoferrin content in the Shubat of Alashan Area, inner Mongolia Autonomous Region alliance is obviously high than the lactoferrin content in the cow's milk, and lactoferrin has very important biological function, and is still, at present very few for the research of two-humped camel lactoferrin both at home and abroad.So studying the lactoferrin in hunchbacked Ruzhong has very important significance.

Summary of the invention

The invention provides a kind of two-humped camel bovine lactoferrin gene, this gene is a kind of synthetic relevant closely-related gene of gene of nonheme iron associativity glycoprotein of controlling Transferrins,iron complexes family, and its nucleotide sequence and dromedary lactoferrin nucleotide sequence AJ131674.1 have 90% similarity.

One of technical scheme of the present invention realizes by following measures: a kind of two-humped camel bovine lactoferrin gene, this gene is a kind of synthetic closely-related gene of nonheme iron associativity glycoprotein of controlling Transferrins,iron complexes family, have among the SEQ ID NO.1 from the nucleotide sequence of Nucleotide 22-2104 position, its nucleotide sequence and dromedary lactoferrin nucleotide sequence AJ131674.1 have 90% similarity.

Two of technical scheme of the present invention realizes by following measures: a kind of recombinant protein of two-humped camel bovine lactoferrin gene.

The below is two further optimization and/or improvements to the foregoing invention technical scheme:

The nucleotides sequence of above-mentioned recombinant protein is classified SEQ ID NO.1 as.

Above-mentioned recombinant protein is polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative of the aminoacid sequence shown in the SEQ ID NO.2.

The aminoacid sequence of above-mentioned recombinant protein is SEQ ID NO.2.

Above-mentioned recombinant protein obtains the two-humped camel bovine lactoferrin gene by the design pair of primers from the two-humped camel lactoferrin, the right nucleotide sequence forward primer of this primer is that SEQ ID NO.3 and reverse primer are SEQ ID NO.4, and its sequence information is as follows:

SEQ ID NO.3：5’- ATGAAGCTCTTCTTCCCCGCC -3’，

SEQ ID NO.4：Oligo dT。

Three of technical scheme of the present invention realizes by following measures: a kind of cloning process of two-humped camel bovine lactoferrin gene, carry out: the first step, separate tissue (Isolation) in the steps below; Second step, the separation (Total RNA isolation) of total RNA, the separation (Total RNA isolation) of total RNA comprise that preparation work, the total tissue RNA of extracting RNA are extracted, the evaluation of total tissue RNA; The 3rd step, the clone of full-length cDNA (Cloning of Full-length cDNA), the clone of full-length cDNA (Cloning of Full-length cDNA) comprises design of primers and synthetic, RT-PCR amplification, Cloning and sequencing, the right nucleotide sequence forward primer of this primer is that SEQ ID NO.3 and reverse primer are SEQ ID NO.4, and its sequence information is as follows:

SEQ ID NO.3：5’- ATGAAGCTCTTCTTCCCCGCC -3’，

SEQ ID NO.4：Oligo dT。

The difference that lactoferrin sequence and the evolutionary tree of the present invention by two-humped camel can show two-humped camel lactoferrin sequence and other these protein sequences of species intuitively, be the later on transhipment of research two-humped camel iron, and broad-spectrum antimicrobial, antiviral, iron balance in the control agent, promote medullary cell to generate, Promote cell's growth, enhancing body immune disease-resistance ability, inhibition tumor cell and disease treatment effect provide experimental data, provide certain theoretical foundation to the adjusting of research two-humped camel and other species and human some inflammatory reaction and body immune system simultaneously, research to the immunity of organism system of defense provides certain biological foundation, so the present invention has very large using value.

Description of drawings

Accompanying drawing 1 is two-humped camel bovine lactoferrin gene RT-PCR product electrophorogram of the present invention.

Accompanying drawing 2 for the animals such as two-humped camel and dromedary, people, mouse, ox with the lactoferrin amino acid sequence homology comparative result figure that aligns among the Clustal X.

Accompanying drawing 3 is the phyletic evolution tree graph of two-humped camel lactoferrin aminoacid sequence of the present invention with animal milk ferritin aminoacid sequence structures such as dromedary, people, mouse.

Embodiment

The present invention is not subjected to the restriction of following embodiment, can determine concrete embodiment according to technical scheme of the present invention and practical situation.

