CN106497962B - One plant of trichoderma engineering bacteria for being overexpressed lae1 gene and its construction method and application - Google Patents
One plant of trichoderma engineering bacteria for being overexpressed lae1 gene and its construction method and application Download PDFInfo
- Publication number
- CN106497962B CN106497962B CN201610899151.4A CN201610899151A CN106497962B CN 106497962 B CN106497962 B CN 106497962B CN 201610899151 A CN201610899151 A CN 201610899151A CN 106497962 B CN106497962 B CN 106497962B
- Authority
- CN
- China
- Prior art keywords
- lae1
- follows
- application
- pcr
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/60—Vectors containing traps for, e.g. exons, promoters
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The trichoderma engineering bacteria and its construction method that are overexpressed lae1 gene the present invention relates to one plant and application.Construction method includes the following steps: that (1) extracts genomic DNA from trichoderma SMF2, and through PCR amplification, the area lae1 gene ORF and terminator sequence is made；(2) area gene ORF lae1 and terminator sequence are connect after digestion with the carrier of same digestion, recombinant plasmid is made；(3) it by recombinant plasmid transformed competence colibacillus cell, is made and is overexpressed plasmid；(4) plasmid will be overexpressed through linearization for enzyme restriction, protoplast is then converted, the trichoderma engineering bacteria for being overexpressed lae1 gene is made.The trichoderma engineering bacteria for the overexpression lae1 gene that the present invention constructs can significantly improve the yield of trichoderma peptaibols, facilitate the application of trichoderma peptaibols in medicine and agriculturally.
Description
Technical field
The trichoderma engineering bacteria and its construction method that are overexpressed lae1 gene the present invention relates to one plant and application, belong to biological work
Journey technical field.
Background technique
Trichoderma (Trichoderma spp.) is a kind of important fungus resource, is industrial important enzyme preparation production bacterium
The production bacterial strain of important biological prevention and control agent and plant growth promoter in strain and agricultural production.Trichoderma can generate a variety of times
Grade metabolite, these secondary metabolites play in trichoderma and causal organism, trichoderma and the interaction process of plant
Important role.
Peptaibols is the special peptides cometabolism that one kind that filamentous fungi generates is rich in α-aminoacid (Aib)
Product, molecular weight usually in 500~2200Da, contain 5~20 amino acid residues, and majority is 15~20 residues；Its N-
Terminal alkylations (usual acetylation), C- terminal hydroxyl, usually phenylalaninol (Benedetti et al., 1982).
The amphiphilic architectural characteristic of Peptaibols makes its multiple molecule be capable of forming the ion channel that charge relies on lipid bilayer,
It is the important biomolecule active peptide for studying large biological molecule and biological membrane interaction.It is anti-that research also found that peptaibols has
Bacterium, antiviral and antitumor, induction plant generate the various biologicals such as resistance activity, all have very in agricultural and field of medicaments
Good application potential.
Trichoderma is the main producing bacterial strain of peptaibols class secondary metabolite, it has been found that peptaibols 80%
From fungus Trichoderma, especially T.viride, T.brevicompactum, T.virens, T.parceramosum and
T.harzianum.The trichoderma SMF2 bacterial strain that we screen can generate the long-chain containing 20 amino acid residues
Peptaibols component Trichokonins A and middle long-chain peptaibols component containing 11 amino acid residues
Trichokonins B, wherein the highest component of yield is long-chain peptaibols component Trichokonin VI.The study found that
Trichokonin VI has the antibacterial activity of wide spectrum, is able to suppress the growth of gram-positive bacterium and fungi, inducing fungal
The programmed cell death of cell；By activating Ca2+Signal transduction pathway causes the apoptosis and autophagy of liver cancer cell lines HepG2；Pass through
The defense mechanism based on salicylic acid signal transduction pathway is activated to induce plant to generate the various biologicals such as resistance activity.
Peptaibols is non-Ribosome biogenesis peptide, and the amino acid residue containing a large amount of non-protein source cannot be using existing
Some chemiluminescent polypeptide synthetic method production, therefore biosynthesis is its main production method, but current yield is lower, is lacked
Efficient production bacterial strain.The Alamethicin of Sigma aldrich company is only commercialization peptaibols, and price
Valuableness is unable to satisfy peptaibols in the application of agricultural and field of medicaments.
Summary of the invention
The trichoderma engineering bacteria for being overexpressed lae1 gene in view of the deficiencies of the prior art, the present invention provides one plant and its building side
Method and application.
Technical scheme is as follows:
The construction method of the trichoderma engineering bacteria of one plant of overexpression lae1 gene, includes the following steps:
(1) genomic DNA is extracted from trichoderma SMF2, then carries out PCR amplification, system by template of genomic DNA obtained
Obtain the area lae1 gene ORF and terminator sequence；The PCR specific primer sequences of the area lae1 gene ORF and terminator sequence are such as
Under:
Lae1OE-F:CATGccatggCCTCTCGAAACGCTCCCAAC；
Lae1OE-R:CCCaagcttCTAGCTAACCTGTTGCTGTAC；
(2) by the area gene ORF lae1 and terminator sequence made from step (1) after NcoI and HindIII double digestion, with
Equally the carrier pIG-1783 through NcoI and HindIII double digestion is attached, and recombinant plasmid is made；
(3) by recombinant plasmid transformed E.coliDH5 α competent cell made from step (2), through Amp containing ampicillin
LB Screening of Media, extract recombinant expression carrier, be made be overexpressed plasmid pIG1783-lae1OE；
(4) then step (3) the plasmid pIG1783-lae1OE obtained that is overexpressed is turned through HindIII linearization for enzyme restriction
Change protoplast, through regeneration, primary dcreening operation, secondary screening, the trichoderma engineering bacteria for being overexpressed lae1 gene is made.
