CN107653255B - Penaeus monodon peroxidase reductase gene Prx5 and application thereof - Google Patents

Abstract

The invention discloses cDNA of a penaeus monodon peroxide reductase gene Prx5, and the nucleic acid sequence of the cDNA is shown as SEQ ID NO. 1. The invention also discloses an expression vector comprising the cDNA. And the application of the penaeus monodon peroxide reductase Prx5 recombinant protein in preparing medicines with shrimp antibacterial effect or shrimp immunity enhancing effect.

Description

Penaeus monodon peroxidase reductase gene Prx5 and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a penaeus monodon peroxide reductase gene Prx5 and application thereof.

Background

Penaeus monodon, a marine invertebrate, has no adaptive immune system and relies on the innate immune system in combating foreign invasion. Respiratory burst is an important biological process in the immune system of prawns, and can generate a large amount of Reactive Oxygen Species (ROS) to kill pathogenic bacteria, but the accumulation of the ROS can damage cells to cause cell damage and damage to biological individuals. The organism avoids ROS to damage cells for maintaining the balance of ROS, has produced two kinds of anti-oxidant systems: one is an antioxidant system relying on non-enzymatic small molecules, such as vitamin E; another class is enzymatic systems, such as the peroxiredoxins (Prx) and the like. Prx is an important antioxidant protease whose primary function is to eliminate peroxide and hydroxyl radicals produced during metabolism.

Prx5 is the only atypical 2-cysteine (Cys) peroxiredoxin of the peroxiredoxin family, with unique attributes: (1) prx5 may be passed through NH₂-the terminal and the COOH-terminal constitute intramolecular disulfide bonds, which donate hydrogen in a redox reaction; (2) prx5 has substrate specificity and reacts more efficiently with ONOO-and organic peroxides than other Prx subfamily members. Prx5 is the most specific subtype of the peroxiredoxin family, and the similarity rate of Prx5 sequence with other subtype sequences in human body is only 28-30%. Prx5 is widely distributed in cells and can be detected in subcellular structures such as mitochondria, peroxisomes, cytoplasm, and nucleus.

On the other hand, Prx5 has multiple functions, and is involved in other biological functions besides the basic antioxidant effect, such as: immune system, apoptosis, cell proliferation, cell differentiation, intracellular signal transduction, gene expression regulation, molting, etc. Research has proved that Prx5 can help Escherichia coli to resist bacteria, prolong the life of Drosophila melanogaster by 30%, and the like.

Thus, research into Prx5 is helpful in understanding a variety of physiological activities.

Disclosure of Invention

The first purpose of the invention is to provide cDNA of a penaeus monodon peroxidase reductase gene Prx5 and coded amino acid thereof.

The second purpose of the invention is to provide an expression vector containing cDNA of the penaeus monodon peroxide reductase gene Prx 5.

The third purpose of the invention is to provide a preparation method of the penaeus monodon peroxide reductase Prx5 recombinant protein and the penaeus monodon peroxide reductase Prx5 recombinant protein prepared by the method.

The last purpose of the invention is to provide the application of the penaeus monodon peroxiredoxin Prx5 recombinant protein in preparing the drugs with the shrimp antibacterial efficacy or the shrimp immunity enhancing efficacy.

Therefore, the invention mainly relates to a gene sequence of a prawn peroxide reductase gene Prx5, in particular to a gene sequence, an amino acid sequence, a space-time expression map, a preparation method and a function verification method of in vitro recombinant protein of a peroxide reductase gene Prx5 which is obtained by homologous cloning in a Penaeus monodon cDNA library, and also relates to an application of the Penaeus monodon peroxide reductase Prx5 recombinant protein.

The first purpose of the invention is realized by the following technical scheme: a cDNA of a penaeus monodon peroxide reductase gene Prx5 has a nucleic acid sequence shown in SEQ ID NO. 1.

The amino acid sequence of the penaeus monodon peroxide reductase gene Prx5 is shown in SEQ ID NO. 2.

The cDNA of the penaeus monodon peroxide reductase gene Prx5 can be prepared by the following method: according to the EST sequence of the peroxidase gene Prx5 in the constructed cDNA library of the penaeus monodon, after the EST sequence of the target gene is verified, a PCR primer is designed, and the full coding sequence of the gene Prx5 of the penaeus monodon is obtained by cloning by combining the RACE technology. The Penaeus monodon Prx5 gene comprises a 76bp 5 '-untranslated region sequence (UTR) and a 1040bp 3' -untranslated region sequence. The gene codes 189 amino acids and has a molecular weight of 20 kD. The gene is induced and expressed in immune organs after being stimulated by external sources, the recombinant protein of the gene in the escherichia coli can protect the propagation and growth of the escherichia coli when being stimulated by heavy metal, and the penaeus monodon peroxide reductase gene Prx5 recombinant protein has obvious antibacterial effect in the living bodies of the penaeus monodon and can be applied to the preparation of shrimp antibacterial drugs.