Embodiment 1: a kind of two-humped camel bovine lactoferrin gene, this gene is a kind of synthetic closely-related gene of nonheme iron associativity glycoprotein of controlling Transferrins,iron complexes family, have among the SEQ ID NO.1 from the nucleotide sequence of Nucleotide 22-2104 position, its nucleotide sequence and dromedary lactoferrin nucleotide sequence AJ131674.1 have 90% similarity.

Embodiment 2: a kind of recombinant protein of two-humped camel bovine lactoferrin gene.

Embodiment 3: the nucleotides sequence of recombinant protein is classified SEQ ID NO.1 as.

Embodiment 4: recombinant protein is polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative of the aminoacid sequence shown in the SEQ ID NO.2.

Embodiment 5: the aminoacid sequence of recombinant protein is SEQ ID NO.2.

Embodiment 6: recombinant protein obtains the two-humped camel bovine lactoferrin gene by the design pair of primers from the two-humped camel lactoferrin, the right nucleotide sequence forward primer of this primer is that SEQ ID NO.3 and reverse primer are SEQ ID NO.4, and its sequence information is as follows:

SEQ ID NO.3：5’- ATGAAGCTCTTCTTCCCCGCC -3’，

SEQ ID NO.4：Oligo dT。

Embodiment 7: a kind of cloning process of two-humped camel bovine lactoferrin gene, carry out: the first step, separate tissue (Isolation) in the steps below; Second step, the separation (Total RNA isolation) of total RNA, the separation (Total RNA isolation) of total RNA comprise that preparation work, the total tissue RNA of extracting RNA are extracted, the evaluation of total tissue RNA; The 3rd step, the clone of full-length cDNA (Cloning of Full-length cDNA), the clone of full-length cDNA (Cloning of Full-length cDNA) comprises design of primers and synthetic, RT-PCR amplification, Cloning and sequencing, the right nucleotide sequence forward primer of this primer is that SEQ ID NO.3 and reverse primer are SEQ ID NO.4, and its sequence information is as follows:

SEQ ID NO.3：5’- ATGAAGCTCTTCTTCCCCGCC -3’，

SEQ ID NO.4：Oligo dT。

The clone of two-humped camel bovine lactoferrin gene cDNA sequence

1. separate tissue (Isolation)

Adopt to get two-humped camel from Alashan Area, inner Mongolia Autonomous Region alliance, butcher fast and get the liver sample, it is freezing rear in-70 ℃ of preservations to organize sample to put into rapidly liquid nitrogen, brings back the laboratory and prepares to extract total tissue RNA.

2. the separation (Total RNA isolation) of total RNA

(1) preparation work of extraction RNA

The NaOH soaked overnight of used in glass products 0.1M is washed repeatedly with tap water, uses distilled water flushing 2 times again, and 180 ℃ were toasted 4 hours.

Homogenizer, electrophoresis chamber be with 3% hydrogen peroxide dipping 20 minutes to 30 minutes, and with 0.1% DEPC water flushing, because the DEPC of deactivation is not influential to the PCR reaction, available 0.5% SDS processes again.

The DEPC water soaking of Tip head, EP effective 0.1% spends the night, and autoclaving makes the DEPC inactivation.

Distilled water and solution are processed with DEPC, and namely every 100ml water or solution add 0.1mlDEPC liquid, and room temperature is placed and spent the night 30 minutes DEPC inactivations of autoclaving.

(2) total tissue RNA is extracted

Get 100mg frozen sample of organizing in liquid nitrogen and put into 1ml Trizol(trizal reagent, invitrogen BRL, USA) the homogenate organ pipe in homogenate; Centrifugal 10 minutes of 4 ℃ of 12000g draw supernatant liquor, and 15 ℃ to 30 ℃ incubations 5 minutes add the 0.2ml chloroform, cover lid, and with hand concuss 15 seconds, 15 ℃ to 30 ℃ incubations 2 minutes to 3 minutes, centrifugal 15 minutes of 4 ℃ of 12000g; Draw supernatant liquor, add the 0.8ml Virahol, mix; 15 ℃ to 30 ℃ incubations 10 minutes, centrifugal 10 minutes of 4 ℃ of 12000g, centrifuge tube bottom white precipitate is RNA; Outwell supernatant, add 1ml 75% washing with alcohol RNA, centrifugal 10 minutes of 4 ℃ of 7500g, seasoning or vacuum-drying RNA; Packing in water-soluble (RNase free) ,-70 ℃ of preservations.