The extraction of trichoderma SMF2 genomic DNA is referring to fungal DNA extraction kits (E.Z.N.A. in the step (1)TM
Fungal DNA Mini Kit, OMEGA) specification progress.
It is preferred according to the present invention, the PCR amplification system of the area gene ORF lae1 and terminator sequence in the step (1)
As follows, total system is 50 μ L:
The PCR amplification program is as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C are prolonged
Stretch 1min, 30 circulations；72 DEG C extend 5min eventually.
Preferred according to the present invention, NcoI and HindIII double enzyme digestion reaction system is as follows in the step (2), total system
For 20 μ L:
NcoI and HindIII double enzyme digestion reaction condition are as follows: 37 DEG C of warm bath 30min.
Preferred according to the present invention, the connection in the step (2) is attached using T4 ligase, reaction condition are as follows:
16 DEG C of connections are overnight.For coupled reaction system referring to the T4 connection enzyme reagent kit of Promega company, reaction system is 10 μ L.
Preferred according to the present invention, the step of conversion E.coliDH5 α competent cell, is as follows in the step (3):
It takes the E.coliDH5 α competent cell of -80 DEG C of preservations ice bath melted, recombinant plasmid is mixed with competent cell,
Ice bath 30min；42 DEG C of heat shock 90s, 2~3min of ice bath；Then 37 DEG C of shaking table 40~50min of shaken cultivation in LB culture medium,
4000rpm is centrifuged 1min, discards supernatant, be resuspended bacterial sediment to get.
Preferred according to the present invention, the concentration of ampicillin is 100 μ g/mL, screening conditions in the step (3) are as follows:
37 DEG C, 200rpm cultivates 12~20h.
Recombinant expression carrier small amount plasmid extraction kit (E.Z.N.A Plasmid is extracted in the step (3)
Miniprep Kit, OMEGA) plasmid is extracted, specific steps are shown in plasmid extraction kit specification, the plasmid order-checking verifying of extraction
It obtains afterwards and is overexpressed plasmid.
Preferred according to the present invention, the system of HindIII linearization for enzyme restriction is as follows in the step (4):
Preferred according to the present invention, the preparation step of protoplast is as follows in the step (4):
By the spore inoculating of trichoderma SMF2 in culture medium for mycelial growth, 28 DEG C, 160rpm culture 13h；By cultural hypha
Object 4000rpm is centrifuged 5min, is washed three times with 0.7M NaCl, each 25mL, and cell wall lysis enzymes liquid is added, and is resuspended, 30 DEG C,
60rpm digests 2.5~3h, filters, and the concentration that pre-cooling is added in filtrate is the NaCl solution of 0.7M, and NaCl solution additional amount is
5.7mL, 4 DEG C, 3800rpm is centrifuged 5min and collects protoplast, and the protoplast being collected into is molten with the STC of the 20mL 0.7M being pre-chilled
Liquid washes the STC solution resuspension that 600 μ L pre-cooling is added afterwards twice, makes protoplast concentration 5 × 107~5 × 108A/mL；
It is further preferred that the cell wall lysis enzymes liquid is prepared as follows:
0.24g cell wall lysis enzymes, are dissolved in the NaCl solution that 5.7mL concentration is 0.7M, and 0.3mL is added in filtration sterilization
The PBS buffer solution of pH5.8.
It is further preferred that the STC solution composition is as follows:
0.7M D-Sorbitol (D-S D-sorbite), 0.05M CaCl2, 10mM Tris-HCl, pH 7.5.
It is preferred according to the present invention, the conversion protoplast in the step (4), step are as follows:
It takes 150 μ L linearized plasmid solutions and 150 μ L protoplasts to mix and is added to 100mL centrifugation bottom of the tube, ice bath 20min
After 1.5mL PTC solution, ice bath 20min is added dropwise, then be placed at room temperature for 20min；STC solution is added to clean, 4 DEG C, 4000rpm
Supernatant is abandoned after centrifugation 5min.
It is further preferred that the PTC solution component is as follows:
600g/L PEG 4000 (Macrogol 4000), 10mMTris-HCl, 10mM CaCl2, pH 7.5；
It is preferred according to the present invention, regeneration, step in the step (4) are as follows:
Protoplast after conversion is resuspended through liquid regeneration culture medium, 28 DEG C overnight；Then it is forwarded to containing 100 μ g/mL
The solid regenerated culture medium of hygromycin B mixes, 28 DEG C of culture 16h；
It is preferred according to the present invention, primary dcreening operation in the step (4), step are as follows:
Protoplast after conversion is transferred to the solid regenerated culture medium containing 100 μ g/mL hygromycin Bs, 28 DEG C of culture 48h are left
The right side, until transformant out；
It is preferred according to the present invention, secondary screening in the step (4), step are as follows:
By transformant by being transferred in solid regenerated culture medium on the secondary screening culture medium containing 100 μ g/mL hygromycin Bs, 28 DEG C of trainings
3d is supported, is then gone on PDA plate；
Above-mentioned culture medium is prepared as follows:
PDB culture medium: peeling potatoes weigh 200g, and stripping and slicing adds suitable quantity of water to boil 30min, and 4 layers of filtered through gauze are added
Glucose 20g adds distilled water constant volume to 1L；115 DEG C, 30min sterilizing.
PDA culture medium: it is 2% agar powder that mass percent is added in PDB culture medium；115 DEG C, 30min sterilizing.
Culture medium for mycelial growth: the yeast extract that mass percent is 1.5% is added in PDB culture medium；115 DEG C,
30min sterilizing.
Liquid regeneration culture medium: it is 1M that sucrose to concentration is added in culture medium for mycelial growth；115 DEG C, 30min sterilizing.
