CN104651389B - A kind of method of liposome-mediated transfection agaricus bisporus lamella - Google Patents
A kind of method of liposome-mediated transfection agaricus bisporus lamella Download PDFInfo
- Publication number
- CN104651389B CN104651389B CN201410832003.1A CN201410832003A CN104651389B CN 104651389 B CN104651389 B CN 104651389B CN 201410832003 A CN201410832003 A CN 201410832003A CN 104651389 B CN104651389 B CN 104651389B
- Authority
- CN
- China
- Prior art keywords
- lamella
- agaricus bisporus
- liposome
- aco
- block
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of method of liposome-mediated transfection agaricus bisporus lamella, specially：1）Lamella not broken young tender mushroom fruitbody is plucked, after clean surface, lamella tissue is collected and is cut into block；2）Liposome and plasmid are mixed, 15-60 min are placed in 5-5 DEG C；3）By step 2）Product dilutes 1000 times with aseptic ultra-pure water, is mixed with lamella tissue block, and room temperature places 80-120 min；4）By step 3）Products therefrom is added in RCM solid mediums, incubated at room temperature 8-12d；5）The agaricus bisporus lamella tissue block of sprouting is transferred on the PDA plate containing hygromycin, incubated at room temperature 10-20d；6）The mycelia block for cutting new growth is transplanted to PDA inclined-plane cultures, Secondary Culture 2-5 times, then is transferred on the PDA plate containing hygromycin, and be capable of normal growth is transformant.The method has the advantages that easy to operate, high conversion rate, transformant stabilization.
Description
Technical field
The invention belongs to lipofection technical field, and in particular to a kind of liposome-mediated transfection agaricus bisporus lamella
Method.
Background technology
Agaricus bisporus（Agaricus bisporus）Also known as white mushroom, mushroom, mushroom, be cultivate in the world most extensively,
Output and the maximum edible mushroom of consumption figure, yield account for the 3/4 of world's edible mushroom total output.However, the heredity of agaricus bisporus
Conversion lacks simple and effective method always.Agaricus bisporus genetic transforming method successively report have protoplast electrotransformation,
Protoplast PEG mediated transformations method, particle bombardment bombard the mycelium and fructification and agriculture bacillus mediated lamella of agaricus bisporus
Conversion method, foreign gene is transferred in agaricus bisporus bacterial strain.These method generally existings are cumbersome, device is complicated, conversion ratio
It is low, the shortcomings of transformant is unstable.Some methods need to prepare protoplast, and preparation process is complicated, such as Protoplast Electro conversion
Method and the protoplast transformation of PEG mediations.Some methods need not prepare protoplast, but device complexity, conversion cost are high,
Such as Gene Knock-out Mice.The conversion ratio of some methods is unstable, and conversion ratio is influenceed by many factors, and such as Agrobacterium-mediated Transformation method turns
Rate is more by agrobacterium strains type, plasmid vector type and match condition between the two, medium component and inductive condition etc.
The influence of the factor of kind.
The content of the invention
Present invention aim to overcome that prior art is not enough, there is provided a kind of side of liposome-mediated transfection agaricus bisporus lamella
Method, the method is simple and efficient to handle, high conversion rate, transformant inheritance stability, it is not necessary to complex appts.
To achieve the above object, the present invention is adopted the following technical scheme that：
A kind of method of liposome-mediated transfection agaricus bisporus lamella, it is comprised the following steps：
1）Lamella not broken young tender agaricus bisporus fructification is plucked, after clean surface, lamella tissue is collected and is cut into block, obtained
Obtain lamella tissue block；
2）By liposome LipofectamineTM2000 and plasmid pBHg-dsACO is mixed, and 15- is placed in -5-5 DEG C
60 min；
3）By step 2）Product dilutes 1000 times with aseptic ultra-pure water, then with step 1）Lamella tissue block is mixed, room temperature
（25±5℃）Place 80-120 min；
4）By step 3）Products therefrom is added in RCM solid mediums, 20-30 DEG C of culture 8-12d；
5）The agaricus bisporus lamella tissue block of sprouting is transferred on the PDA plate containing hygromycin, 20-30 DEG C of culture
10-20d；
6）The mycelia block for cutting new growth is transplanted to PDA inclined-planes and is cultivated, such Secondary Culture 2-5 times, then is transferred to
On PDA plate containing hygromycin, be capable of normal growth is transformant.Transformant can be inoculated into conventional PDA inclined-planes is carried out
Culture and preservation.