(3) evaluation of total tissue RNA

By measuring rna content on the spectrophotometer and with the quality of agarose electrophoretic analysis RNA, concrete grammar is as follows: electrophoresis chamber RNA scavenging solution (100mM NaOH, 1mM EDTA) soaked 4 hours to 5 hours, it is stand-by to pour 1 * TBE into after repeatedly washing for several times with the DEPC treated water again, and sepharose is prepared with 1 * TBE; The 10ul sample-loading buffer (2 * TBE, 13% phenanthrene can, 0.1% bromjophenol blue, 7M urea) in add the above total tissue RNA of 1ul, 65 ℃ of sex change were put into frozen water 2 minutes to 3 minutes immediately after 10 minutes, point sample is electrophoresis in sepharose.

3. the clone of full-length cDNA (Cloning of Full-length cDNA)

(1) design of primers and synthetic

The lysozyme gene mRNA sequence ORF flank homologous sequence of the species such as the people (Accession No:AAA59511.1) who delivers according to GenBanK, mouse (Accession No:AAA39427.1), ox (Accession No:AAA30610.1), design following primer for the pcr amplification take two-humped camel N,O-Diacetylmuramidase cDNA as masterplate, to obtain two-humped camel lysozyme gene cDNA sequence; Primer is with Primer Premier 5.0 designed, designeds, and synthetic by Shanghai Sani's bio tech ltd, the right nucleotide sequence of this primer is respectively SEQ ID NO:3(forward) and SEQ ID NO:4(reverse), sequence information is as follows:

SEQ ID NO:3(forward): 5 '-ATGAAGCTCTTCTTCCCCGCC-3 '

SEQ ID NO:4(is reverse): Oligo dT

(2) RT-PCR amplification

Carry out reverse transcription by precious biological reverse transcription test kit (the BcaBEST RNA PCR Kit Ver.1.1) requirement in Dalian; Inverse transcription reaction liquid forms: 10ul 2 * Bca 1st Buffer, 4ul 25Mm MgSO4,1ul dNTP Mixture, 0.5ul Rnase Inhibitor (40U/ul), 1ul BcaBEST Polymerase (22U/ul), 1ul Oligo dT Primer, 1ul RNA Sample, 1.5ul Rnase Free dH2O totally is 20 ul; The reverse transcription reaction condition: 65 ℃ 1 minute, 30 ℃ 5 minutes (in 15 minutes to 30 minutes at the uniform velocity heat up), 65 ℃ 25 minutes, 98 ℃ 5 minutes, 5 ℃ 5 minutes; Pcr amplification condition: 97 ℃ of sex change 5 minutes; 95 ℃ 30 seconds → 55 ℃ 30 seconds → 72 ℃ 1 minute, so carry out 30 times the circulation; 72 ℃ were extended 4 ℃ of preservations 10 minutes.

(3) Cloning and sequencing

The recovery of pcr amplified fragment: fragment reclaims by the explanation of Shanghai China Shun a small amount of glue recovery test kit is undertaken, and operating process is as follows: as far as possible little cutting off contains the Agarose plug of DNA, puts into the 1.5mlEP pipe.The ratio that adds 300ulS1 liquid in every 100mg agarose adds S1 liquid, 50 ℃ of water-baths 10 minutes; The agar liquid glucose that will dissolve moves into adsorption column, and centrifugal 1 minute of 10000g outwells liquid in the pipe.In adsorption column, add 500ul W1 liquid, centrifugal 15 seconds of 10000g; Outwell liquid in the pipe, in adsorption column, add 500ul W1 liquid, leave standstill 1 minute after, centrifugal 15 seconds of 10000g outwells liquid in the pipe; Centrifugal 1 minute, adsorption column is put into a clean 1.5mlEP pipe, after adsorption film central authorities add 30ulT1 liquid, leave standstill 1 minute, centrifugal 1 minute of 10000g, liquid is the DNA of recovery in the EP pipe.