Solid regenerated culture medium: it is 0.7M that sucrose to concentration is added in PDB culture medium, and it is 7g/ that agar powder to concentration, which is added,
L；115 DEG C, 30min sterilizing.
Secondary screening culture medium: it is 100 μ g/mL that hygromycin B to concentration is added in PDA culture medium.
It is preferred according to the present invention, further include PCR screening step after secondary screening in the step (4):
The genomic DNA of SMF2 and transformant is extracted, design primer amplifies promoter on plasmid pIG-1783-lae1
Whole section of sequence of Pgpd to lae1 terminator；
The primer sequence of the PCR screening is as follows:
YZlae1OE-F:GATCGCTGAGATAGGTGCCTCACTG；
YZlae1OE-R:CTAGCTAACCTGTTGCTGTAC；
It is further preferred that the PCR system is as follows, reaction system is 20 μ L:
It is further preferred that the PCR response procedures are as follows:
95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C of extension 1min30sec, 30 are followed
Ring；72 DEG C extend 5min eventually.
It is preferred according to the present invention, further include RT-PCR screening step after secondary screening in the step (4):
The RNA for extracting SMF2 and transformant, measures its purity and concentration with ultraviolet micro-spectrophotometer Nano-100.
The RNA of SMF2 and transformant is extracted referring to the PrimeScript of TaKaRaTM RT reagent Kit with
GDNA Eraser kit.
With the PrimeScript of TaKaRaTMRT reagent Kit with gDNA Eraser kit carries out RNA
The removal and reverse transcription of DNA, according to the concentration of the RNA sample of measurement, according to the DNA in kit specification removal sample, instead
Answering system is 10 μ L, and 2 μ g total serum IgEs, 42 DEG C of incubation 2min or room temperature 5min are added in each system.To remove the RNA sample of DNA according to
Reverse transcription is carried out according to kit specification, reaction system is 20 μ L, 37 DEG C of incubation 15min, 85 DEG C, 5s.What reverse transcription obtained
CDNA be stored in -20 DEG C it is spare.
It is preferred according to the present invention, further include qRT-PCR screening step after secondary screening in the step (4):
Negate transcription product carry out qRT-PCR amplification, tef1 gene as reference gene (Seiboth et al.,
2012)。
According to the SYBR Premix Ex Taq of TaKaRaTMKit carries out qRT-PCR analysis, and PCR instrument is Roche company
LightCycler 480II, data analysis use LC480 software；When mapping, the expression quantity of tef1 gene is converted to 1, other
The expression quantity of gene carries out the conversion of equal proportion；After qRT-PCR amplified reaction, 60 DEG C~95 DEG C melting curves point are carried out
Analysis.
It is further preferred that qRT-PCR reaction system described above is as follows, reaction system is 20 μ L:
It is further preferred that qRT-PCR response procedures described above are as follows:
95 DEG C of initial denaturation 30s；PCR reacts 95 DEG C of denaturation 5s, and 55 DEG C of annealing 20s, 72 DEG C of extension 20s, 45 recycle.
It is further preferred that the primer sequence of the qRT-PCR is as follows:
Tef1-F:CCACATTGCCTGCAAGTTCGC；
Tef1-R:GTCGGTGAAAGCCTCAACGCAC；
RTlae1-F:CATGAGCATGATGCCGATGAGTGAC；
RTlae1-R:CTAGATAGCGGTAGCATCCGAGTC.
The trichoderma engineering bacteria for the overexpression lae1 gene that above-mentioned construction method obtains.
The trichoderma engineering bacteria for the overexpression lae1 gene that above-mentioned construction method obtains contains strong promoter Pgpd, may be implemented
The overexpression of filamentous fungi general transcription factor Lae1, the output increased of trichoderma peptaibols, long-chain peptaibols is in
68.96% and 42.85% has been respectively increased in the yield of long-chain peptaibols compared with starting strain, when colonial morphology starts
It is fine and close for white, it is round, it extends around, generates green spores from bacterium colony center after growth a period of time, center becomes green
Color, bacterium colony growth is rapid, has apparent wheel line, around there is the growth band of white hypha, and the entire bacterium colony of 4~5d or so all becomes
Green, pigment production and spore output increase compared with starting strain.
Above-mentioned trichoderma engineering bacteria is preparing the application in peptaibols antibacterial peptide.
Above-mentioned application, steps are as follows:
The trichoderma engineering bacteria of the overexpression lae1 gene of building is inoculated in PDB culture medium, at 28 DEG C, 180rpm is cultivated
For 24 hours, fermentation liquid is made, then 20min is centrifuged through 10000rpm, then through Agela C18It after solid phase extraction, is concentrated, system
Obtain peptaibols antibacterial peptide.
Beneficial effect
1, the function fragment of strong promoter Pgpd, lae1 sequence and its terminator is inserted into carrier by first passage of the present invention
In pIG-1783, and the protoplast of trichoderma SMF2 bacterial strain is converted, the wood that can stablize the overexpression lae1 gene of passage is made
Mould engineering bacteria；
2, the trichoderma engineering bacteria for the overexpression lae1 gene that the present invention constructs can significantly improve trichoderma peptaibols's
Yield, wherein the yield of long-chain peptaibols and middle long-chain peptiabols improve 68.96% He than starting strain respectively
42.85%, facilitate the application of trichoderma peptaibols in medicine and agriculturally.
Detailed description of the invention
Fig. 1 lae1 gene overexpression plasmid pIG1783-lae1OE map；
The PCR electrophoresis result photo of Fig. 2, lae1 gene overexpression bacterial strain；
Fig. 3, lae1 gene overexpression bacterial strain lae1OE-16 colonial morphology photo；
Wherein, left figure is colonial morphology photo after culture 3 days, and right figure is colonial morphology photo after culture 5 days；
The qRT-PCR of lae1 gene expression amount analyzes histogram in Fig. 4 lae1OE-16 bacterial strain；
The HPLC of Fig. 5 SMF2 bacterial strain and lae1OE-16 bacterial strain peptaibols analyze peak value figure.