The second purpose of the invention is realized by the following technical scheme: an expression vector, which comprises cDNA of the penaeus monodon peroxide reductase gene Prx 5.

The third purpose of the invention is realized by the following technical scheme: a preparation method of the penaeus monodon peroxide reductase Prx5 recombinant protein comprises the steps of transforming host cells by using the expression vector, and culturing a transformant to obtain the penaeus monodon peroxide reductase Prx5 recombinant protein.

Wherein, the host cell of the invention is a prokaryotic cell or a eukaryotic cell. Further preferred is Escherichia coli BL21(DE 3).

The invention provides a penaeus monodon peroxide reductase Prx5 recombinant protein, which is prepared by a method comprising the steps of transforming host cells by using the expression vector, culturing a transformant and obtaining the penaeus monodon peroxide reductase Prx5 recombinant protein from the culture.

The fourth purpose of the invention is realized by the following technical scheme: the penaeus monodon peroxide reductase Prx5 recombinant protein is applied to the preparation of drugs with shrimp antibacterial efficacy or shrimp immunity enhancing efficacy.

The invention discovers through experiments that: the penaeus monodon peroxide reductase Prx5 recombinant protein comprises prokaryotic or eukaryotic expression recombinant protein expressed by the DNA sequence, the antioxidant enzyme activity of the prokaryotic or eukaryotic expression recombinant protein is measured in vitro, the antibacterial effect of the recombinant prawn Prx5 binding protein is detected by an agarose diffusion method, in addition, the protection effect of the penaeus monodon peroxide reductase Prx5 recombinant protein on escherichia coli stressed by heavy metal is detected, and in a living body of the penaeus monodon, the recombinant protein can improve the immunity of the penaeus monodon stimulation of gram-positive bacteria and gram-negative bacteria and can improve the survival rate of the penaeus monodon.

The invention has the beneficial effects that:

(1) the invention obtains a new cDNA sequence of the penaeus monodon peroxidase reductase gene Prx5 from a penaeus monodon sample, and finds that the sequence can be efficiently expressed in eukaryotic or prokaryotic cells through the functional research of a genetic engineering technology;

(2) the invention also clones the cDNA sequence of the penaeus monodon peroxide reductase gene Prx5 to a prokaryotic or eukaryotic expression vector, transforms escherichia coli competent cells, obtains recombinant protein thereof through the induced expression of positive clones, and researches show that the penaeus monodon peroxide reductase gene Prx5 is stimulated by vibrio harveyi and streptococcus agalactiae and then is up-regulated and expressed in immune organs, the recombinant protein has the function of inhibiting the growth of bacteria, the recombinant protein of the gene in the escherichia coli can improve the survival rate of the escherichia coli after being stressed by heavy metal, and the increase phenomenon of death rate caused by harmful stimulation can be reduced in the live injection experiment of the penaeus monodon, thereby revealing that the penaeus monodon peroxide reductase gene Prx5 can be used as a shrimp antibacterial or shrimp immunity enhancing medicine.

Drawings

FIG. 1 is the blastP result of the peroxiredoxin gene Prx5 of Penaeus monodon, containing Prx5-like domain and Thioredoxin (TRX) -like subfamily domain;

FIG. 2 is a real-time quantitative PCR analysis of the Penaeus monodon peroxiredoxin gene Prx 5. 1. An ovary; 2. a heart; 3. the liver pancreas; 4. gills; 5. the brain and intestine; 6. a bowel; 7. a muscle; 8. the thoracic nerve; 9. the stomach; 10. lymph fluid; 11. blood, the internal reference gene is EF-1 alpha;

FIG. 3A is the Prx5 expression pattern in gills of Penaeus monodon after bacterial stimulation (Vibrio harveyi and Streptococcus agalactiae), with the internal reference being EF-1 α, representing P <0.05, representing P < 0.01;

FIG. 3B shows the expression profile of Prx5 in hepatopancreas after bacterial stimulation (Vibrio harveyi and Streptococcus agalactiae), with the internal reference being EF-1 α, representing P <0.05, representing P < 0.01;

FIG. 4A is the expression pattern of Prx5 in gill of Penaeus monodon stressed by Cu, Zn and Cd, the internal reference gene is EF-1 alpha, which represents P <0.05, and P < 0.01; reference gene and statistics are the same under the meaning;

FIG. 4B is an expression profile of Prx5 in hepatopancreas after the penaeus monodon is stressed by copper, zinc and cadmium;

FIG. 4C is an expression map of Prx5 in gills of penaeus monodon stressed by seawater conditions of different pH values;

FIG. 4D is an expression profile of Prx5 in the hepatopancreas, after penaeus monodon is stressed by seawater conditions of different pH;