Reclaim fragment with the connection of T carrier: connect the test kit with TaKaRa pMD18-T Vector, operating process is as follows: the following ligation liquid of preparation in the EP pipe: pMD 18-T Vector (50ng/ul) 0.5ul, DNA 20-40ng, Solution 1 5ul adds dH2O to 10ul; 30 minutes (also can spend the night) of 16 ℃ of reactions, product is used for the transformed competence colibacillus cell with above-mentioned reaction solution.

The conversion of plasmid: from-70 ℃ of refrigerators, take out the competent cell of preserving, ice bath hydrotropy; The 100ul competent cell adds 10ul and connects product, ice bath 30 minutes; In 42 ℃ of 90 seconds of water-bath heat stress, inserted immediately in the ice bath 2 minutes; Add 400ul liquid LB substratum, 37 ℃ brought back to life 50 minutes; Get 100ul and be laid on the LB flat board, flat board contains the ammonia benzyl mould Amp (100mg/ml) of 0.1% (V/V), 37 ℃ of constant temperature culture 10 hours to 15 hours.

The PCR that transforms bacterium colony identifies and cultivation: transform single bacterium colony of cultivating with the marking pen mark, dip single bacterium colony with the toothpick of sterilizing; Dentiscalprum head is placed in to be added with in the PCR reaction solution EP pipe of (not containing template) rocks, make single bacterium colony serve as template; Increase with the PCR condition that obtains this fragment; the PCR product carries out agarose gel electrophoresis together with Marker; differentiate on the T carrier and whether contain the purpose fragment; if obtain the purpose fragment; the choicest of available sterilization rifle is taken at the with it single bacterium colony of correspondence on the flat board, puts into 40 mlLB liquid nutrient mediums, adds first the benzylpenicillin sodium (100mg/ml) of 0.1% (V/V) in liquid; 37 ℃ are spent the night and shake bacterium and cultivate, and are used for plasmid and reclaim.

The recovery of plasmid: plasmid reclaims with Shanghai China Shun a small amount of plasmid extraction purification kit, and operation steps is as follows: will transform the bacterium liquid of cultivating and add in the 1.5mlEP pipe, 4000 rev/mins centrifugal, outwells liquid and obtain bacterial precipitation; It is centrifugal to add a bacterium liquid when bacterial precipitation is inadequate again; Add 250ulP1 liquid in bacterial precipitation, vibration suspends; Add 250ulP2 liquid, gentleness shakes up, and room temperature left standstill 4 minutes; Add 350ulP3 liquid, gentleness shakes up; Centrifugal 10 minutes, supernatant liquor is carefully moved into adsorption column, centrifugal 15 seconds, outwell liquid; In adsorption column, add 500ulW1, centrifugal 15 seconds, outwell liquid; In adsorption column, add 500ulW1, left standstill 1 minute, centrifugal 15 seconds, outwell liquid; Centrifugal 1 minute, adsorption column is put into a clean 1.5mlEP pipe, after adsorption film central authorities added 25-30ulT1 liquid, leave standstill 1 minute, centrifugal 1 minute, liquid was the plasmid of recovery in the EP pipe.

The enzyme of plasmid is cut evaluation: to reclaim plasmid really for inserting the recombinant plasmid of purpose fragment in order proving, to adopt the double digestion method to identify.This research concrete operations are as follows: according to TaKaRa pMD18-T Vector figure, select restriction endonuclease Bam H I and Hin d III, guarantee in the purpose fragment point of contact without these two kinds of enzymes.Endonuclease reaction system composed as follows: Bam H I 1ul, Hin d III 1ul, 10 * K Buffer 2ul, DNA≤1ul adds dH2O to 20ul.30 ℃ were reacted 3 hours, and agarose gel electrophoresis detects.

The order-checking of recombinant plasmid: get the 20ul recombinant plasmid in the EP pipe, sealed membrane sealing, the order-checking of intergrowth thing technology company.

Two-humped camel bovine lactoferrin gene encoding sequence homology compares and phylogenetic tree makes up

1, the sequence information of two-humped camel lactoferrin and bioinformatic analysis

The length of the two-humped camel lactoferrin CDS that the present invention is new is 2128 bp, and detailed sequence is seen SEQ ID NO.1.Derive the aminoacid sequence of two-humped camel lactoferrin according to total length CDS, totally 693 amino acid are residual, see SEQ ID NO.2 for details, on-line prediction (http://www.expasy.ch/tools/pi_tool.html) result shows, its molecular weight is 75489.87 dalton, and iso-electric point (pI) is 8.06.