Specific embodiment
Below with reference to embodiment, the invention will be further described, but institute's protection scope of the present invention is without being limited thereto.
Biological material source:
Trichoderma (Trichoderma) SMF2 derives from China typical culture collection center, bacterium numbering CCTCC NO:
M209031；
Escherichia coli (Escherichia coli) DH5 α is purchased from precious biotech firm；
Over-express vector constructs the building of plasmid pIG-1783 according to Stefanie Poggeler etc. and Peter
(Curr.Genet., (2003) 43:54-61 such as W.Inglis；J.Gen.Appl.Microbiol., (1999) 45,63-67) in
Building obtains；
Fungal gene extracts kit: E.Z.N.A Fungal DNA Kit, OMEGA company, the U.S.；
Small amount plasmid extraction kit: E.Z.N.A Plasmid Miniprep Kit, OMEGA company, the U.S.；
Ago-Gel QIAquick Gel Extraction Kit: E.Z.N.A Gel Extraction Kit, OMEGA company, the U.S.；
T4 connection enzyme reagent kit: pGEM-T ligation kit, Promega company, the U.S.；
Southern hybridization kit: DIG High Prime DNA Labeling and Dectection Starter
Kit I, Roche company, Germany；
RT-PCR kit: PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real
Time), TaKaRa company, Japan；
QPCR kit: SYBR Premix Ex TaqTM (Perfect Real Time), TaKaRa company, Japan；
pMDTM- 19T, TaKaRa company, Japan；
Plain agar sugar, antibiotic: the raw work in Shanghai, China；
Fast Pfu DNA Polymerase, DNA Marker, dNTP mix etc.: TransGen Biotech company, in
State；
Restriction endonuclease: Fermentas company, the U.S.；
Lyases: Sigma company；
Hygromycin B: Roche company, Germany；
Trizol Reagent:invitrogen company, the U.S.；
DEPC water: raw work biology, China；
Antibiotic used is purchased from Merck company；
Methanol is purchased from Tianjin Kermel Chemical Reagent Co., Ltd.；
Culture medium preparation raw material is raw material commonly used in the art, can market buy；
DNA sequencing is completed in Beijing Bo Shang Bioisystech Co., Ltd；
Primer synthesis is completed in Hua Da gene；
Embodiment 1
The building of the clone and expression vector of the area gene ORF lae1 and terminator sequence, steps are as follows:
The clone of the area gene ORF 1lae1 and terminator sequence
The extraction of 1.1 trichoderma SMF2 genomic DNAs
Referring to fungal DNA extraction kits (E.Z.N.A.TMFungal DNA Mini Kit, OMEGA) specification extraction
Genomic DNA.
1.2 design of primers and synthesis
Two primers are designed according to lae1 gene order:
lae1OE-FCATGccatggCCTCTCGAAACGCTCCCAAC
lae1OE-RCCCaagcttCTAGCTAACCTGTTGCTGTAC
By Shanghai, Sheng Gong biotech company is synthesized.
1.3 carry out gene order amplification and product recycling using PCR
(1) using F and R as primer, using genomic DNA as template, PCR amplification is carried out；
PCR reaction condition are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C extend
1min, 30 circulations；72 DEG C extend 5min eventually.
PCR amplification system (50 μ L) is as follows:
(2) 1% agarose gel electrophoresis is carried out to pcr amplification product, as a result obtains the DNA fragmentation of a treaty 2169bp
(Fig. 1).Then illustrate the DNA fragmentation that recycling amplifies according to it with the DNA QIAquick Gel Extraction Kit of Omega company, obtain gene
The area ORF of lae1 and terminator sequence.
2. over-express vector and the building for being overexpressed bacterial strain
(1) DNA fragmentation and expression vector digestion
The DNA fragmentation and carrier pIG-1783 comprising the area lae1ORF and lae1 terminator sequence that recycling is obtained are used
NcoI and HindIII double digestion, endonuclease reaction system are as follows:
Lid is covered tightly, finger flicks centrifuge tube, mixes sample, and the brief centrifugation 2sec on centrifuge concentrates on sample
Tube bottom, 37 DEG C of warm bath 30min.
(2) 1% agarose gel electrophoresis is carried out to digestion products, purpose band is cut into glue, then with Omega company
DNA QIAquick Gel Extraction Kit recycles target DNA fragment according to its specification.
(3) DNA fragmentation is connect with expression vector
For coupled reaction system referring to the T4 connection enzyme reagent kit of Promega company, reaction system is 10 μ L.
Lid is covered tightly, finger flicks centrifuge tube, mixes sample, and the brief centrifugation 2sec on centrifuge concentrates on sample
Tube bottom, 16 DEG C of connections are overnight.
Plasmid conversion: taking the E.coliDH5 α competent cell of -80 DEG C of preservations ice bath melted, and 10 μ L linked systems are whole
It is added in the competent cell of 50 μ L, ice bath 30min, 42 DEG C of heat shock 90s, is transferred to 2~3min of ice bath on ice at once, 500 μ are added
Then L liquid fresh water LB culture medium, 37 DEG C of 15~20min of water-bath go to 37 DEG C of shaking table 40~50min of shaken cultivation, culture knot
Shu Hou, 4000rpm are centrifuged 1min, discard 400 μ L supernatants, and bacterial sediment is resuspended with 100 μ L supernatants of retention.By the bacterium after resuspension
Liquid is all applied to containing on 100 μ g/mL ampicillin/LB plates, 37 DEG C of 12~20h of culture.