Specifically, the step 2）It is middle by 1 μ L liposomes LipofectamineTM2000 and 2-3 μ g plasmids pBHg-
DsACO is mixed.
The step 4）In RCM solid mediums composition be：The g of tryptone 2.0, the g of yeast extract 2.0,
MgSO4·7H2O 0.5 g, K2HPO4 0.46 g, KH2PO4 1 g, the g of glucose 20, the g of agar 20, the g of mannitol 109.3, steam
Distilled water 1000 mL, pH 7.0.
The step 5）With 6）In PDA plate concentration containing hygromycin be 20-100 μ g/mL.
Compared to the prior art, agaricus bisporus liposome-mediated transfection lamella method of the present invention has operation letter
Just, fast, high conversion rate, transformant inheritance stability, and protoplast need not be prepared, it is not necessary to the advantages of complex appts.
Brief description of the drawings
Fig. 1 is the physical map of plasmid pBHg-dsACO；
Fig. 2 is the transformant of agaricus bisporus；CK：AS2796 starting strains；Grown on secondary screening resistance plate at arrow
Transformant；
Fig. 3 is verified for the PCR of transformant；A is hph gene PCR results；B is ACO gene PCR results；In figure, M：DNA
Marker；WT：Starting strain AS2796；p：Plasmid pBHg-dsACO；1-5, transformant；
Fig. 4 is the Semi quantitative PCR analysis of transformant ACO genes；WT：Starting strain AS2796；1-5：Transformant；*, with
WT reaches the level of signifiance compared to difference（p<0.01）；
Fig. 5 is transformant ACO enzyme activity determination results；WT：Starting strain AS2796；1-5：Transformant；WT：*, with WT phases
The level of signifiance is reached than difference（p<0.05）；
Fig. 6 is transformant ethylene synthase amount measurement result；WT：Starting strain AS2796；1-5：Transformant；WT：*, with WT
The level of signifiance is reached compared to difference（p<0.05）.
Specific embodiment
The present invention is further illustrated by the following examples, but protection scope of the present invention is not limited thereto.
Embodiment 1
1 experiment material
1.1 bacterial strains
Agaricus bisporus CGMCC NO.0214, from China General Microbiological culture presevation administrative center.
1.2 plasmids
Plasmid pBHg, purchased from Sylvan companies of the U.S..Plasmid pBHg-dsACO is formed by pBHg transformations, contains hygromycin
Resistant gene（hph）Expression cassette and agaricus bisporus 1- amino-cyclopropane -1- carboxylic acids（ACC）Oxidase gene（ACO）Partial sequence
Double-stranded RNA（ds RNA）Expression cassette, its physical map is shown in Fig. 1, and the wherein sequence of S-ACO is：
GAACCCACCCAGAACCTCTTAGGCCGTTCCTATCTGAAATCGACGATTTCTCGGATCAAATCCACTCTGATATAATT
AACACAATTCTTCGCCTCATCGCAATGAGCTTGGAGCTAGATGAAGATTACTTCATCCAAATGCATGATCGTTCTGC
GAACGCAGAAACATTCCTCCGGTTTGTGAATTATTTCCCTCATCCAGAAGAAGAAGAGAATAAATCCGGCGGAGTCT
The sequence of GGTTGAAAGGACATACTG, R-ACO is：ACCTAGCAGCCGAACATCATCGGGGGACAGTCCTTAAGTTAACG
GAGAGGTTATAACTGTTCTTGAGGTAAGAGTTGCACGAACTGGGTGAAGGTAACGGGTAGAAATCAGTAATAGACCT
CCCTACGATGACCGACCGACTTATCGTTGCAATCGCAGTATTTCAGTCATACAGGAAAGTTGGTCTGAGGCGGCCTA
AATAAGAGAAGAAGAAGACCTACTCCCTTTATTAAGTGTTTGGCCTCCTTACAAAGACGCAAGCGTCTTGCTAGTAC
GTAAACCTACTTCATTAGAAGTAGATCGAGGTTCGAGTAACGCTACTCCGCTTCTTAACACAATTAATATAGTCTCA
CCTAAACTAGGCTCTTTAGCAGCTAAAGTCTATCCTTGCCGGATTCTCCAAGACCCACCCAAG.Specific remodeling method
It is this area routine techniques, reference can be made to document（Smith, N. A., Singh, S. P., Wang, M. B.,
Stoutjesdijk, P. A., Green, A. G., & Waterhouse, P. M. (2000). Gene
expression: Total silencing by intron-spliced hairpin RNAs. Nature, 407
(6802), 319-320）.Wherein, plasmid pBHg-dsACO is preferably built as follows：
Plasmid pBHg-dsACO is by agaricus bisporusACOGene C DS partial sequence double-stranded RNAs（dsRNA）Expression cassette insertion
It is built-up at the MCS of plasmid pBHg.Agaricus bisporusACOGene C DS partial sequence dsRNA expression cassettes are by four
DNA fragmentation is got continuously through digestion enzyme, and four DNA fragmentations are respectively agaricus bisporus glycerol-3-phosphate genesgpdPromoter,
Agaricus bisporusACOThe positive sequence S-ACO in gene C DS parts, agaricus bisporusACOGene C DS parts reverse sequence R-ACO and
The terminator sequence T35S of CaMV35S genes.Both S-ACO and R-ACO have the repetitive sequence of 248 bp.gpdThe PCR of promoter expands
The primer that increasing is used is GPD-U, GPD-D（Table 1）, template is plasmid pBHg, PCR amplification conditions：94 DEG C of predegeneration 5 min, 94
DEG C 40 s, 55 DEG C of 1 min, 72 DEG C of 1 min totally 30 circulation, 72 DEG C of 10 min of extension.Amplification S-ACO and R-ACO is used
Primer is S-ACO-U, S-ACO-D and R-ACO-U, R-ACO-D, according to agaricus bisporus AS2796ACOGene cDNA sequence
（GeneBank accession number JQ314344.1）Design, template is the total serum IgE of agaricus bisporus AS2796 through using MMLV Reverse
The cDNA of Transcriptase 1st-Strand cDNA Synthesis Kit synthesis.PCR amplification conditions：94 DEG C of predegenerations 5
Min, 94 DEG C of 40 s, 56 DEG C of 1 min, 72 DEG C of 1 min totally 30 circulation, 72 DEG C of 10 min of extension.What T35S amplifications were used draws
Thing is T35S-U, T35S-D（Table 1）, template is plasmid pBHg, PCR amplification conditions：94 DEG C of predegeneration 5 min, 94 DEG C of 40 s,
55 DEG C of 1 min, 72 DEG C of 1 min totally 30 circulation, 72 DEG C of 10 min of extension.
Use KpnI single endonuclease digestionsgpdPromoter and R-ACO fragments, with ApaLI single endonuclease digestion T35S and S-ACO fragments, purifying
Connected respectively with T4 ligases after recoverygpdPromoter and R-ACO fragments and T35S and S-ACO fragments.With enzyme connect product thing as mould
Plate, is primer, PCR amplifications with GPD-U, R-ACO-DgpdPromoter+R-ACO fragments, are primer with T35S-D and S-ACO-D,
PCR expands S-ACO+T35S fragments, and PCR amplification conditions are：94 DEG C of min of predegeneration 5,94 DEG C of 40 s, 55 DEG C of 1 min, 72
DEG C 1 min totally 30 circulations, 72 DEG C of 10 min of extension.PCR primer purifying is reclaimed, and respectively willgpdPromoter+R-ACO fragments and
S-ACO+T35S fragments are connected with pMD19-T simple carriers, are transferred toE. coliJM109, extracts after culture and obtains two
Recombinant plasmid.Two recombinant plasmids SalI/ NcoI distinguish double digestion, and purifying recovery containsgpdThe matter of promoter+R-ACO fragments
Granzyme cut after large fragment, the small fragment after the plasmid enzyme restriction containing S-ACO+T35S, and with T4 ligases connect, obtain clone carry
Body pMD19-dsACO.PMD19-dsACO is transferred toE. coliJM109, cloning vector pMD19- is extracted after culture propagation
dsACO.With SalI/BamHI double digestion plasmid pBHg and pMD19-dsACO, large fragment and small fragment are separately recovered, are connected with T4
Connect enzyme carries out enzyme company by large and small fragment, obtains expression plasmid pBHg-dsACO（Fig. 1）, it is transformed intoE. coli In HA105, warp
Plasmid pBHg-dsACO is extracted after Multiplying culture, for converting agaricus bisporus lamella.
1.3 culture mediums
PDA solid mediums：The g of potato 200（Peeling stripping and slicing adds water and boils 20 min and take filter with four layers of filtered through gauze
Liquid）, the g of agar 20, the g of glucose 20, the mL of distilled water 1000.
PD fluid nutrient mediums：The g of potato 200（Peeling stripping and slicing adds water and boils 20 min and take filtrate with four layers of filtered through gauze）,
The g of glucose 20, the mL of distilled water 1000.
RCM solid mediums：The g of tryptone 2.0, yeast extract 2.0 g, MgSO4·7H2O 0.5 g, K2HPO4
0.46 g, KH2PO4 1 g, the g of glucose 20, the g of agar 20, the g of mannitol 109.3, distilled water 1000 mL, pH 7.0.
1.4 liposomes
Liposome LipofectamineTM2000 are purchased from invitorgen companies.
2.1 experimental techniques
A kind of method of liposome-mediated transfection agaricus bisporus lamella, it is comprised the following steps：
1）Lamella not broken young tender mushroom fruitbody is plucked, after clean surface, lamella tissue is collected and is cut into thin block, obtained
The thin block of lamella tissue, the thin block of lamella tissue is added in the aseptic centrifuge tubes of 50 mL；
2）By 1 μ L liposomes LipofectamineTM2000 and 2.5 μ g plasmids pBHg-dsACO are mixed, 0 DEG C of placement
30 min；
3）By step 2）Product dilutes 1000 times with aseptic ultra-pure water, is then transferred to the centrifugation equipped with the thin block of lamella tissue
Guan Zhong（It is advisable with flooding the thin block of lamella tissue）, mix, 25 DEG C of 100 min of placement；
4）By step 3）Products therefrom is added in RCM solid mediums, is down flat plate, and 25 DEG C are inverted culture 10d；
5）The agaricus bisporus lamella tissue block of sprouting is transferred on the PDA plate containing 30 μ g/mL hygromycin, 25 DEG C of trainings
Support 2 weeks；
6）The mycelia block for cutting new growth is transplanted to conventional PDA inclined-planes and is cultivated, such Secondary Culture 3 times, then transfers
Onto the PDA plate containing 30 μ g/mL hygromycin, be capable of normal growth is transformant（See Fig. 2）.
The PCR identifications of 2.2 transformants
5 transformants that selection is grown fine, are transferred in PDA liquid medium, Shaking culture.Mycelia is collected, is used
CTAB methods extract the genomic DNA of transformant mycelia, are template with the genomic DNA for extracting, and usehphGene andACOGene
The specific primer of CDS enters performing PCR amplification checking.
hphGene magnification primer is hph-F（5′-CTATTCCTTTGCCCTCGG-3′）And hph-R（5′-
ATGAAAAAGCCTGAA CTCACC-3′）.Amplification condition：94 DEG C of predegeneration 5 min, 94 DEG C of 40 s, 50 DEG C of 1 min, 72 DEG C
1 min totally 30 circulations, 72 DEG C of 10 min of extension.
ACOThe CDS amplimers of gene are T4-F（5′-GAACCCACCCAGAACCTC-3′）And T4-R（5′-
ATGTTCGGCTGTTAGGTA-3′）.Amplification condition：94 DEG C of predegenerations 5 min, 94 DEG C of 45 s, 52 DEG C of 1 min, 72 DEG C of 30 s
Totally 30 circulations, 72 DEG C of 10 min of extension.
5 μ l PCR primers are taken respectively to be detected with 1% agarose gel electrophoresis, are as a result shown（See Fig. 3）：Can amplifyhphGene（Primer size is 750 bp）WithACOGene outcome（Primer size is 416 bp）.
The Semi quantitative PCR analysis of 2.3 transformant ACO gene expression amounts
5 transformants are randomly selected, the total serum IgE of transformant mycelia is extracted using Trizol methods.It is (big using precious bioengineering
Even) the AMV Reverse Transcriptase kits that Co., Ltd provides carry out reverse transcription, synthesize the chains of cDNA first.
ACOPrimer set for amplification is T4-F（5′-GAACCCACCCAGAACCTC-3′）And T4-R（5′-
ATGTTCGGCTGTTAGGTA-3′）.Reference gene GAPDH amplimers are GAPDH-F（5′-
TCACGCCACCACCGCTACTCAA-3′）And GAPDH-R（5′-CGGGCTTCTCAAGACGAACAACAA-3′）, amplified production
Size is respectively 416 bp and 200 bp.Amplification condition is：94 DEG C of min of predegeneration 5,94 DEG C of 30 s, 52 DEG C of 30 S, 72
DEG C 45 S totally 26 circulations, 72 DEG C of 10 min of extension.
Take 5 μ l PCR primers to be detected with 1% agarose gel electrophoresis, Gel Base/ are taken a picture and used with gel imaging system
The gray value of Gel Blot each electrophoretic bands of Support software analysis.Result shows（See Fig. 4）：5 transformantsACOGene
Expression is significantly reduced, than starting strain reduction 47-74%.
2.4 transformant ACO oxidizing ferment enzyme assays
5 transformants that will be randomly selected, are transferred in PD fluid nutrient mediums, the d of Shaking culture 20.Mycelia is collected by centrifugation
Ball, takes the fresh agaricus bisporus mycelium pellet samples of 1g and is put into 20 mL test tubes, adds 3 mL Mops buffer solutions（100 mmol
/ L, pH7.2）, mix；Each transformant does 6 repetitions.To in the test tube as blank plus 50 μ L sterilized waters.Remaining examination
50 μ L ACC containing 50mmol/L are then added in pipe（1- amino-cyclopropane -1- carboxylic acids）The aqueous solution, and immediately with rubber stopper it is close
Envelope, and add CO with syringe2Make the CO in test tube2Volume about reaches 5%.Then test tube is placed in 26 DEG C of water-baths and reacts 30
min.The invisible spectro gaseous samples of 1 mL are extracted with airtight pin, gas chromatograph for determination ethylene emanation is used, so as to calculate ACC
Oxidase active.The number that rubs received for producing ethene with every milligram of albumen of 1h under the conditions of 26 DEG C is expressed as 1 enzyme activity unit（U）.
Result shows（See Fig. 5）：Compared with starting strain, the ACO enzyme activities of 5 transformants are significantly reduced, enzyme activity drop
Low 68-86%.
2.5 transformant ethylene synthases measure fixed
The starting strain of agaricus bisporus and transformant are inoculated into PD fluid nutrient mediums respectively, in 25 DEG C, 160 r/min
Under the conditions of cultivated, 6 repetitions are done in every kind for the treatment of.When cultivating 20 d, open sealed membrane and aseptically blow 4 h（It is used to
Remove ethene）, after 8 h of sealing culture, using ethylene contents in gas chromatography measure each sample, sample size is 1 mL.Gas phase
Chromatographic condition：The type gas chromatographs of Agilent 7890；Chromatographic column：HP-2 55%（Capillary column）Phenyl Met hyl
Siloxane Capillary 3010 m × 320 μ m, 0.125 μm of nominal, fid detector, 100 DEG C of column temperature；Hydrogen from
Sub- flame detector（FID）, 150 DEG C of detector temperature；Carrier gas N2Flow velocity 50 mL/min, combustion gas H2The mL/min of flow velocity 50, air stream
400 mL/min of speed, retention time is 3.0 min.Enter 1 mL ethene samples with sample introduction needle to be determined on chromatograph, gas sample is entered
Sample flow velocity is 115 mL/min, replication 6 times.
Result shows（See Fig. 6）：Compared with starting strain, the ethylene yield of 5 transformants is significantly reduced, ethylene yield drop
Low 27-48%.
2.6 co-culture influence of the time to lamella germination rate
1）Lamella not broken young tender mushroom fruitbody is plucked, after clean surface, lamella tissue is collected and is cut into thin block, obtained
The thin block of lamella tissue, the thin block of lamella tissue is added in the aseptic centrifuge tubes of 50 mL；
2）By 1 μ L liposomes LipofectamineTM2000 and 2.5 μ g plasmids pBHg-dsACO are mixed, 0 DEG C of placement
30 min；
3）By step 2）Product dilutes 1000 times with aseptic ultra-pure water, is then transferred to the centrifugation equipped with the thin block of lamella tissue
Guan Zhong（It is advisable with flooding the thin block of lamella tissue）, mix, 25 DEG C are placed 20 min, 40 min, 60 min, 80 min, 100
Min, 120 min, totally six time gradients are with comparing；
4）By step 3）Products therefrom is added in RCM solid mediums, is down flat plate, and 25 DEG C are inverted culture one week, are calculated
The sprouting number of lamella block.
The lamella block sum of the sprouting number of germination rate=lamella block/participation conversion.The results are shown in Table 2.With the time of co-cultivation
Increase, the germination rate of agaricus bisporus lamella tissue is constantly raised.When co-cultivation is extended again after the co-cultivation time reaches 100 min
Between, germination rate rising is less, the ratio of co-cultivation time and germination rate is considered, it is determined that the co-cultivation time is with 100 min
Most preferably.
Conclusion
By the above results as can be seen that agaricus bisporus liposome-mediated transfection lamella method of the present invention has operation letter
Just, the advantages of high conversion rate, transformant stabilization.
Claims (4)
1. a kind of method of liposome-mediated transfection agaricus bisporus lamella, it is characterised in that comprise the following steps：
1）Lamella not broken young tender agaricus bisporus fructification is plucked, after clean surface, lamella tissue is collected and is cut into block, obtain bacterium
Pleat tissue block；
2）By liposome LipofectamineTM2000 and plasmid pBHg-dsACO is mixed, and 15-60 is placed in -5-5 DEG C
min；
3）By step 2）Product dilutes 1000 times with aseptic ultra-pure water, then with step 1）Lamella tissue block is mixed, and room temperature is placed
80-120 min；
4）By step 3）Products therefrom is added in RCM solid mediums, 20-30 DEG C of culture 8-12d；
5）The agaricus bisporus lamella tissue block of sprouting is transferred on the PDA plate containing hygromycin, 20-30 DEG C of culture 10-
20d；
6）The mycelia block for cutting new growth is transplanted to PDA inclined-planes and is cultivated, such Secondary Culture 2-5 time, then is transferred to containing damp
On the PDA plate of mycin, be capable of normal growth is transformant；
Step 2）Described in plasmid pBHg-dsACO by pBHg transformation form, contain hygromycin gene（hph）Expression cassette and
Agaricus bisporus 1- amino-cyclopropane -1- carboxylic acids（ACC）Oxidase gene（ACO）Partial sequence double-stranded RNA（ds RNA）Expression
Frame, wherein,
The sequence of S-ACO is：
GAACCCACCCAGAACCTCTTAGGCCGTTCCTATCTGAAATCGACGATTTCTCGGATCAAATCCACTCTGATAT
AATTAACACAATTCTTCGCCTCATCGCAATGAGCTTGGAGCTAGATGAAGATTACTTCATCCAAATGCATGATCGTT
CTGCGAACGCAGAAACATTCCTCCGGTTTGTGAATTATTTCCCTCATCCAGAAGAAGAAGAGAATAAATCCGGCGGA
GTCTGGTTGAAAGGACATACTG,
The sequence of R-ACO is：
ACCTAGCAGCCGAACATCATCGGGGGACAGTCCTTAAGTTAACGGAGAGGTTATAACTGTTCTTGAGGTAAGA
GTTGCACGAACTGGGTGAAGGTAACGGGTAGAAATCAGTAATAGACCTCCCTACGATGACCGACCGACTTATCGTTG
CAATCGCAGTATTTCAGTCATACAGGAAAGTTGGTCTGAGGCGGCCTAAATAAGAGAAGAAGAAGACCTACTCCCTT
TATTAAGTGTTTGGCCTCCTTACAAAGACGCAAGCGTCTTGCTAGTACGTAAACCTACTTCATTAGAAGTAGATCGA
GGTTCGAGTAACGCTACTCCGCTTCTTAACACAATTAATATAGTCTCACCTAAACTAGGCTCTTTAGCAGCTAAAGT
CTATCCTTGCCGGATTCTCCAAGACCCACCCAAG。
2. the method for liposome-mediated transfection agaricus bisporus lamella as claimed in claim 1, it is characterised in that the step 2）In
By 1 μ L liposomes LipofectamineTM2000 and 2-3 μ g plasmids pBHg-dsACO is mixed.
3. the method for liposome-mediated transfection agaricus bisporus lamella as claimed in claim 1, it is characterised in that the step 4）In
RCM solid mediums composition be：The g of tryptone 2.0, yeast extract 2.0 g, MgSO4·7H2O 0.5 g, K2HPO4
0.46 g, KH2PO4 1 g, the g of glucose 20, the g of agar 20, the g of mannitol 109.3, distilled water 1000 mL, pH 7.0.
4. the method for liposome-mediated transfection agaricus bisporus lamella as claimed in claim 1, it is characterised in that the step 5）With
6）In PDA plate concentration containing hygromycin be 20-100 μ g/mL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410832003.1A CN104651389B (en) | 2014-12-29 | 2014-12-29 | A kind of method of liposome-mediated transfection agaricus bisporus lamella |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410832003.1A CN104651389B (en) | 2014-12-29 | 2014-12-29 | A kind of method of liposome-mediated transfection agaricus bisporus lamella |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104651389A CN104651389A (en) | 2015-05-27 |
| CN104651389B true CN104651389B (en) | 2017-06-06 |
Family
ID=53243032
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410832003.1A Expired - Fee Related CN104651389B (en) | 2014-12-29 | 2014-12-29 | A kind of method of liposome-mediated transfection agaricus bisporus lamella |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104651389B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111349649B (en) * | 2020-03-16 | 2020-11-17 | 三峡大学 | Method for gene editing of agaricus bisporus and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0870835A1 (en) * | 1997-04-07 | 1998-10-14 | Unilever N.V. | Agrobacterium mediated transformation of moulds, in particular those belonging to the genus Aspergillus |
| WO2002000896A2 (en) * | 2000-06-28 | 2002-01-03 | The Penn State Research Foundation | Method for transformation of agaricus bisporus |
-
2014
- 2014-12-29 CN CN201410832003.1A patent/CN104651389B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0870835A1 (en) * | 1997-04-07 | 1998-10-14 | Unilever N.V. | Agrobacterium mediated transformation of moulds, in particular those belonging to the genus Aspergillus |
| WO2002000896A2 (en) * | 2000-06-28 | 2002-01-03 | The Penn State Research Foundation | Method for transformation of agaricus bisporus |
Non-Patent Citations (5)
| Title |
|---|
| A Fruiting Body Tissue Method for Efficient Agrobacterium-Mediated Transformation of Agaricus bisporus;XI CHEN等;《Applied and Environmental Microbiology》;20001031;第66卷(第10期);4510-4513页 * |
| Effect of 1-aminocyclopropane-1-carboxylic acid deaminase producing bacteria on the hyphal growth and primordium initiation of Agaricus bisporus;Shichang CHEN等;《Fungal Ecology》;20121010;第6卷;110-118页 * |
| Liposome-mediated mycelial transformation of filamentous fungi;Ran CHAI等;《Fungal Biology》;20130726;第117卷;577-583页 * |
| 基因枪法遗传转化双孢蘑菇菌褶;曹育博 等;《食用菌学报》;20110930(第3期);9-11页 * |
| 脂质体介导遗传转化双孢蘑菇菌褶及1-氨基环丙烷-1-羧酸氧化酶基因(ACO)功能初探;张岩 等;《农业生物技术学报》;20150424;第23卷(第8期);1112-1120页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104651389A (en) | 2015-05-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Shi et al. | Development of a simple and efficient transformation system for the basidiomycetous medicinal fungus Ganoderma lucidum | |
| Xu et al. | Enhancement of ganoderic acid accumulation by overexpression of an N-terminally truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase gene in the basidiomycete Ganoderma lucidum | |
| Yu et al. | Development of an expression plasmid and its use in genetic manipulation of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (higher basidiomycetes) | |
| Liu et al. | Identification of virulence genes in the crucifer anthracnose fungus Colletotrichum higginsianum by insertional mutagenesis | |
| Wang et al. | Highly efficient Agrobacterium-mediated transformation of Volvariella volvacea | |
| US10612007B2 (en) | Method for increasing citric acid production by Aspergillus niger fermentation | |
| CN103981216A (en) | Backbone plasmid vector and application thereof | |
| CN108004262A (en) | A kind of Agrobacterium tumefaciens mediated hypha of Pleurotus ostreatus genetic transforming method | |
| Wang et al. | Optimization of Agrobacterium tumefaciens-mediated transformation method of oleaginous filamentous fungus Mortierella alpina on co-cultivation materials choice | |
| Chauhan et al. | Establishment of Agrobacterium tumefaciens–mediated genetic transformation of apple pathogen Marssonina coronaria using marker genes under the control of CaMV 35S promoter | |
| CN106497962A (en) | The Trichoderma spp. engineering bacteria of one plant of overexpression lae1 gene and its construction method and application | |
| CN104651389B (en) | A kind of method of liposome-mediated transfection agaricus bisporus lamella | |
| JP2021514679A (en) | Recombinant oxalate decarboxylase expressed by filamentous fungal host cells | |
| Lei et al. | Establishment of an efficient transformation system for Pleurotus ostreatus | |
| Li et al. | Transformation of Corynespora cassiicola by Agrobacterium tumefaciens | |
| Bao et al. | Agrobacterium-mediated transformation of arthroconidia obtained from the edible mushroom Hypsizygus marmoreus | |
| CN107815459B (en) | Pleurotus ostreatus manganese peroxidase gene and application thereof | |
| CN116926092A (en) | Pantothenate kinase gene RkPank and application thereof | |
| CN107417783A (en) | Genes For Plant Tolerance mosaic virus GAP-associated protein GAP GmGR1 and its encoding gene and application | |
| CN109666762B (en) | Specific amplification primer of Thelephora ganbajun zang single copy gene and application thereof | |
| CN102140446A (en) | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape | |
| CN104988176B (en) | Method for improving gum content of eucommia ulmoides | |
| CN116732060B (en) | CYP716C oxidase gene in camptotheca acuminata, carrier, microsomal protein and application thereof | |
| CN114774492B (en) | Expression using Aspergillus niger 6 Method for producing neokestose by using G-beta-fructofuranosidase | |
| CN115725644B (en) | Genetic transformation method and application of Polygonatum cyrtonema Fabricius |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170606 Termination date: 20181229 |