FIG. 4E is an expression profile of Prx5 in gills of Penaeus monodon after high and low salt stress;

FIG. 4F is an expression profile of Prx5 in the hepatopancreas after high and low salt stress of Penaeus monodon;

FIG. 5 shows fusion expression protein of Penaeus monodon Prx5 gene in Escherichia coli, where M represents protein marker; 1 represents the IPTG-induced protein of Escherichia coli BL21 strain of empty vector pRSET; 2.3 and 4 represent proteins of escherichia coli BL21 recombinant strains with the recombinant vector pRSET-Prx5 after 8, 6 and 0h of IPTG induction; panel A shows total proteins in E.coli and panel B shows Prx5 protein after Western blot screening;

FIG. 6 shows antioxidant activity of recombinant Penaeus monodon Prx5 protein at different doses;

FIG. 7 is a test of the in vitro antibacterial effect of the recombinant protein Prx5 of Penaeus monodon on against bacteria, Streptococcus agalactiae in the A plate; vibrio harveyi is arranged in the plate B;

FIG. 8 shows the heavy metal stress resistance effect of the Penaeus monodon Prx5 recombinant protein in E.coli; a picture is a bacteriostatic circle of escherichia coli BL21 transferred into an empty vector pRSET after being stressed by 1mol/L heavy metal; b picture is the inhibition zone of Escherichia coli BL21 recombinant strain with recombinant vector pRSET-Prx5 after being stressed by 1mol/L heavy metal; c picture is the inhibition zone of Escherichia coli BL21 transferred into empty vector pRSET after being stressed by 0.1mol/L heavy metal; d, a graph is the inhibition zone of an escherichia coli BL21 recombinant strain with the recombinant vector pRSET-Prx5 stressed by 0.1mol/L heavy metal, and E is the statistics of the diameter of the inhibition zone in the graphs A and B; panel F is a statistic of zone diameters in panels C and D;

FIG. 9 shows the antibacterial effect of the recombinant protein Prx5, a peroxiredoxin of Penaeus monodon, in living bodies of Penaeus monodon.

Detailed Description

The invention is further illustrated below by the following specific embodiments, to which, however, the invention is not at all restricted.

1. Extraction of Total RNA and construction of liver pancreatic full-Length cDNA library

1.1 extraction of Total RNA

Fresh and healthy penaeus monodon (the weight is about 50g) is taken to be temporarily cultured in Shenzhen base of Nanhai aquatic research institute of Chinese aquatic science institute for one week (7d), the temperature is about 24 ℃ during temporary culture, the salinity is about 33 per mill, continuous aeration is carried out, about 50mg of hepatopancreas tissues of the penaeus monodon are taken out after dissection, the hepatopancreas tissues are rapidly frozen and stored in liquid nitrogen, and then TRIzol reagent of Yingjun company is used for extracting the total RNA of the hepatopancreas tissues according to the instruction of reagent use. And (4) detecting the concentration, purity and integrity of the extracted total RNA, and freezing and storing the total RNA in a refrigerator at the temperature of-80 ℃ for later use after the total RNA is detected to be qualified.

1.2 preparation of full-Length hepatopancreata cDNA template

Using SMART 5 'RACE and 3' RACE kits (TaKaRa, Japan), 1. mu.g of total RNA was reacted at 42 ℃ for 1 hour under the action of reverse transcriptase according to the instruction requirements to synthesize the first strand of cDNA, and linkers were added to both ends of the template under the action of DNA polymerase and DNA ligase using the first strand as a template, finally obtaining a template for cloning full-length cDNA.

2. Clone of Penaeus monodon peroxide reductase gene Prx5 gene cDNA complete sequence

2.1 validation of core fragments

In a penaeus monodon transcriptome database, obtaining a Prx5 splicing sequence according to the gene annotation information, and designing a specific primer according to the splicing sequence, wherein the primer sequence is as follows:

an upstream primer 5'-ATGGCGACTCTCATGGCT-3';

the downstream primer 5'-CTACAACTGAGCCATGGTGTT-3'.

Wherein the upstream primer comprises a start codon, and the amplified fragment has a size of about 570 bp.