Bacterium colony on picking LB conversion plate is transferred to containing in 100 μ g/mL ampicillin LB culture mediums, and 37 DEG C,
200rpm cultivates 12~20h.
Plasmid is extracted with small amount plasmid extraction kit (E.Z.N.A Plasmid Miniprep Kit, OMEGA), specifically
Step is shown in plasmid extraction kit specification, obtains after the plasmid order-checking verifying of extraction and is overexpressed plasmid.Above-mentioned recombination is overexpressed
Plasmid includes the function fragment of strong promoter Pgpd, lae1 sequence and its terminator, as shown in Figure 1.
Embodiment 2
It is overexpressed the building of bacterial strain, steps are as follows:
(1) the protoplast preparation of trichoderma SMF2 bacterial strain
By the spore inoculating of trichoderma SMF2 in culture medium for mycelial growth, 28 DEG C, 160rpm cultivates 13h；Then 4000rpm
It is centrifuged 5min, is washed three times with the NaCl solution of concentration 0.7M, each 25mL, cell wall lysis enzymes liquid 6mL is added, and (0.24g is thin
Cell wall lyases is dissolved in 5.7mL 0.7M NaCl solution, filtration sterilization, and 0.3mL PBS buffer solution, pH=5.8 is added), weight
Outstanding, 30 DEG C, 60rpm digests 3h.Enzymolysis liquid is filtered with three layers of microscope lens wiping paper, is added 20mL concentration 0.7M's in filtered solution
NaCl solution, 4 DEG C, 3800rpm is centrifuged 5min and collects protoplast, the STC solution of the protoplast being collected into concentration 0.7M
Twice, each 15mL, the rear 600 μ LSTC solution that are added are resuspended for washing, make protoplast concentration 5 × 107~5 × 108A/mL
It is spare.The above operation is placed in be carried out on ice, and the NaCl solution of concentration 0.7M, the STC solution of concentration 0.7M should all be pre-chilled in advance.
(2) conversion and regeneration of protoplast
Vector linearization: with HindIII digestion lae1 gene overexpression carrier pIG1783-lae1OE and making its linearisation,
It is diluted after digestion with the STC solution that the concentration of pre-cooling is 0.7M；
Protoplast transformation: 100mL centrifugation is added to after taking 150 μ L linearized plasmid solutions and 150 μ L protoplasts to mix
1.5mL PTC is added dropwise after ice bath 20min in bottom of the tube, and ice bath 20min is being placed at room temperature for 20min, takes 500 μ of μ L~600 L
Liquid regeneration culture is uniformly added in 90mm plate, is subsequently poured into suitable solid regenerated culture medium (containing 100 μ g/mL
Hygromycin B) mix after 28 DEG C culture.
Protoplast regeneration and primary dcreening operation: the bacterium colony grown on solid regenerated culture medium is transferred to secondary screening culture medium, and picking is raw
Long good transformant is transferred to PDA culture medium.
(3) screening and verifying of transformant obtains and is overexpressed bacterial strain lae1OE.
Transformant is subjected to PCR verifying, verifying is purified using using the method for single spore separation.
YZlae1OE-F:GATCGCTGAGATAGGTGCCTCACTG
YZlae1OE-R:CTAGCTAACCTGTTGCTGTAC
PCR reaction system is 20 μ L, and specific reaction system and reaction condition is referring to GenStar2 × Taq PCR StarMix
Specification.
Above-mentioned culture medium is prepared as follows:
PDB culture medium: peeling potatoes weigh 200g, and stripping and slicing adds suitable quantity of water to boil 30min, and 4 layers of filtered through gauze are added
Glucose 20g adds distilled water constant volume to 1L；115 DEG C, 30min sterilizing.
PDA culture medium: it is 2% agar powder that mass percent is added in PDB culture medium；115 DEG C, 30min sterilizing.
Culture medium for mycelial growth: the yeast extract that mass percent is 1.5% is added in PDB culture medium；115 DEG C,
30min sterilizing.
Liquid regeneration culture medium: it is 1M that sucrose to concentration is added in culture medium for mycelial growth；115 DEG C, 30min sterilizing.
Solid regenerated culture medium: it is 0.7M that sucrose to concentration is added in PDB culture medium, and it is 7g/ that agar powder to concentration, which is added,
L；115 DEG C, 30min sterilizing.
Secondary screening culture medium: it is 100 μ g/mL that hygromycin B to concentration is added in PDA culture medium.
Embodiment 3
It is overexpressed the analysis of bacterial strain lae1 expression quantity and peptaibols yield, steps are as follows:
(1) it is overexpressed the fermented and cultured of bacterial strain
Suitable spore is scraped from the plate of culture 5d or so, spore suspension is configured to, spore concentration is made to reach 108
A/mL is then seeded into the 500mL triangular flask containing 100mL PDB culture medium, every bottle of inoculation 1mL spore suspension, each bacterium
5 bottles of strain inoculation, 28 DEG C, 180rpm is cultivated for 24 hours.
(2) it is overexpressed the qPCR analysis of lae1 expression quantity in bacterial strain
Fungi total serum IgE is extracted using TRizol reagent.With the PrimeScript of TaKaRaTM RT reagent Kit
With gDNA Eraser kit carries out reverse transcription to RNA, and reaction system is 20 μ L, and method is referring to specification.
According to the SYBR Premix Ex Taq of TaKaRaTMKit carries out qRT-PCR analysis, and experimental arrangement is referring to explanation
Book.
1 μ L reverse transcription product is expanded for subsequent qRT-PCR, and amplification system is 20 μ L, tef1 genes as internal reference base
Cause.After qRT-PCR amplified reaction, 60 DEG C~95 DEG C melting curve analysis are carried out.