2, bovine lactoferrin gene encoding sequence phylogenetic tree makes up

Search for and obtain the coding protein sequence of nine bovine lactoferrin genes of nine kinds of species such as dromedary, people, mouse at GenBank, add the SEQ ID NO.2 sequence that the present invention obtains, utilize molecular biology software MEGA4 to make up phylogenetic tree (seeing accompanying drawing 3).The result shows: the two-humped camel bovine lactoferrin gene is nearest with the sibship of dromedary; Indirect proof resulting sequence really be the two-humped camel bovine lactoferrin gene.

The present invention carries out homology relatively with the CDS sequence of the different plant species bovine lactoferrin genes such as dromedary, people, mouse, sheep and aminoacid sequence on the cDNA sequence that the two-humped camel bovine lactoferrin gene is provided and albumen coded sequence basis; To the CDS sequence construct of nine bovine lactoferrin genes of nine species comprising two-humped camel phylogenetic tree.The present invention is achieved by the following technical solutions:

The cDNA sequence of the two-humped camel bovine lactoferrin gene among the present invention is as template by total RNA in the two-humped camel liver organization, with reference to the homologous sequence design primer of the bovine lactoferrin gene of the species such as dromedary, people, mouse, carry out reverse transcription PCR and the new gene order that obtains.The two-humped camel bovine lactoferrin gene cDNA sequence that obtains is seen SEQ ID NO.1.The protein coding sequence that encoding sequence (CDS) in the two-humped camel bovine lactoferrin gene cDNA sequence is translated into by universal code is seen SEQ ID NO.2.

In SEQ ID NO.1, RT-PCR product length is 2128bp, and electrophoresis result is seen accompanying drawing 1, and wherein the 23-25 position is initiator codon ATG, and the 2102-2104 position is terminator codon TGA, and the 23-2104 position is coded protein zone (CDS).At SEQ ID NO.1,693 amino acid of two-humped camel bovine lactoferrin gene coding.Two-humped camel and dromedary lactoferrin nucleotide sequence AJ131674.1 have 90% similarity; The animals such as two-humped camel and dromedary, people, mouse, ox see accompanying drawing 2 with the bovine lactoferrin gene encoding amino acid sequence homology comparative result that aligns among the Clustal X; Wherein nine kinds of animal milk ferritin amino acid numbers and molecular weight see Table one; Wherein nine kinds of animal milk ferritin amino acid ratios see Table two.

To the CDS sequence construct of nine bovine lactoferrin genes of nine species comprising SEQ ID NO.1 phylogenetic tree, found that: the two-humped camel lactoferrin is nearest with the evolutionary distance of dromedary, indirect proof resulting sequence really be the two-humped camel bovine lactoferrin gene.

Above technical characterictic has consisted of embodiments of the invention, and it has stronger adaptability and implementation result, can increase and decrease according to actual needs non-essential technical characterictic, satisfies the demand of different situations.

Sequence table

＜110 〉 Xinjiang Wang Yuan camel milk Industrial Co., Ltd.