ATGGCGACTCTCATGGCTCTCCAGCTCCGGCCAGTTCTCAGTCGTGCTGGGACAGCCACCCTCTCCCACCTCCACAAAACCATCGCCAGAGCAATGTCCATTAAGGTTGGTGATGAGATTCCCAGTGTGGATCTCTTTGAAGAGACCCCAGCAAATAGTGTCAACTCACGTGACCTGTGTGCTGGCAAGAAGGTTCTGATCTTTGCTGTGCCAGGTGCCTTCACCCCAGGATGCTCAAAGACTCATTTACCAGGATATGTCAGCAGTGCTGATGCCATCAAAGCCAAGGGTATCAGTGAAATTGTGTGTGTGTCCGTCAATGACCCCTTTGTTATGAGTGCCTGGGGCCAGAACCAGGAAACAGGAGAGAAGGTTCGAATGCTGGCCGACACCAATGGAGATTTCACCAAAGCCCTTGGCCTGGAGCAAGATCTGGCTGTGTTGGGAGGCCTTCGATCAAAACGCTACTCCATGGTTGTGGAAGATGGCAAGATCACCCAGCTGAATGTGGAACCTGATGGGAAGGGTCTCTCATGCTCTCTGGCAGATAACACCATGGCTCAGTTGTAG

Partial sequence of Prx5 gene

The synthesized cDNA is used as a template, and PCR amplification is carried out by using a specific primer, wherein the reaction system is as follows: mu.L of cDNA template, 1. mu.L of each of the 10nmol/L upstream and downstream primers, 2. mu.L of 10mmol/L dNTP, 2.5. mu.L of 10 XExtaq buffer, and 17. mu.L of ultrapure water, totaling to 25. mu.L.

The PCR reaction conditions are as follows: denaturation at 94 deg.C for 3 min; high temperature denaturation at 94 ℃ for 30s, low temperature annealing at 56 ℃ for 30s, and extension at 72 ℃ for 1min for 30s, for 33 cycles; extending for 10min at 72 ℃; keeping the temperature at 4 ℃.

And after the amplified PCR product is detected to be qualified by 1.2% agarose gel electrophoresis, purifying and recovering the PCR product of the target fragment from the gel.

The purified PCR product was ligated into pUC-19T vector, transformed into E.coli competent cell DH-5. alpha. and single strains of positive clones were picked up for blue-white screening, amplified by shaking for 6 hours at 37 ℃ in a cell culture incubator at 220rpm, extracted with plasmid DNA and sequenced with the universal primer M13.

2.2 obtaining of full-Length cDNA of Prx5 from Penaeus monodon

Specific primers were designed based on the sequence of the cDNA fragments obtained. The 3' end of the target gene is subjected to PCR Amplification by using a Rapid Amplification of CDNA Ends (RACE) technique.

Synthesizing 3' RACE primers 5'-ACAGATAAACAGATCAAATTCAAGG-3' and 5'-ATGCTGGCCGACACCAATGGAGAT-3' according to the sequence, adopting the synthesized full-length cDNA as a template and adopting a falling typePCR and nested PCR methods, according to

RACE 5'/3' kit (TaKaRa, Japan) was used for 3' RACE PCR amplification. The first reaction system is 20 mu L, and the first amplification conditions are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 72 ℃ (1 ℃ per cycle) for 30s, and cooling at 1 ℃ per cycle, wherein the annealing temperature is reduced by 1 ℃ per cycle for 10 cycles; extending for 1.5h at 72 ℃; denaturation at 95 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 1.5min for 25 cycles; extending for 10min at 72 ℃; storing at 4 ℃.

The second amplification system is 50mL, and the second amplification conditions are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 1.5min for 30 cycles; extension at 72 ℃ of 10 miin; storing at 4 ℃.

The obtained PCR product is separated by 1.2% agarose gel electrophoresis, the target product is purified and recovered from the gel, then the target product is cloned into a PUC-19T vector, T7 and SP6 are subjected to sequencing reaction to obtain a nucleic acid sequence of 1232bp of a 3' RACE fragment, and the full-length cDNA obtained after splicing is 1686 bp.

2.3 bioinformatics analysis of Penaeus monodon Prx5

TABLE 1 Blast homology analysis results

Blast analysis result of peroxidase Gene Prx5

Homology analysis was performed using Blast (http:// www.ncbi.nim.nih.gov /), and as a result, as shown in Table 1 above, the gene has high homology with prx5 proteins of Typha giganteus (Oryces bornicus), Culex quinquefasciatus (Culex quinquefasciatus), and Chrysomyia collecticola (Nasonia viripenenis), etc., and it was revealed that the gene was the prx5 gene. Bioinformatic analysis using DNAstar et al revealed that the initiation codon ATG was located at nucleotides 77-79, the stop codon was located at nucleotides 644 and 646 and the open reading frame was 570 nucleotides, presumably encoding a 190 amino acid protein. The 5' UTR is 76bp, the 3' UTR is 1040bp, and a typical tailing signal AATAAA exists in the 3' UTR. The predicted molecular mass is 20 kDa. The proteins were analyzed by ExPASy software and SignalIP software for the presence of a typical Prx5 tag domain at amino acids 70-85 and 173-181 and two conserved cysteines at amino acids 78 and 179 (FIG. 1), revealing to be an atypical 2-cysteine (Cys) peroxiredoxin Prx 5.

The nucleotide sequence of the penaeus monodon peroxidase reductase gene Prx5 and the amino acid sequence deduced therefrom are shown below, each row of numbers representing a nucleotide or amino acid position; boxed positions represent the Prx5 nucleotide sequence start codon (ATG) and terminator codon (TAA); the grey shaded portion represents the thioredoxin superfamily signal region; the single horizontal line represents a redox active site; the double horizontal line in the amino acid sequence represents active cysteine; bold letters represent the polyadenylation signal sequence (AATAAA); italics represent the poly (A) signal sequence.

3, detecting the distribution of the penaeus monodon Prx5 in different tissues of the penaeus monodon by PCR

RNA of different tissues (including ovary, heart, liver pancreas, gill, brain intestine, muscle, thoracic nerve, stomach, lymph fluid and blood) of the penaeus monodon is extracted. The method for extracting total RNA is described above. Separately, 1. mu.g of total RNA from different tissues was mixed with 0.5mL of reverse transcription primer Oligo- (dT) (50. mu. mol/L) and 0.5. mu.L of Random 6mers (100. mu. mol/L), and then 5 XPrimeScript buffer 2. mu.L and reverse transcriptase mixture PrimeScript RT Enzyme Mix I0.5. mu.L were added to make up to 10. mu.L with water. The reaction process is 15min at 37 ℃ and 5s at 85 ℃, and the diluted solution is used as a template after being diluted by 10 times.

Real-time fluorescent quantitative PCR was performed using primers qPmPrx5-F (5'-ATGCTGGCCGACACCAATGGAGAT-3') and qPmPrx5-R (5'-TAACAATGCCTCCATTCTGGGAAA-3') to amplify the Prx5 gene, the housekeeping gene EF-1 α (GenBank: DQ021452.1) (EF-F5'-ATGGTTGTCAACTTTGCCCC-3', EF-R5'-TTGACCTCCTTGATCACACC-3') as an internal reference, and the above-synthesized cDNA as a template.

The reaction was performed in 25. mu.L total, containing 12.5. mu.L of 2 XSSYBR Pre-Mix ExTaq (TaKaRa, Dalian, China), 2. mu.L of cDNA template, 1. mu.L of 10. mu. mol/L forward and reverse primers, and 8.5. mu.L deionized water. The PCR reaction condition is pre-denaturation at 94 ℃ for 30 s; denaturation at 94 ℃ for 5s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s for a total of 40 cycles. The dissolution curve analysis was 65-95 ℃ to ensure amplification of each single product. Through 2^-ΔΔCtThe method analyzes the relative expression level of the prax 5 of the penaeus monodon. As a result, as shown in FIG. 2, it was found that expression was observed in all tissues, with the lowest graduation of expression in thoracic nerve and ovary, and with high peak expression in immune tissues and muscles such as gill, hepatopancreas, hemolymph, etc.

4, detecting the expression of mRNA of the penaeus monodon peroxidase reductase gene Prx5 under different immune stimulation conditions by PCR

At present, pathogens and environmental toxins pose serious threats to the development of the worldwide prawn farming industry, and cause huge economic losses to the prawns. It includes some gram-positive bacteria (such as Streptococcus agalactiae), gram-negative bacteria (such as Vibrio harveyi), heavy metals (such as cadmium Cd, zinc Zn, copper Cu), and salinity and pH changes of seawater environment. Bacterial and environmental stresses often cause phagocytosis of cells, producing ROS, which activate the body's antioxidant system. In the antioxidant system, the Prx family has antioxidant and immune functions and can participate in the innate immune process of the body. Prx5 was the latest family member found in this family, and to determine whether Prx5 was involved in this process, corresponding bacterial and environmental stimuli expression experiments were performed.

Healthy Penaeus monodon is injected with 100 μ L of 1 × 10⁸CFU/mL density of Vibrio harveyi and Streptococcus agalactiae, control group injected with 100. mu.L PBS buffer (NaCl 137mM, KCl 2.7mM, Na)₂HPO₄ 10mM，KH₂PO₄2mM, pH7.4), the injection site is positioned at the second abdominal node for centripetal injection, and gill and liver-pancreas tissues are taken 0, 6, 12, 24, 48, 72 and 96 hours after the injection and are cut into piecesThen quickly freezing and storing in liquid nitrogen, and finally quickly transferring to a refrigerator at the temperature of minus 80 ℃ for storage. In addition, the concentrations of copper (solute: CuSO) were set to 0.18mg/L, respectively₄·5H₂O), 0.506mg/L zinc (solute is ZnSO)₄·7H₂O) and 7.73mg/L cadmium (solute CdCl)₂·2.5H₂O), pH 7.0 + -0.1, pH 9.0 + -0.1, salinity of 23 ‰ 43 ‰ seawater, placing healthy Penaeus monodon into the seawater for stress, and normal seawater (salinity of 33 ‰, pH 8.0 + -0.1, temperature 25 + -1 deg.C) as control group. Taking gill and liver pancreas at 0, 6, 12, 24, 48 and 96 hours respectively in the heavy metal and pH value stress process; in the process of high and low salt stress, gill and liver pancreas are taken at 0, 4, 8, 16 and 32 hours respectively, and the sample preservation method is the same as the above.

The total RNA extraction method and the reverse transcription cDNA method are described above. Designing fluorescent quantitative PCR primers according to the whole cDNA of the prax 5 gene of the penaeus monodon, and simultaneously selecting EF-1 alpha as an internal reference gene, wherein the internal reference gene primers are described above. The quantitative system and the reaction procedure were as described above. The results are shown in fig. 3A, fig. 3B, fig. 4A, fig. 4B, fig. 4C, fig. 4D, fig. 4E and fig. 4F, and the prax 5 gene of penaeus monodon in gill and liver pancreas was significantly up-regulated after the injection of vibrio harveyi and streptococcus agalactiae, which indicates that the prax 5 of penaeus monodon was involved in immune process after bacterial stimulation and was an immune response expression protein.

5. Preparation of penaeus monodon Prx5 fusion protein

Using cDNA as a template, amplifying all open reading frames of Prx5 by PCR, wherein PCR primers are rPmPrx 5-F: 5'-CGACGATGACGATAAGGATCCATGGCGACTCTCATGGCT-3', respectively; rPmPrx 5-R: 5'-ATGGCGACTCTCATGGCTCTACAACTGAGCCATGGTGTT-3' are provided. The PCR reaction conditions were 94 ℃ for 3min, 94 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 50s, for 30 cycles. Cloning the PCR product into pRSET plasmid to constitute recombinant plasmid pRSET-PmPrx5 (wherein Pm refers to Penaeus monodon), and transforming the recombinant plasmid pRSET-PmPrx5 into Escherichia coli BL21(DE3) strain. Simultaneously, the empty plasmid pRSET was transformed into E.coli BL21(DE3) strain at the same time and used as a control. Two types of E.coli BL21 cells were expanded in LB medium containing 100. mu.g/mL ampicillin. When the OD600 of the E.coli BL21 cell solution reached between 0.4 and 0.6, isopropyl-. beta. -D-thiogalactopyranoside (IPTG) was added to LB medium at a final concentration of 1mol/L, and induced for expression at 37 ℃ and 220rpm for 8 hours. The recombinant Penaeus monodon Prx5 protein was purified by Ni-NTA affinity chromatography according to the His-binding Purification Kit (Novagen). The purified protein was confirmed by SDS-PAGE and Western blot to have a band around 41kDa, which removed about 21KD of the vector-added 6 XHis tag fusion protein, consistent with the above predicted 20kDa for Prx5 protein of Penaeus monodon (see FIG. 5). The concentration of prax 5 protein from shrimp zebra was determined using a modified BCA protein assay kit (raw, shanghai, china). The purified recombinant prax 5 protein was then stored in an ultra low temperature freezer at-80 ℃ for use.

6. Determination of antioxidase Activity, antibacterial Activity and anti-heavy Metal Activity of recombinant Prx5 protein

According to the principle that peroxidase can catalyze hydrogen peroxide reaction, the antioxidant activity of the protein coded by the prax 5 gene of the prawns monodon is measured. Adding specified reagent and protein into peroxide test box (Nanjing Jiancheng bioengineering institute, Nanjing, China) according to the instruction, reacting at 37 deg.C for half an hour, adding color reagent, centrifuging at 3500rpm for 10min, cooling, and measuring OD_420nmThe absorbance value of (b) was calculated according to the specification formula, and the PmPrx5 protease activity was calculated. In addition, the study carried out the determination of the dosage activity of different Penaeus monodon Prx5 recombinant proteins, namely 10 μ g and 20 μ g of PmPrx5 protein were added into each system and the determination was carried out at 37 ℃, and the result shows that the protein is a dosage-dependent protein (FIG. 6).

In the detection of the in vitro antibacterial activity of the recombinant pRSET-PmPrx5 protein, firstly, respectively coating Vibrio harveyi and Streptococcus agalactiae on agar nutrient plate culture media, and culturing at 37 ℃ for 16-18 h for activation; then respectively picking single colonies, inoculating the single colonies into an LB liquid culture medium, and culturing at 37 ℃ for 16-18 h for amplification culture; respectively taking 0.1mL of vibrio harveyi and streptococcus agalactiae bacterial liquid, uniformly coating the liquid on an LB agar plate, respectively soaking aseptic paper sheets in pRSET-PmpPrx 5 protein (recombinant protein), pRSET protein (empty plasmid protein) and PBS with the same concentration, and then pasting the paper sheets on the plate culture medium to ensure that the distance between the paper sheets is more than or equal to 24 mm. And (3) making three strains of each strain in parallel, after paving, placing the flat plate in a constant temperature box, culturing for 16-18 h at 37 ℃, and then detecting the bacteriostatic effect of the recombinant protein on the two strains. The result shows that the penaeus monodon recombinant Prx5 protein has strong dissolving activity on vibrio harveyi and streptococcus agalactiae. Purified pRSET protein (empty plasmid protein) and PBS had no antibacterial properties (see fig. 7). The result shows that the antibacterial performance of the purified penaeus monodon Prx5 recombinant protein shows that the purified penaeus monodon Prx5 recombinant protein has selective effect on inhibition of pathogenic bacteria, and the protein is more sensitive to Vibrio harveyi.

In the detection of the recombinant pRSET-PmPrx5 protein in the escherichia coli to protect the escherichia coli stressed by heavy metal, firstly, the escherichia coli is coated on an agar nutrient plate culture medium and cultured for 16-18 h at 37 ℃ for activation; then respectively picking single colonies, inoculating the single colonies into an LB liquid culture medium, and culturing at 37 ℃ for 16-18 h for amplification culture; 0.1mL of Escherichia coli is evenly coated on an LB agar plate, and a sterile paper sheet is respectively soaked in 0.1mol/L and 1mol/L CuSO₄、ZnSO₄、CdCl₂In solution, the control group was PBS. Then, the paper pieces are pasted on the plate culture medium, the distance between the paper pieces is more than or equal to 24mm, the parallelism of three heavy metal solutions is guaranteed, after the paper pieces are paved, the plate is placed in a constant temperature box, the paper pieces are cultured for 16-18 h at 37 ℃, and then the protection effect of the recombinant proteins of the escherichia coli under the stress of heavy metals is detected (figure 8). The results show that Escherichia coli with recombinant protein Prx5 is resistant to CuSO₄Solution and ZnSO₄The solution has obvious resistance to CdCl₂The solution was weakly resistant.

7. Antibacterial function research of Penaeus monodon Prx5 recombinant protein in Penaeus monodon living body

In order to further determine the antibacterial effect of the Prx5 recombinant protein of the penaeus monodon, the antibacterial effect research of the living body of the penaeus monodon injected with the Prx5 recombinant protein is carried out. Healthy penaeus monodon is selected and averagely divided into 4 groups of 30 penaeus monodon tails, and three groups of the penaeus monodon tails are arranged in parallel. Wherein 2 groups are control groups (PBS + Vibrio harveyi, PBS + Streptococcus agalactiae), and 2 groups are experimental groups (Prx5+ Vibrio harveyi and Streptococcus agalactiae) of Vibrio harveyi and Streptococcus agalactiae respectivelyVibrio harveyi, Prx5+ streptococcus agalactiae). In the control group, 50. mu.L of sterilized PBS (pH7.4) was injected into Penaeus monodon; 50 μ L of Penaeus monodon Prx5 recombinant protein (3 μ g/g) was injected into Penaeus monodon in the experimental group. After 12h, the experimental and control groups were each injected with 50. mu.L of Vibrio harveyi suspension (0.3X 10)⁹CFU/mL) or 50. mu.L of Streptococcus agalactiae suspension (each line represents an injection method, and as shown in FIG. 9, "PBS + Vibrio harveyi" means that PBS is injected first and then Vibrio harveyi is injected overnight) (0.3 x 10⁹CFU/mL). The death status of each group was recorded after 12, 24, 48, 72, 96 h. The results show that the mortality rate of the penaeus monodon Prx5 recombinant protein experimental group is obviously lower than that of the control group (figure 9).

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents and are included in the scope of the present invention.

Sequence listing

<110> research institute for aquatic products in south China sea

<120> penaeus monodon peroxidase reductase gene Prx5 and application thereof

<150> 2017106743815

<151> 2017-08-09

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1686

<212> DNA

<213> peroxide reductase (Prx5)

<400> 1

acagataaac agatcaaatt caaggttgga agcagagcgg cgttcgagca gcaccgtcgg 60

taataaggga gcgacgatgg cgactctcat ggctctccag ctccggccag ttctcagtcg 120

tgctgggaca gccaccctct cccacctcca caaaaccatc gccagagcaa tgtccattaa 180

ggttggtgat gagattccca gtgtggatct ctttgaagag accccagcaa atagtgtcaa 240

ctcacgtgac ctgtgtgctg gcaagaaggt tctgatcttt gctgtgccag gtgccttcac 300

cccaggatgc tcaaagactc atttaccagg atatgtcagc agtgctgatg ccatcaaagc 360

caagggtatc agtgaaattg tgtgtgtgtc cgtcaatgac ccctttgtta tgagtgcctg 420

gggccagaac caggaaacag gagagaaggt tcgaatgctg gccgacacca atggagattt 480

caccaaagcc cttggcctgg agcaagatct ggctgtgttg ggaggccttc gatcaaaacg 540

ctactccatg gttgtggaag atggcaagat cacccagctg aatgtggaac ctgatgggaa 600

gggtctctca tgctctctgg cagataacac catggctcag ttgtagattg atgggatgga 660

gggtagtact ttgatgctgt ttatgttgta atgaaaaatt atgattgatt ttcccagaat 720

ggaggcattg ttagcaacaa atgacactgt aatagcttta atataggatt tccaggtgaa 780

caggaagaga gttgttctgc tttaggttgt tttctgaatt tcagctgtgt aatcctgtgt 840

ttgttcattc ttggacacta agttggtgct tgaatgtacg gaaataaaaa ggaaatatac 900

taaaacttat gacaagacat atcataatga gtaaatcact aaacaggaca taaaaagaaa 960

gtacttaata atttgaccaa ttggtattac tttccttctg aagaaattat atcagttggt 1020

agatatggga ttactgtcag tcagtagcta tgggattcaa tggtattttg catttcaact 1080

ttgtacaagg catttcttaa tggtcaccat atatgactcg agtcatgtag acaaatgtta 1140

attactgatg ataaaaagta gcaatagtaa gttcctgtaa atacctaaga gttttattgt 1200

ttaaactgca gattgcataa tacaatggtt atacaagcag ttgattccac agcaagatca 1260

attgaagctt atgttgcaaa atgcatcatc tacaccagtt gtagatccat ggactttact 1320

gtgatggcaa aagtggctgt gagtttatca agaaactcag tagctctttc ttttattgca 1380

gtgtctcagg aatgcggctt ggttatttct gattagagct gtcctgaata agttactcat 1440

ttaacataat tacaagacag tgcattctac aattatattg aatatttatt ttttatttct 1500

tggtacaaac ttgtgactta caaaatgtaa gacagttgat ccatatattt atgaaaatta 1560

gcaaatgaat cattgaagag aaccgtttct gacgaaagta tttcataatt gtaccagttt 1620

tgtaaatgtg atgcatttaa gcaaataaaa atcagattac caaaaaaaaa aaaaaaaaaa 1680

aaaaaa 1686

<210> 2

<211> 189

<212> PRT

<213> peroxide reductase (Prx5)

<400> 2

Met Ala Thr Leu Met Ala Leu Gln Leu Arg Pro Val Leu Ser Arg Ala

1 5 10 15

Gly Thr Ala Thr Leu Ser His Leu His Lys Thr Ile Ala Arg Ala Met

20 25 30

Ser Ile Lys Val Gly Asp Glu Ile Pro Ser Val Asp Leu Phe Glu Glu

35 40 45

Thr Pro Ala Asn Ser Val Asn Ser Arg Asp Leu Cys Ala Gly Lys Lys

50 55 60

Val Leu Ile Phe Ala Val Pro Gly Ala Phe Thr Pro Gly Cys Ser Lys

65 70 75 80

Thr His Leu Pro Gly Tyr Val Ser Ser Ala Asp Ala Ile Lys Ala Lys

85 90 95

Gly Ile Ser Glu Ile Val Cys Val Ser Val Asn Asp Pro Phe Val Met

100 105 110

Ser Ala Trp Gly Gln Asn Gln Glu Thr Gly Glu Lys Val Arg Met Leu

115 120 125

Ala Asp Thr Asn Gly Asp Phe Thr Lys Ala Leu Gly Leu Glu Gln Asp

130 135 140

Leu Ala Val Leu Gly Gly Leu Arg Ser Lys Arg Tyr Ser Met Val Val

145 150 155 160

Glu Asp Gly Lys Ile Thr Gln Leu Asn Val Glu Pro Asp Gly Lys Gly

165 170 175

Leu Ser Cys Ser Leu Ala Asp Asn Thr Met Ala Gln Leu

180 185

Claims (6)

1. A cDNA of a penaeus monodon peroxide reductase gene Prx5 is characterized in that: the nucleic acid sequence of the cDNA is shown as SEQ ID NO. 1.

2. A penaeus monodon peroxide reductase Prx5 is characterized in that: the amino acid sequence of the Prx5 is shown in SEQ ID NO. 2.

3. An expression vector comprising the cDNA of claim 1.

4. The preparation method of the penaeus monodon peroxide reductase Prx5 recombinant protein comprises the steps of transforming escherichia coli by using the expression vector of claim 3, and culturing a transformant to obtain the penaeus monodon peroxide reductase Prx5 recombinant protein.

5. The method of claim 4, wherein: the Escherichia coli is Escherichia coli BL 21.

6. The use of the penaeus monodon peroxiredoxin Prx5 according to claim 2 in the preparation of a medicament having shrimp antibacterial efficacy, said bacteria being Vibrio harveyi or Streptococcus agalactiae.

Images