Primer for qRT-PCR analysis is as follows:
Tef1-F:CCACATTGCCTGCAAGTTCGC；
Tef1-R:GTCGGTGAAAGCCTCAACGCAC；
RTlae1-F:CATGAGCATGATGCCGATGAGTGAC；
RTlae1-R:CTAGATAGCGGTAGCATCCGAGTC.
QPCR reaction system is as follows:
QRT-PCR reaction condition is as follows:
95 DEG C of initial denaturation 30s；PCR reacts 95 DEG C of denaturation 5s, and 55 DEG C of annealing 20s, 72 DEG C of extension 20s, 45 recycle.
(3) it is overexpressed the HPLC analysis of bacterial strain peptaibols yield
Agela C is used by what culture solution 10000rpm centrifugation 20min was obtained18What solid-phase extraction column (500mg/6mL) carried out
Peptaibols is extracted and concentration.HPLC detection is carried out after 0.22 μm of syringe needle filter filtering of fermentation liquid after concentration, is flowed
It is mutually methanol and ultrapure water (0.1%TFA is added), the ratio of methanol and water is 84:16, flow velocity 1mL/min, is selected
watersC18Reverse-phase chromatographic column, Detection wavelength 203nm, applied sample amount are 15 μ L.
Comparative analysis the result shows that, the yield of trichoderma SMF2 bacterial strain long-chain peptaibols is 0.29mg/mL, short chain
The yield of peptaibols is 0.18mg/mL, and the yield that lae1 is overexpressed bacterial strain peptaibols reaches 0.49mg/mL, short chain
The yield of peptaibols reaches 0.3mg/mL, and 68.96% and 42.85% has been respectively increased.
Above-mentioned PDB nutrient media components used are as follows: peeling potatoes, weigh 200g, and stripping and slicing adds suitable quantity of water to boil 30min, and 4
Layer filtered through gauze, is added glucose 20g, adds distilled water constant volume to 1L.115 DEG C, 30min sterilizing.
Claims (23)
1. one plant of overexpressionlae1The trichoderma engineering bacteria of gene exists preparing the application in peptaibols antibacterial peptide, feature
In the overexpressionlae1The construction method of the trichoderma engineering bacteria of gene includes:
(1) genomic DNA is extracted from trichoderma SMF2, then carries out PCR amplification by template of genomic DNA obtained, be madelae1The area gene ORF and terminator sequence；It is describedlae1The PCR specific primer sequences of the area gene ORF and terminator sequence are as follows:
lae1OE-F:CATGccatggCCTCTCGAAACGCTCCCAAC；
lae1OE-R:CCCaagcttCTAGCTAACCTGTTGCTGTAC；
(2) step (1) is obtainedlae1The area gene ORF and terminator sequence are and same after NcoI and HindIII double digestion
Carrier pIG-1783 through NcoI and HindIII double digestion is attached, and recombinant plasmid is made；
(3) by recombinant plasmid transformed made from step (2)E.coliDH5 α competent cell, the LB through the Amp containing ampicillin
Screening of Media extracts recombinant expression carrier, is made and is overexpressed plasmid pIG1783-lae1OE；
(4) by step (3) overexpression plasmid pIG1783- obtainedlae1OE is through HindIII linearization for enzyme restriction, and then conversion is former
Raw plastid is made and is overexpressed through regeneration, primary dcreening operation, secondary screeninglae1The trichoderma engineering bacteria of gene.
2. application as described in claim 1, which is characterized in that in the step (1)lae1The area gene ORF and terminator sequence
PCR amplification system it is as follows, total system be 50 μ L:
32.2 μ L of sterile purified water
5×TransStart FastPfu10 μ L of buffer
5 μ L of dNTP mixture
50 μM of concentrationlae1OE-F 0.4 μL
50 μM of concentrationlae1OE-R 0.4 μL
1 μ L of genomic DNA
TransStart FastPfu 1 μ L of DNA polymerase；
The PCR amplification program is as follows: 95 DEG C of 5 min of initial denaturation；95 DEG C of 30 sec of denaturation, 55 DEG C of 30 sec of annealing, 72 DEG C are prolonged
Stretch 1 min, 30 circulations；72 DEG C extend 5 min eventually.
3. application as described in claim 1, which is characterized in that NcoI and HindIII double enzyme digestion reaction body in the step (2)
System is as follows, and total system is 20 μ L:
2 μ L of buffer
12 μ L of DNA fragmentation or carrier pIG-1783
1 μ L of NcoI restriction endonuclease
1 μ L of HindIII restriction endonuclease
4 μ L of sterile purified water；
NcoI and HindIII double enzyme digestion reaction condition are as follows: 37 DEG C of 30 min of warm bath.
4. application as described in claim 1, which is characterized in that the connection in the step (2) is connected using T4 ligase
It connects, reaction condition are as follows: 16 DEG C of connections are overnight.
5. application as described in claim 1, which is characterized in that conversion in the step (3)E.coliDH5 α competent cell
The step of it is as follows:
Take -80 DEG C of preservationsE.coliDH5 α competent cell is ice bath melted, recombinant plasmid is mixed with competent cell, ice bath
30 min；42 DEG C of 90 s of heat shock, 2~3 min of ice bath；Then 37 DEG C of 40~50 min of shaking table shaken cultivation in LB culture medium,
4000 rpm are centrifuged 1 min, discard supernatant, be resuspended bacterial sediment to get.
6. application as described in claim 1, which is characterized in that the concentration of ampicillin is 100 μ g/ in the step (3)
ML, screening conditions are as follows: 37 DEG C, 200 rpm cultivate 12~20 h.
7. application as described in claim 1, which is characterized in that the system of HindIII linearization for enzyme restriction is such as in the step (4)
Under:
7 μ L of sterile purified water
2 μ L of buffer
Plasmid pIG1783-lae1OE 10μL
1 μ L of HindIII restriction endonuclease.