＜120〉albumen coded sequence of two-humped camel lactoferrin

<160> 4

<210> 1

<211> 2128

<212> DNA

＜213〉Alashan League two-humped camel

<400> 1

gagtcgcctc aggaccccag acatgaagct cttcttcccc gccttgctgt ccctcggggc 60

ccttggactg tgtctggctg cctctaagaa aagtgttcga tggtgcacca catcaccagc 120

agagtcgtca aaatgtgccc aatggcaacg gaggatgaaa aaagtgcgtg gtccctctgt 180

cacctgcgta aagaagacat ctcgctttga atgcatccag gccatctcga cagaaaaggc 240

agatgctgtg acccttgacg gtggtttggt gtatgacgca ggcctggacc cctacaagct 300

gcggccgata gcggcagagg tctatgggac agaaaacaat ccccaaaccc actattatgc 360

cgttgccatt gccaaaaagg gcaccaactt tcagctgaac cagctacaag gcctgaagtc 420

ctgccatacc ggccttggca ggtctgctgg gtggaacatc cctatggggc tacttcgtcc 480

attcttggac tggacagggc ctcctgagcc cctccagaaa gctgtggcca aattcttctc 540

tgccagctgt gttccctgcg tggatggaaa agagtacccc aacctgtgtc agctgtgtgc 600

agggacgggg gaaaataaat gtgcctgctc ctcccaggaa ccatattttg gctactctgg 660

tgccttcaag tgtctgcaag atggggctgg agatgtggct tttgtcaagg acagtacagt 720

gtttgagagc ctgccagcga aggcggacag ggaccagtat gagctgctct gcccaaacaa 780

tactcggaaa ccagtggatg cattccagga gtgtcatcta gcccgggtcc cttctcatgc 840

tgttgtggcc cgaagtgtga atggcaagga ggacttgatc tggaaacttc tcgtcaaggc 900

acaggaaaag tttggaagag gcaagccatc agcattccag ctctttggct ctcctgctgg 960

gcagaaggac ctgctgttca aagactctgc ccttgggttg ttgaggatcc cctcaaagat 1020

agattctggg ctgtacctgg gctccaacta catcactgcc atccgaggcc tgagggaaag 1080

taacggcggg aggcgcgcgc aggtcgtgtg gtgcgcggtg ggctccgacg agcagctcaa 1140

gtgccaggag tggagccgcc agagcaacca aagcgtggtc tgtgccacgg cctccaccac 1200

cgaggactgc atcgccctgg tgctgaaagg agaagctgat gctttgagct tggatggagg 1260

atatatctac attgcgggca agtgtggctt ggtgcctgtc ctggcagaga gccaacatga 1320

attcttcagt caaagctgtg cccctgggtc tgacccaaga tccaagctct gtgctctgtg 1380

tgcaggcaac gaggagggcc agaacaagtg tgtgcccaac agcagcgaga gatactatgg 1440

ctacactggg gctttcaggt gcctggctga gaatgttggg gatgttgcgt ttgtgaaaga 1500

tgtcaccgtc ttagacaaca ctgatggaaa gaacactgag cagtgggcta aggatttgaa 1560

gctgggagac tttgagctgc tgtgcctcaa tggcaccagg aagcctgtga ctgaggctga 1620

gagctgccac ctggccgtgg ccccaaatca tgctgtggta tctcggattg ataaggtagc 1680

acacctggaa caggtgctgc tccgccaaca ggctcatttt ggaagaaatg gacaagactg 1740

cccaggcaaa ttttgcttgt tccagtccaa aaccaaaaac ctcctgttca atgacaacac 1800

tgagtgtctg gccaaactcc aaggcaaaac aacatatgaa gagtatttgg gaccacagta 1860

tgtcacggcc attgctaagc tgagacgatg ctccacctcc cttcctgcag agatgaactc 1920

gacagactct gccccagagt ccttcagagg cgagagtgga gacggtaagt acagcataca 1980

gctcgtcatc agatggaact ggcgcaagct tggggacctg ggttgtgtgc tttgcggaag 2040

aggtagtcat ttacttggag cagctgcaga aggccgatat gaggaggagg aggaggaggc 2100

ctgaaaatgc tgttggtttt cattccct 2128

<210> 2

<211> 693

<212> PRT

＜213〉Alashan League two-humped camel

<400> 2

Met Lys Leu Phe Phe Pro Ala Leu Leu Ser Leu Gly Ala Leu Gly Leu

1 5 10 15

Cys Leu Ala Ala Ser Lys Lys Ser Val Arg Trp Cys Thr Thr Ser Pro

20 25 30

Ala Glu Ser Ser Lys Cys Ala Gln Trp Gln Arg Arg Met Lys Lys Val

35 40 45

Arg Gly Pro Ser Val Thr Cys Val Lys Lys Thr Ser Arg Phe Glu Cys

50 55 60

Ile Gln Ala Ile Ser Thr Glu Lys Ala Asp Ala Val Thr Leu Asp Gly

65 70 75 80

Gly Leu Val Tyr Asp Ala Gly Leu Asp Pro Tyr Lys Leu Arg Pro Ile

85 90 95

Ala Ala Glu Val Tyr Gly Thr Glu Asn Asn Pro Gln Thr His Tyr Tyr

100 105 110

Ala Val Ala Ile Ala Lys Lys Gly Thr Asn Phe Gln Leu Asn Gln Leu

115 120 125

Gln Gly Leu Lys Ser Cys His Thr Gly Leu Gly Arg Ser Ala Gly Trp

130 135 140

Asn Ile Pro Met Gly Leu Leu Arg Pro Phe Leu Asp Trp Thr Gly Pro

145 150 155 160

Pro Glu Pro Leu Gln Lys Ala Val Ala Lys Phe Phe Ser Ala Ser Cys

165 170 175

Val Pro Cys Val Asp Gly Lys Glu Tyr Pro Asn Leu Cys Gln Leu Cys

180 185 190

Ala Gly Thr Gly Glu Asn Lys Cys Ala Cys Ser Ser Gln Glu Pro Tyr

195 200 205

Phe Gly Tyr Ser Gly Ala Phe Lys Cys Leu Gln Asp Gly Ala Gly Asp

210 215 220

Val Ala Phe Val Lys Asp Ser Thr Val Phe Glu Ser Leu Pro Ala Lys

225 230 235 240

Ala Asp Arg Asp Gln Tyr Glu Leu Leu Cys Pro Asn Asn Thr Arg Lys

245 250 255

Pro Val Asp Ala Phe Gln Glu Cys His Leu Ala Arg Val Pro Ser His

260 265 270

Ala Val Val Ala Arg Ser Val Asn Gly Lys Glu Asp Leu Ile Trp Lys

275 280 285

Leu Leu Val Lys Ala Gln Glu Lys Phe Gly Arg Gly Lys Pro Ser Ala

290 295 300

Phe Gln Leu Phe Gly Ser Pro Ala Gly Gln Lys Asp Leu Leu Phe Lys

305 310 315 320

Asp Ser Ala Leu Gly Leu Leu Arg Ile Pro Ser Lys Ile Asp Ser Gly

325 330 335

Leu Tyr Leu Gly Ser Asn Tyr Ile Thr Ala Ile Arg Gly Leu Arg Glu

340 345 350

Ser Asn Gly Gly Arg Arg Ala Gln Val Val Trp Cys Ala Val Gly Ser

355 360 365

Asp Glu Gln Leu Lys Cys Gln Glu Trp Ser Arg Gln Ser Asn Gln Ser

370 375 380

Val Val Cys Ala Thr Ala Ser Thr Thr Glu Asp Cys Ile Ala Leu Val

385 390 395 400

Leu Lys Gly Glu Ala Asp Ala Leu Ser Leu Asp Gly Gly Tyr Ile Tyr

405 410 415

Ile Ala Gly Lys Cys Gly Leu Val Pro Val Leu Ala Glu Ser Gln His

420 425 430

Glu Phe Phe Ser Gln Ser Cys Ala Pro Gly Ser Asp Pro Arg Ser Lys

435 440 445

Leu Cys Ala Leu Cys Ala Gly Asn Glu Glu Gly Gln Asn Lys Cys Val

450 455 460

Pro Asn Ser Ser Glu Arg Tyr Tyr Gly Tyr Thr Gly Ala Phe Arg Cys

465 470 475 480

Leu Ala Glu Asn Val Gly Asp Val Ala Phe Val Lys Asp Val Thr Val

485 490 495

Leu Asp Asn Thr Asp Gly Lys Asn Thr Glu Gln Trp Ala Lys Asp Leu

500 505 510

Lys Leu Gly Asp Phe Glu Leu Leu Cys Leu Asn Gly Thr Arg Lys Pro

515 520 525

Val Thr Glu Ala Glu Ser Cys His Leu Ala Val Ala Pro Asn His Ala

530 535 540

Val Val Ser Arg Ile Asp Lys Val Ala His Leu Glu Gln Val Leu Leu

545 550 555 560

Arg Gln Gln Ala His Phe Gly Arg Asn Gly Gln Asp Cys Pro Gly Lys

565 570 575

Phe Cys Leu Phe Gln Ser Lys Thr Lys Asn Leu Leu Phe Asn Asp Asn

580 585 590

Thr Glu Cys Leu Ala Lys Leu Gln Gly Lys Thr Thr Tyr Glu Glu Tyr

595 600 605

Leu Gly Pro Gln Tyr Val Thr Ala Ile Ala Lys Leu Arg Arg Cys Ser

610 615 620

Thr Ser Leu Pro Ala Glu Met Asn Ser Thr Asp Ser Ala Pro Glu Ser

625 630 635 640

Phe Arg Gly Glu Ser Gly Asp Gly Lys Tyr Ser Ile Gln Leu Val Ile

645 650 655

Arg Trp Asn Trp Arg Lys Leu Gly Asp Leu Gly Cys Val Leu Cys Gly

660 665 670

Arg Gly Ser His Leu Leu Gly Ala Ala Ala Glu Gly Arg Tyr Glu Glu

675 680 685

Glu Glu Glu Glu Ala

690

<210> 3

<211> 21

<212> DNA

＜213〉artificial

<400> 3

atgaagctct tcttccccgcc 21

<210> 4

<211>

<212> DNA

＜213〉artificial

<400> 4

Oligo dT

Claims (10)

1. two-humped camel bovine lactoferrin gene, it is characterized in that this gene is a kind of synthetic closely-related gene of nonheme iron associativity glycoprotein of controlling Transferrins,iron complexes family, have among the SEQ ID NO.1 from the nucleotide sequence of Nucleotide 22-2104 position, its nucleotide sequence and dromedary lactoferrin nucleotide sequence AJ131674.1 have 90% similarity.

2. the recombinant protein of a two-humped camel bovine lactoferrin gene according to claim 1.

3. recombinant protein according to claim 2 is characterized in that the nucleotides sequence of this recombinant protein is classified SEQ ID NO.1 as.

4. according to claim 2 or 3 described recombinant proteins, it is characterized in that this recombinant protein is polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative of the aminoacid sequence shown in the SEQ ID NO.2.

5. according to claim 2 or 3 described recombinant proteins, the aminoacid sequence that it is characterized in that this recombinant protein is SEQ ID NO.2.

6. recombinant protein according to claim 4, the aminoacid sequence that it is characterized in that this recombinant protein is SEQ ID NO.2.

7. according to claim 2 or 3 described recombinant proteins, it is characterized in that from the two-humped camel lactoferrin, obtaining the two-humped camel bovine lactoferrin gene by the design pair of primers, the right nucleotide sequence forward primer of this primer is that SEQ ID NO.3 and reverse primer are SEQ ID NO.4, and its sequence information is as follows:

SEQ ID NO.3：5’- ATGAAGCTCTTCTTCCCCGCC -3’，

SEQ ID NO.4：Oligo dT。

8. recombinant protein according to claim 4, it is characterized in that from the two-humped camel lactoferrin, obtaining the two-humped camel bovine lactoferrin gene by the design pair of primers, the right nucleotide sequence forward primer of this primer is that SEQ ID NO.3 and reverse primer are SEQ ID NO.4, and its sequence information is as follows:

SEQ ID NO.3：5’- ATGAAGCTCTTCTTCCCCGCC -3’，

SEQ ID NO.4：Oligo dT。

9. according to claim 5 or 6 described recombinant proteins, it is characterized in that from the two-humped camel lactoferrin, obtaining the two-humped camel bovine lactoferrin gene by the design pair of primers, the right nucleotide sequence forward primer of this primer is that SEQ ID NO.3 and reverse primer are SEQ ID NO.4, and its sequence information is as follows:

SEQ ID NO.3：5’- ATGAAGCTCTTCTTCCCCGCC -3’，

SEQ ID NO.4：Oligo dT。

10. the cloning process of a two-humped camel bovine lactoferrin gene according to claim 1 carries out: the first step, separate tissue (Isolation) in the steps below; Second step, the separation (Total RNA isolation) of total RNA, the separation (Total RNA isolation) of total RNA comprise that preparation work, the total tissue RNA of extracting RNA are extracted, the evaluation of total tissue RNA; The 3rd step, the clone of full-length cDNA (Cloning of Full-length cDNA), the clone of full-length cDNA (Cloning of Full-length cDNA) comprises design of primers and synthetic, RT-PCR amplification, Cloning and sequencing, the right nucleotide sequence forward primer of this primer is that SEQ ID NO.3 and reverse primer are SEQ ID NO.4, and its sequence information is as follows:

SEQ ID NO.3：5’- ATGAAGCTCTTCTTCCCCGCC -3’，

SEQ ID NO.4：Oligo dT。

Images