8. application as described in claim 1, which is characterized in that the preparation step of protoplast is as follows in the step (4):
By the spore inoculating of trichoderma SMF2 in culture medium for mycelial growth, 28 DEG C, 160 rpm culture, 13 h；By cultural hypha object
4000 rpm are centrifuged 5 min, are washed three times with 0.7 M NaCl, every time 25 mL, and cell wall lysis enzymes liquid is added, and are resuspended, 30 DEG C,
60 rpm digest 2.5~3 h, filter, and the concentration that pre-cooling is added in filtrate is the NaCl solution of 0.7 M, NaCl solution additional amount
For 5.7 mL, 4 DEG C, 3800 rpm are centrifuged 5 min and collect protoplast, 0.7 M that 20 mL of the protoplast being collected into are pre-chilled
STC solution wash be added afterwards twice 600 μ L pre-cooling STC solution be resuspended, make protoplast concentration 5 × 107~5 × 108A/
mL。
9. application as claimed in claim 8, which is characterized in that the cell wall lysis enzymes liquid is prepared as follows:
0.24 g cell wall lysis enzymes, are dissolved in the NaCl solution that 5.7 mL concentration are 0.7 M, and 0.3 mL is added in filtration sterilization
The PBS buffer solution of pH5.8.
10. application as claimed in claim 8, which is characterized in that the STC solution composition is as follows:
0.7 M D-S D-sorbite, 0.05 M CaCl2, 10 mM Tris-HCl, pH 7.5.
11. application as described in claim 1, which is characterized in that the conversion protoplast in the step (4), step are as follows:
It takes 150 μ L linearized plasmid solutions and 150 μ L protoplasts to mix and is added to 100 mL centrifugation bottom of the tube, 20 min of ice bath
After 1.5 mL PTC solution, 20 min of ice bath is added dropwise, then be placed at room temperature for 20 min；STC solution is added to clean, 4 DEG C, 4000
Rpm abandons supernatant after being centrifuged 5 min.
12. application as claimed in claim 11, which is characterized in that the PTC solution component is as follows:
600g/L Macrogol 4000,10 mMTris-HCl, 10 mM CaCl2, pH 7.5.
13. application as described in claim 1, which is characterized in that primary dcreening operation in the step (4), step are as follows:
Protoplast after conversion is transferred to the solid regenerated culture medium containing 100 μ g/mL hygromycin Bs, 28 DEG C of culture 48h or so,
Until transformant out.
14. application as described in claim 1, which is characterized in that secondary screening in the step (4), step are as follows:
By transformant by being transferred in solid regenerated culture medium on the secondary screening culture medium containing 100 μ g/mL hygromycin Bs, 28 DEG C of cultures 3
Then d is gone on PDA plate.
15. application as described in claim 1, which is characterized in that further include PCR screening step after secondary screening in the step (4)
It is rapid:
The genomic DNA of SMF2 and transformant is extracted, design primer amplifies plasmid pIG-1783-lae1Upper promoter Pgpd is arrivedlae1Whole section of sequence of terminator；
The primer sequence of the PCR screening is as follows:
YZlae1OE-F:GATCGCTGAGATAGGTGCCTCACTG；
YZlae1OE-R:CTAGCTAACCTGTTGCTGTAC.
16. application as claimed in claim 15, which is characterized in that the PCR system is as follows, and reaction system is 20 μ L:
2×Taq PCR StarMix 10 μL
8 μ L of sterile purified water
10 μM YZlae1OE-F 0.5μL
10 μM YZlae1OE-R 0.5 μL
1 μ L of genomic DNA.
17. application as claimed in claim 15, which is characterized in that the PCR response procedures are as follows:
95 DEG C of 5 min of initial denaturation；95 DEG C of 30 sec of denaturation, 55 DEG C of 30 sec of annealing, 72 DEG C of 1 min30 sec of extension, 30 are followed
Ring；72 DEG C extend 5 min eventually.
18. application as described in claim 1, which is characterized in that further include RT-PCR screening after secondary screening in the step (4)
Step:
The RNA for extracting SMF2 and transformant, measures its purity and concentration with ultraviolet micro-spectrophotometer Nano-100.
19. application as described in claim 1, which is characterized in that further include qRT-PCR screening after secondary screening in the step (4)
Step:
It negates transcription product and carries out qRT-PCR amplification,tef1Gene is as reference gene.
20. application as claimed in claim 19, which is characterized in that the qRT-PCR reaction system is as follows, and reaction system is
20 μ L:
2×SYBR Green qPCR Mix 10μL
8 μ L of sterile purified water
The 0.5 μ L of primers F that 10 μM of concentration
10 μM of concentration of 0.5 μ L of primer R
cDNA 1 μL。
21. application as claimed in claim 19, which is characterized in that the qRT-PCR response procedures are as follows:
95 DEG C of 30 s of initial denaturation；PCR reacts 95 DEG C of denaturation 5s, and 55 DEG C of annealing 20s, 72 DEG C of 20 s of extension, 45 recycle.
22. application as claimed in claim 19, which is characterized in that the primer sequence of the qRT-PCR is as follows:
tef1- F:CCACATTGCCTGCAAGTTCGC；
tef1- R:GTCGGTGAAAGCCTCAACGCAC；
RTlae1- F:CATGAGCATGATGCCGATGAGTGAC；
RTlae1- R:CTAGATAGCGGTAGCATCCGAGTC.
23. application as described in claim 1, which is characterized in that steps are as follows:
By the overexpression of buildinglae1The trichoderma engineering bacteria of gene is inoculated in PDB culture medium, and at 28 DEG C, 180 rpm are cultivated for 24 hours,
Fermentation liquid is made, then 20min is centrifuged through 10000 rpm, then through Agela C18It after solid phase extraction, is concentrated, is made
Peptaibols antibacterial peptide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610899151.4A CN106497962B (en) | 2016-10-14 | 2016-10-14 | One plant of trichoderma engineering bacteria for being overexpressed lae1 gene and its construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610899151.4A CN106497962B (en) | 2016-10-14 | 2016-10-14 | One plant of trichoderma engineering bacteria for being overexpressed lae1 gene and its construction method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106497962A CN106497962A (en) | 2017-03-15 |
| CN106497962B true CN106497962B (en) | 2019-11-26 |
Family
ID=58295031
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610899151.4A Active CN106497962B (en) | 2016-10-14 | 2016-10-14 | One plant of trichoderma engineering bacteria for being overexpressed lae1 gene and its construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106497962B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111548977B (en) * | 2020-05-09 | 2022-05-24 | 江南大学 | Serratia marcescens engineering bacterium and application thereof in prodigiosin production |
| CN114426984B (en) * | 2020-10-29 | 2024-06-07 | 浙江大学 | Plasmid for regulating and controlling secondary metabolite of filamentous fungi and application thereof |
| CN113881579A (en) * | 2021-11-09 | 2022-01-04 | 上海交通大学 | Method for synthesizing trichoderma long-chain antibacterial peptide and improving antibacterial activity |
| CN114752507B (en) * | 2022-04-18 | 2023-09-15 | 山东大学 | Application of trichoderma pseudokoningii SMF2 in preventing and treating plant bacterial diseases |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102071148A (en) * | 2010-12-01 | 2011-05-25 | 山东大学 | Trichoderma pseudokoningii (SMF2) strain and application thereof |
| CN104357475A (en) * | 2014-10-14 | 2015-02-18 | 山东师范大学 | Metarhizium anisopliae transgenic strain as well as preparation method and application thereof |
-
2016
- 2016-10-14 CN CN201610899151.4A patent/CN106497962B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102071148A (en) * | 2010-12-01 | 2011-05-25 | 山东大学 | Trichoderma pseudokoningii (SMF2) strain and application thereof |
| CN104357475A (en) * | 2014-10-14 | 2015-02-18 | 山东师范大学 | Metarhizium anisopliae transgenic strain as well as preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Heterogeneity of homologously expressed Hypocrea jecorina (Trichoderma reesei ) Cel7B catalytic module;Torny Eriksson，et al;《Eur. J. Biochem.》;20041231;第271卷;1266-1276 * |
| The Putative Protein Methyltransferase LAE1 of Trichoderma atroviride Is a Key Regulator of Asexual Development and Mycoparasitism;Razieh Karimi Aghcheh，et al;《PLOS ONE》;20130630;第8卷(第6期);e67144 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106497962A (en) | 2017-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106497962B (en) | One plant of trichoderma engineering bacteria for being overexpressed lae1 gene and its construction method and application | |
| CN105861517A (en) | Panax notoginseng antimicrobial peptide gene PnSN1 and application thereof | |
| CN109401985A (en) | The Δ Tlrgt2 trichoderma engineering bacteria and its construction method of one plant height production peptaibols antibacterial peptide and application | |
| US11325953B2 (en) | Protein of ‘dangshan suli’ having function of promoting growth of pollen tube, encoding gene PBRTTS1 and use thereof | |
| EP2725098B1 (en) | Kluyveromyces lactis yeast strain and methods for the production of sugars, ethanol, beta-galactosidase and biomass | |
| CN104212757A (en) | Method for high-efficiently producing L-theanine through production of coli [gamma]-glutamylmethylamine synthetase with escherichia coli | |
| CN106554971A (en) | The preparation method of the transgenic rye grass of expressing gene recombination human serum albumin | |
| JP2021514679A (en) | Recombinant oxalate decarboxylase expressed by filamentous fungal host cells | |
| CN103114089B (en) | Strong promoter from trichoderma reesei as well as expression vector and application thereof | |
| CN110669114B (en) | Lanthionine precursor peptide amyA6, and preparation method and application thereof | |
| US20230039558A1 (en) | Chloroplast or accumulated lipid particle enriched with an oil-body protein fusion polypeptide and method for producing the same in algae | |
| CN102993278A (en) | Purification method of methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen FnbA1 | |
| CN107815459B (en) | Pleurotus ostreatus manganese peroxidase gene and application thereof | |
| CN104894115B (en) | A kind of Aspergillus terreus and its construction method and application with efficient homologous recombination ability | |
| CN104774847B (en) | Yangbi bulla walnut Pro-rich GFP JsPRP1 and application | |
| CN108754008B (en) | Detection kit for colchicine burning germs and application thereof | |
| Wang et al. | Heterologous expression of bovine lactoferricin in Pichia methanolica | |
| CN104651389B (en) | A kind of method of liposome-mediated transfection agaricus bisporus lamella | |
| EP2852677A1 (en) | Trichoderma hydrophobin production | |
| CN113980945B (en) | Trichoderma viride histone deacetylase and encoding gene and application thereof | |
| WO2019014755A1 (en) | Recombinant polypeptide enriched algal chloroplasts, methods for producing the same and uses thereof | |
| CN111944779B (en) | Trehalose synthesis dual-function enzyme coding gene TvTPS/TPP and application thereof | |
| CN114480468B (en) | Method for inhibiting growth of fusarium by constructing Sch9 gene mutant strain | |
| Mani et al. | Agrobacterium-mediated transformation and gus gene expression in Amaranthuscaudatus | |
| CN107964547B (en) | A kind of 10 gene PnPR10-3 of Radix Notoginseng pathogenesis-related proteins and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |