CN115948620A

CN115948620A - Primer probe combination, reagent and application

Info

Publication number: CN115948620A
Application number: CN202310055388.4A
Authority: CN
Inventors: 曹雅倩; 高歌; 高利飞; 郑业焕; 付光宇
Original assignee: Autobio Diagnostics Co Ltd
Current assignee: Autobio Diagnostics Co Ltd
Priority date: 2023-01-17
Filing date: 2023-01-17
Publication date: 2023-04-11

Abstract

The invention relates to the technical field of in-vitro detection, in particular to a primer probe combination, a reagent and application. The invention provides a primer probe combination, a reagent or a kit for detecting HPV DNA and mRNA, and aims to simply, conveniently, quickly and accurately detect HPV DNA and mRNA of multiple types in a single reaction so as to achieve the purpose of typing. The invention can perform fluorescence PCR detection and typing on 9 types of DNA or mRNA fragments of HPV16, 18, 31, 33, 45, 52, 58, 59 and 68 types in a single tube by using an asymmetric PCR technology-melting curve technology.

Description

Primer probe combination, reagent and application

Technical Field

The invention relates to the technical field of in-vitro detection, in particular to a primer probe combination, a reagent and application.

Background

Cervical cancer is one of the common cancers affecting women worldwide, and studies have shown that 99.7% of cervical cancers are caused by Human Papilloma Virus (HPV), which can also cause the development of other various cancers, such as penile cancer, vaginal cancer, vulval cancer, anal cancer, oropharyngeal cancer, and the like.

HPV is a small-molecule, non-enveloped, circular double-stranded DNA virus, the genome of which is about 8000 base pairs (bp) long and is divided into 3 functional regions, namely an early transcribed region (E region), a late transcribed region (L region) and a non-transcribed region (long control region, LCR). The E6 and E7 genes of HPV are oncogenes, capable of regulating p53 and pdz domain proteins, and targeting retinoblastoma protein family (pRb) to play a role.

The methods for detecting HPV are mainly pap smear, in situ hybridization, cytology detection, HPV nucleic acid detection and the like, and p16 immune tissue staining can also be used as a potential substitute marker for detecting HPV. At present, HPV nucleic acid detection and TCT detection are relatively effective detection methods and play a great role in cervical cancer screening.

However, real-time PCR is technically limited when multiple mutations or multiple samples need to be detected simultaneously in a single reaction tube. These limitations can be addressed by Fluorescent Melt Curve Analysis (FMCA) based probes after PCR, which detects multiple mutations based on shifts in the Melting Temperature (Tm). If multiple probes labeled with different fluorophores are used, the number of mutations that can be detected will be further increased.

Integration of the HPV genome during the progression from low-grade lesions to cancer has been reported in the literature. In the integration process, the E6/E7 gene is continuously present, the L1 gene can be lost, and the detection process has the risk of missing detection. The research shows that the L1/E1 region of HPV18 is easier to lose, almost all the viral genomes in the HPV18 positive cervical cancer are integrated on the human genome, and less than or equal to 60 percent of the viral genomes in the HPV16 positive cervical cancer are integrated, so that the detection of mRNA has higher sensitivity.

Various methods for detecting HPV nucleic acid based on real-time fluorescent quantitative PCR technology exist in China, but typing is limited, and the problem can be solved by applying multicolor melting curve technology. The prior art patent discloses that mRNA is used as a template for amplification, although multiple typing can be carried out, the design difficulty of a primer probe is high, the cost is high, and the components of a reaction system are complex. And the DNA is used as a template for amplification, so that the detection omission risk exists, and especially the detection omission of HPV16 and HPV18 types has great influence on subsequent diagnosis and treatment.

At present, melting curve products on the market generally use DNA or RNA as targets to carry out nucleic acid detection, and have the defects of low sensitivity, low specificity and the like to different degrees.

The problems of the prior art also include:

1) The typing is limited. Most HPV typing reagents are in a tube-splitting mode, so that the cost is high;

2) It is stored at-20 ℃. The similar kits in the market at present are generally stored at the temperature of-20 ℃;

3) The operation is complicated. Most reagents have complex principles and great design difficulty of primer probes.

Disclosure of Invention

In view of this, the primer probe combination, the reagent and the application provided by the invention can simply, rapidly and accurately detect HPV DNA and mRNA of multiple types in a single reaction so as to achieve the purpose of typing.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides primers, which comprise a primer 1, a primer 2, a primer 3, a primer 4, a primer 5, a primer 6, a primer 7, a primer 8, a primer 9, a primer 10, a primer 11, a primer 12, a primer 13, a primer 14, a primer 15, a primer 16 or a primer 17;

the primer 1 has:

(1) The nucleotide sequence shown as SEQ ID NO. 1; or

(2) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in the (1) has the same or similar functions as the nucleotide sequence shown in the (1); or

(3) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (1) or (2);

the primer 2 has:

(4) The nucleotide sequence shown as SEQ ID NO. 2; or

(5) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in the (4) has the same or similar functions as the nucleotide sequence in the (4); or

(6) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (4) or (5);

the primer 3 has:

(7) 3 as shown in SEQ ID NO; or

(8) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (7) has the same or similar function as that of (7); or

(9) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (7) or (8);

the primer 4 has:

(10) The nucleotide sequence shown as SEQ ID NO. 4; or

(11) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (10) has the same or similar functions as the nucleotide sequence shown in (10); or

(12) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (10) or (11);

the primer 5 has:

(13) The nucleotide sequence shown as SEQ ID NO. 6; or

(14) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (13) has the same or similar function as that of (13); or

(15) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (13) or (14);

the primer 6 has:

(16) The nucleotide sequence shown as SEQ ID NO. 7; or

(17) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (16) has the same or similar functions as the nucleotide sequence shown in (16); or

(18) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (16) or (17);

the primer 7 has:

(19) The nucleotide sequence shown as SEQ ID NO. 8; or

(20) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (19) has the same or similar function as that of (19); or

(21) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (19) or (20);

the primer 8 has:

(22) A nucleotide sequence shown as SEQ ID NO. 9; or

(23) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (22) has the same or similar function as that of (22); or

(24) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (22) or (23);

the primer 9 has:

(25) A nucleotide sequence shown as SEQ ID NO. 10; or

(26) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (25) has the same or similar function as that of (25); or

(27) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (25) or (26);

the primer 10 has:

(28) A nucleotide sequence shown as SEQ ID NO. 12; or

(29) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (28) has the same or similar function as that of (28); or

(30) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (28) or (29);

the primer 11 has:

(31) The nucleotide sequence shown as SEQ ID NO. 13; or

(32) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (31) has the same or similar functions as the nucleotide sequence in (31); or

(33) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (31) or (32);

the primer 12 has:

(34) 14 as shown in SEQ ID NO; or

(35) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (34) has the same or similar function as that of (34); or

(36) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (34) or (35);

the primer 13 has:

(37) 15, as shown in SEQ ID NO; or

(38) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (37), and the function of the nucleotide sequence is the same as or similar to that of (37); or

(39) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (37) or (38);

the primer 14 has:

(40) 16 as shown in SEQ ID NO; or

(41) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (40) has the same or similar function as that of (40); or

(42) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (40) or (41);

the primer 15 has:

(43) A nucleotide sequence shown as SEQ ID NO. 17; or

(44) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (43), and the function of the nucleotide sequence is the same as or similar to that of (43); or

(45) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (43) or (44);

the primer 16 has:

(46) The nucleotide sequence shown as SEQ ID NO. 19; or

(47) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (46) has the same or similar function as that of (46); or

(48) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (46) or (47);

the primer 17 has:

(49) The nucleotide sequence shown as SEQ ID NO. 20; or

(50) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (49) has the same or similar function as that of (49); or

(51) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (49) or (50);

the plurality is 2 to 7.

The invention also provides a probe, which comprises a probe 1, a probe 2, a probe 3 or a probe 4;

the probe 1 has:

(52) The nucleotide sequence shown as SEQ ID NO. 5; or

(53) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (52) has the same or similar function as that of (52); or

(54) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (52) or (53);

the probe 2 has:

(55) A nucleotide sequence shown as SEQ ID NO. 11; or

(56) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (55) has the same or similar function as that of (55); or

(57) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (55) or (8);

the probe 3 has:

(58) A nucleotide sequence shown as SEQ ID NO. 18; or

(59) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (58) has the same or similar function as that of (58); or

(60) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (58) or (59);

the probe 4 has:

(61) The nucleotide sequence shown as SEQ ID NO. 21; or

(62) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (61), and the function is the same as or similar to that of (61); or

(63) A nucleotide sequence having at least 70% homology with the nucleotide sequence shown in (61) or (62);

the plurality is 2 to 7.

The invention also provides primer probe sets comprising one or more of combination 1, combination 2, combination 3, combination 4, combination 5, combination 6, combination 7, combination 8, or combination 9;

the combination 1 comprises the primer 1, the primer 2 and the probe 1;

the combination 2 comprises the primer 1, the primer 3 and the probe 1;

the combination 3 comprises the primer 1, the primer 4 and the probe 1;

the combination 4 comprises the primer 5, the primer 6 and the probe 2;

the combination 5 comprises the primer 5, the primer 7 and the probe 2;

the combination 6 comprises the primer 8, the primer 9 and the probe 2;

the combination 7 comprises the primer 10, the primer 11 and the probe 3;

the combination 8 comprises the primer 12, the primer 13 and the probe 3;

the combination 9 includes the primer 14, the primer 15, and the probe 3.

In some embodiments of the present invention, the primer probe set described above includes probe 1 labeled with FAM at the 5 'end and BHQ1 at the 3' end.

In some embodiments of the present invention, the probe 2 in the primer probe set is labeled with ROX at the 5 'end and BHQ2 at the 3' end.

In some embodiments of the present invention, the 5 'end of the probe 3 in the primer probe set is labeled CY5, and the 3' end is labeled BHQ2.

In some embodiments of the invention, the primer probe set further comprises combination 10;

the combination 10 includes the primer 16, the primer 17, and the probe 4.

In some embodiments of the present invention, the 5 'end of the probe 4 in the primer probe set is labeled with HEX, and the 3' end of the probe is labeled with BHQ1.

The invention also provides the application of the primer, the probe or the primer probe group in the following aspects:

(I) Detecting HPV; and/or

(II) typing HPV; and/or

(III) preparing a reagent, a kit or a device for detecting HPV; and/or

(IV) preparing a reagent, kit or device for typing HPV;

the HPV comprises one or more of HPV16, HPV18, HPV31, HPV33, HPV45, HPV52, HPV58, HPV59, or HPV 68.

The invention also provides a reagent, which comprises the primer, the probe or the primer probe group, and acceptable auxiliary materials or auxiliary agents.

In some embodiments of the invention, the reagent comprises:

the concentration of the restriction primer is 0.02-0.05 mu M; and/or

The concentration of the non-limiting primer is 0.2-1 mu M; and/or

The concentration of the probe is 0.2-0.4 mu M;

the restriction primer includes the above primer 1, the above primer 5, the above primer 8, the above primer 10, the above primer 12, the above primer 14 or the above primer 16;

the non-limiting primer includes the above-mentioned primer 2, the above-mentioned primer 3, the above-mentioned primer 4, the above-mentioned primer 6, the above-mentioned primer 7, the above-mentioned primer 9, the above-mentioned primer 11, the above-mentioned primer 13, the above-mentioned primer 15 or the above-mentioned primer 17.

The invention also provides a kit, which comprises the reagent and acceptable auxiliary materials or auxiliary agents.

In some embodiments of the present invention, the kit comprises: PCR reaction solution 1, PCR reaction solution 2, negative control and positive control;

the PCR reaction solution 1 includes:

(a) Tricine with a pH of 8.3; and/or

(b) DMSO; and/or

(c)、NaN ₃ (ii) a And/or

(d) UNG enzyme; and/or

(e) DNA polymerase; and/or

(f)、dNTP；

The DNA polymerase includes rTth DNA polymerase;

the PCR reaction solution 2 contains Mn (OAc) ₂ 、Mg(OAc) ₂ KOAc or NaN ₃ One or more of;

the negative control comprises a pseudoviral solution containing an internal standard specific target DNA fragment;

the positive control comprises a pseudoviral solution containing an internal standard specific target DNA fragment, an HPV E6/E7 or L1 region specific target fragment.

The invention also provides a typing method of HPV16, HPV18, HPV31, HPV33, HPV45, HPV52, HPV58, HPV59 or HPV68, which comprises the steps of amplifying a sample by using the primer probe group and an amplification reagent to obtain a melting curve and a temperature corresponding to a melting peak, and obtaining a typing result by comparing when a negative control and a positive control are established;

wherein the fluorescence channel of the probe 1 is a channel 1, the fluorescence channel of the probe 2 is a channel 2, the fluorescence channel of the probe 3 is a channel 3, and the fluorescence channel of the probe 4 is a channel 4;

the comparing comprises:

(i) If the temperature corresponding to the melting peak of the channel 1 falls within 70 +/-1.5 ℃ and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 16; and/or

(ii) If the temperature corresponding to the melting peak of the channel 1 falls within 60 +/-1.5 and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 33; and/or

(iii) If the temperature corresponding to the melting peak of the channel 1 falls within 50 +/-1.5 ℃, and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive by HPV 58; and/or

(iv) If the temperature corresponding to the melting peak of the channel 2 falls within 69 +/-1.5 ℃, and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 18; and/or

(v) If the temperature corresponding to the melting peak of the channel 2 falls within 61 +/-1.5 ℃, and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 45; and/or

(vi) If the temperature corresponding to the melting peak of the channel 2 falls within 50 +/-1.5 ℃, and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 59; and/or

(vii) If the temperature corresponding to the melting peak of the channel 3 falls within 67 +/-1.5 ℃, and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 31; and/or

(viii) If the temperature corresponding to the melting peak of the channel 3 falls within 63 +/-1.5 ℃, and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 52; and/or

(ix) And if the temperature corresponding to the melting peak of the channel 3 falls within 49 +/-1.5 ℃, and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 68.

The primer probe set and the kit have the following effects:

the invention can simply, conveniently, quickly and accurately detect the HPV DNA and mRNA of a plurality of types in a single reaction so as to achieve the aim of typing. The invention uses the asymmetric PCR technology-melting curve technology to perform fluorescence PCR detection and typing on 9 types of DNA and mRNA fragments of HPV16, 18, 31, 33, 45, 52, 58, 59 and 68 types in a single tube.

Sensitivity experiments show that the TE solution is used for diluting HPV types in the detection range in the national reference products of the second generation human papilloma virus complete genome type to 1 x 10 ³ ～1×10 ⁴ And (3) performing copies/reaction, and detecting, wherein the result shows that the primer probe sets of the invention are detected in HPV types in the detection range and can accurately classify the HPV types.

Specific experiments show that TE solution is used for diluting HPV types which are not in the detection range in the national reference products of the second generation human papilloma virus complete genome type to 1 x 10 ⁴ ～1×10 ⁵ And (3) performing copes/reaction, and detecting, wherein the result shows that the primer probe group has no cross reaction with other pathogens and other types of HPV and has better specificity.

Repeated experiments show that the primer probe group provided by the invention is used for detecting

HPV types

16, 18, 31, 33, 45, 52, 58, 59 and 68, and the result shows that the Tm value difference of each type is small and the repeatability is good.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the prior art descriptions will be briefly described below.

FIG. 1 shows Tm values and melting curves of HPV16 types in FAM channels;

FIG. 2 shows Tm values and melting curves of HPV33 type in FAM channel;

FIG. 3 shows Tm values and melting curves of HPV type 58 in FAM channels;

FIG. 4 shows Tm values and melting curves of HPV18 type in ROX channel;

FIG. 5 shows Tm values and melting curves of HPV45 types in ROX channel;

FIG. 6 shows Tm values and melting curves of HPV59 type in ROX channel;

FIG. 7 shows Tm values and melting curves for HPV type 31 on the CY5 channel;

FIG. 8 shows Tm and melting curves for HPV type 52 on the CY5 channel;

FIG. 9 shows Tm and melting curves for HPV68 type on CY5 channel;

FIG. 10 shows Tm values and melting curves for internal standards in the HEX channel;

FIG. 11 shows the melting curves of HPV16, 33, 58 type mixed positive pseudoviruses in the FAM channel;

FIG. 12 shows melting curves of

HPV type

18, 45, 59 mixed positive pseudoviruses in ROX channel;

FIG. 13 shows melting curves of

HPV types

31, 52, 68 mixed positive pseudoviruses in CY5 channel;

FIG. 14 shows Tm values and melting curves of HPV type 58 in FAM channels;

FIG. 15 shows Tm values and melting curves for HPV type 52 on the CY5 channel;

FIG. 16 shows Tm values and melting curves of HPV18 type in ROX channel;

FIG. 17 shows Tm values and melting curves of HPV16 type in FAM channel;

FIG. 18 shows Tm and melting curves for HPV68 type on CY5 channel;

FIG. 19 shows Tm values and melting curves of

HPV types

18, 45 and 59 in ROX channel;

FIG. 20 shows Tm values and melting curves of

HPV types

16, 33 and 58 in FAM channels;

FIG. 21 shows Tm values and melting curves of HPV type 58 in FAM channels;

FIG. 22 shows Tm values and melting curves of HPV type 52 in CY5 channel;

FIG. 23 shows Tm values and melting curves of HPV59 type in ROX channel.

Detailed Description

The invention discloses a primer probe combination, a reagent and application, and can be realized by appropriately improving process parameters by referring to the contents in the text by a person skilled in the art. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations and modifications, or appropriate variations and combinations of the methods and applications described herein may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The existing melting curve products generally use DNA or RNA as targets to carry out nucleic acid detection, and have the defects of complex operation, low sensitivity, low specificity and the like to different degrees, but the primer probe combination or the reagent of the invention takes E6/E7mRNA as a template for part of types and DNA in an L1 region as a template for part of types, so that the sensitivity can be considered while typing, the condition of missing detection is avoided, and the diagnosis, treatment and the like of subsequent diseases are facilitated. The current similar kits on the market are generally stored at the temperature of minus 20 ℃, but the reagent can be stored for 1 year at the temperature of 2-8 ℃. Most reagents have complex principles, primer probes have great design difficulty and complex operation, and the method is simple to operate and easy to realize.

The invention aims to detect HPV DNA and mRNA of multiple types simply, conveniently, quickly and accurately in a single reaction so as to achieve the purpose of typing. The invention can perform fluorescence PCR detection and typing on 9 types of DNA and mRNA fragments of HPV16, 18, 31, 33, 45, 52, 58, 59 and 68 types in a single tube by using an asymmetric PCR technology-melting curve technology.

Specifically, the method comprises the following steps:

1. primer Probe design

Specific primers and probes are designed aiming at the E6/E7 or L1 segment of HPV16, 18, 31, 33, 45, 52, 58, 59 and 68 types with high prevalence rate, FAM and ROX channels detect E6/E7mRNA, and CY5 channels detect L1 DNA.

The invention provides a primer group, which comprises at least 1 primer pair in 10 primer pairs, wherein the sequences of the primers and probes are as follows:

(1) The nucleotide sequences of the primer pair and the probe for detecting HPV16 type are respectively shown as SEQ ID NO 1, 2 and 5;

(2) The nucleotide sequences of the primer pair and the probe for detecting HPV33 type are respectively shown as SEQ ID NO 1, 3 and 5;

(3) The nucleotide sequences of the primer pair and the probe for detecting the HPV58 type are respectively shown as SEQ ID NO 1, 4 and 5;

(4) The nucleotide sequences of the primer pair and the probe for detecting HPV18 type are respectively shown as SEQ ID NO 6, 7 and 11;

(5) The nucleotide sequences of the primer pair and the probe for detecting HPV45 type are respectively shown as SEQ ID NO 6, 8 and 11;

(6) The nucleotide sequences of the primer pair and the probe for detecting the HPV59 type are respectively shown as SEQ ID NO 9, 10 and 11;

(7) The nucleotide sequences of the primer pair and the probe for detecting HPV31 type are respectively shown as SEQ ID NO 12, 13 and 18

Shown;

(8) The nucleotide sequences of the primer pair and the probe for detecting HPV type 52 are respectively shown as SEQ ID NO 14, 15 and 18;

(9) The nucleotide sequences of the primer pair and the probe for detecting HPV68 type are respectively shown in

SEQ ID NO

16, 17 and 18.

(10) The nucleotide sequences of the primer pair and the probe for detecting the internal standard are respectively shown as SEQ ID NO 19, 20 and 21.

SEQ ID NO:1：TGCGACGTGAGGTATATGACTTTG

SEQ ID NO:2：GTTGTTCCATACAAACTATAACA

SEQ ID NO:3：AGATAAGAACCGCAAACACAGT

SEQ ID NO:4：GATAGCAATCGTAAACACACT

SEQ ID NO:5：AGAGATGGGAATCCATATGCTGTATGTG

(5 '-end Mark FAM,3' -end Mark BHQ 1)

SEQ ID NO:6：CCGACGAGCCGAACCACA

SEQ ID NO:7：GGACACACAAAGGACAGGGTGTTC

SEQ ID NO:8：CGGACACACAAAGGACAAGGTGCT

SEQ ID NO:9：GTTTCTTCCCAGGCTGCTACTGAT

SEQ ID NO:10：ATTTGAAAAGGTGCTAGATGCCG

SEQ ID NO:11：ATGTTGTGTATGTGTTGTAAGT

(5 'end mark ROX,3' end mark BHQ 2)

SEQ ID NO:12：GGATTTCCTGATACATCTTTT

SEQ ID NO:13：CAGGACCACCGGCATATCTATTA

SEQ ID NO:14：GGTTTTCCAGATACATCT

SEQ ID NO:15：GGTTTACCAGCATATTTGTTACTG

SEQ ID NO:16：GGGTTTCCCTACCTGATCCTAAT

SEQ ID NO:17：CAGTAACAAATATGCTGGTAAACC

SEQ ID NO:18：TAATCCTGAAACTCAACGCTTAGTTTG

(5 'end marker CY5,3' end marker BHQ 2)

SEQ ID NO:19：CTACTCCCAGGAGCAGGGAG

SEQ ID NO:20：GTGTCTGTTTGAGGTTGCTAGTG

SEQ ID NO:21：GGCAGAGCCATCTATTGCTTACATTTGCT

(5 'end mark HEX,3' end mark BHQ 1)

The length of the Taqman probe of the probe is 10-40 bp, and preferably 20-30 bp.

The 5' end of the probe can be marked as a fluorescent reporter group and can be FAM, HEX, JOE, HEX, ROX or CY5; the 3' end can be marked as a fluorescence quenching group and can be BHQ1 or BHQ2;

preferably, the 5 'end of the Taqman probe for detecting HPV16, HPV33 and HPV58 is marked with FAM, and the 3' end is marked with BHQ1;

preferably, the 5 'end of the Taqman probe for detecting HPV18, HPV45 and HPV59 is marked with ROX, and the 3' end is marked with BHQ2;

preferably, the 5 'end of the Taqman probe for detecting HPV31, HPV52 and HPV68 is marked with CY5, and the 3' end is marked with BHQ2;

preferably, 5 'end of Taqman probe for detecting internal standard is marked with HEX, and 3' end is marked with BHQ1.

Wherein in the combination of the primer and the probe, SEQ ID NO. 1, SEQ ID NO. 6, SEQ ID NO. 9, SEQ ID NO. 12, SEQ ID NO. 14, SEQ ID NO. 16 and SEQ ID NO. 19 are limiting primers, and the concentration of the limiting primers is 0.02-0.05 mu M; 2, 3, 4, 7, 8, 10, 13, 15, 17, 20 are non-limiting primers with a concentration of 0.2-1. Mu.M; the concentration of the probe is 0.2-0.4 mu M.

The invention provides a primer, a probe combination and a parting reagent for detecting HPV DNA and mRNA, which comprises PCR reaction liquid 1, PCR reaction liquid 2, negative control and positive control.

The PCR reaction solution 1 contains Tricine (pH 8.3), DMSO, and NaN ₃ UNG enzyme, rTth DNA polymerase and dNTP; the PCR reaction solution 2 contains Mn (OAc) ₂ 、Mg(OAc) ₂ KOAc, naN ₃ 。

In some embodiments, the PCR reaction solution 1 comprises: tricine (pH 8.3) 100mM, DMSO 2%, naN ₃ 0.02%, 0.3. Mu.L UNG enzyme at a concentration of 1U/. Mu.L, 1. Mu.L rTth enzyme at a concentration of 5U/. Mu.L, 0.3mM each of dATP, dGTP, dCTP and dUTP, primers and probes (final concentrations of the primers and probes: 0.02 to 0.05. Mu.M for limiting primers, 0.2 to 1. Mu.M for non-limiting primers, and 0.2 to 0.4. Mu.M for specific probes), and the balance ultrapure water; the PCR reaction solution 2 contains Mn (OAc) ₂ 2mM、Mg(OAc) ₂ 2mM、KOAc 100mM、NaN ₃ 0.02% and the balance ultrapure water.

The DNA polymerase is rTth DNA polymerase.

Negative control: the negative control is a pseudovirus solution containing an internal standard specific target DNA fragment.

Positive control: the positive control is a pseudoviral solution containing an internal standard specific target DNA fragment, an HPV E6/E7 or an L1 region specific target fragment.

2. Nucleic acid extraction:

and (3) extracting sample nucleic acid by adopting a paramagnetic particle method, and simultaneously extracting a negative control and a positive control. After the extraction of nucleic acid is completed, the extracted nucleic acid can be immediately used for PCR detection, or the extracted nucleic acid is transferred into a centrifugal tube and stored at the temperature of-20 ℃ for subsequent nucleic acid detection.

3. Preparing a reaction system:

the reaction system was 40. Mu.L. Adding 10 mul PCR reaction solution 1, 5 mul PCR reaction solution 2 and 25 mul nucleic acid extract into the amplification tube in sequence, covering the reaction tube tightly, marking, centrifuging instantaneously, transferring to PCR amplification area for PCR detection.

4. And (3) computer detection:

detection was performed on the macro stone SLAN 96. Item type selection "standard melting curve", and simultaneously selection of FAM, HEX, ROX and Cy5 channels; the melting curve parameter selects "Step Mode", then the "scan interval" is set to 0.5 ℃ and the "constant temperature" is set to 15s. The PCR amplification procedure was as follows: 2min at 50 ℃; 30min at 60 ℃; 3min at 95 ℃; 45 cycles of 95 ℃ 15s,60 ℃ 30 s; the melting curve analysis step program is set as follows: 2min at 95 ℃; the temperature is gradually increased to 80 ℃ for 2min at 40 ℃, and fluorescence signals are collected for 1 time at every 0.5 ℃ rise in the process.

5. And (4) analyzing results:

after the amplification reaction is finished, the result is automatically stored by the instrument, and the result can be automatically analyzed by software or manually adjusted by a base line and a threshold line value.

Negative control: FAM, ROX and CY5 channels have no melting peak;

positive control: FAM, ROX and CY5 channels all have melting peaks, and the typing results are HPV16, HPV18 and HPV31 respectively.

The Tm value ranges for each type in each channel are shown in table 1:

TABLE 1

1) After the negative control and the positive control meet the requirements, analyzing the sample result, if the negative control and the positive control do not meet the requirements, the test is invalid, and the test needs to be carried out again;

2) If the internal standard has a melting peak at the position corresponding to the Tm value and each type of the FAM, ROX and CY5 channels has a melting curve at the position corresponding to the Tm value, the internal standard can be judged as positive of the corresponding type;

3) If the internal standard has a melting peak at the position corresponding to the Tm value and each type of FAM, ROX and CY5 channels has no melting curve at the position corresponding to the Tm value, the internal standard can be judged as negative of the corresponding type;

4) If the internal standard has no melting peak at the corresponding Tm value, the test has no reference property and needs to be performed again.

Unless otherwise specified, the raw materials, reagents, consumables and instruments according to the present invention are all commercially available products, and are all commercially available.

The invention is further illustrated by the following examples:

example 1: primer and probe reagent combination 1 for detecting HPV DNA and mRNA

Primer and probe reagent combination 1

The sequences of the primers and the probes are as follows:

(5) The nucleotide sequences of the primer pair and the probe for detecting HPV45 type are respectively shown as SEQ ID NO. 6, 8 and 11;

(7) The nucleotide sequences of the primer pair and the probe for detecting HPV31 type are respectively shown in SEQ ID NO 12, 13 and 18;

(9) The nucleotide sequences of the primer pair and the probe for detecting the HPV68 type are respectively shown as

SEQ ID NO

16, 17 and 18.

SEQ ID NO:1：TGCGACGTGAGGTATATGACTTTG

SEQ ID NO:2：GTTGTTCCATACAAACTATAACA

SEQ ID NO:3：AGATAAGAACCGCAAACACAGT

SEQ ID NO:4：GATAGCAATCGTAAACACACT

SEQ ID NO:5：AGAGATGGGAATCCATATGCTGTATGTG

(5 '-end Mark FAM,3' -end Mark BHQ 1)

SEQ ID NO:6：CCGACGAGCCGAACCACA

SEQ ID NO:7：GGACACACAAAGGACAGGGTGTTC

SEQ ID NO:8：CGGACACACAAAGGACAAGGTGCT

SEQ ID NO:9：GTTTCTTCCCAGGCTGCTACTGAT

SEQ ID NO:10：ATTTGAAAAGGTGCTAGATGCCG

SEQ ID NO:11：ATGTTGTGTATGTGTTGTAAGT

(5 'end mark ROX,3' end mark BHQ 2)

SEQ ID NO:12：GGATTTCCTGATACATCTTTT

SEQ ID NO:13：CAGGACCACCGGCATATCTATTA

SEQ ID NO:14：GGTTTTCCAGATACATCT

SEQ ID NO:15：GGTTTACCAGCATATTTGTTACTG

SEQ ID NO:16：GGGTTTCCCTACCTGATCCTAAT

SEQ ID NO:17：CAGTAACAAATATGCTGGTAAACC

SEQ ID NO:18：TAATCCTGAAACTCAACGCTTAGTTTG

(5 'end marker CY5,3' end marker BHQ 2)

SEQ ID NO:19：CTACTCCCAGGAGCAGGGAG

SEQ ID NO:20：GTGTCTGTTTGAGGTTGCTAGTG

SEQ ID NO:21：GGCAGAGCCATCTATTGCTTACATTTGCT

(5 'end marker HEX,3' end marker BHQ 1)

The length of the Taqman probe of the probe is 20-30 bp.

FAM is marked at the 5 'end of a Taqman probe for detecting HPV16, HPV33 and HPV58, and BHQ1 is marked at the 3' end;

marking ROX at the 5 'end and BHQ2 at the 3' end of the Taqman probe for detecting HPV18, HPV45 and HPV 59;

marking CY5 at the 5 'end of a Taqman probe for detecting HPV31, HPV52 and HPV68, and marking BHQ2 at the 3' end;

HEX is marked at the 5 'end of the Taqman probe for detecting the internal standard, and BHQ1 is marked at the 3' end.

In the combination of the primers and the probes, SEQ ID NO 1, SEQ ID NO 6, SEQ ID NO 9, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16 and SEQ ID NO 19 are limiting primers, and the concentration of the limiting primers is 0.02-0.05 mu M; SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 13, SEQ ID NO 15, SEQ ID NO 17, SEQ ID NO 20 are non-limiting primers, the concentration of the non-limiting primers is 0.2 to 1. Mu.M; the concentration of the probe is 0.2-0.4 mu M.

The primer, probe combination and typing reagent combination 1 for detecting HPV DNA and mRNA comprises PCR reaction liquid 1, PCR reaction liquid 2, negative control and positive control.

The PCR reaction solution 1 includes: tricine (pH 8.3) 100mM, DMSO 2%, naN ₃ 0.02%, 0.3. Mu.L UNG enzyme at a concentration of 1U/. Mu.L, 1. Mu.L rTth enzyme at a concentration of 5U/. Mu.L, 0.3mM each of dATP, dGTP, dCTP, and dUTP, primers and probes (final concentrations of the primers and probes: 0.02. Mu.M for limiting primer, 0.2. Mu.M for non-limiting primer, and 0.2. Mu.M for specific probe), and the balance ultrapure water; the PCR reaction solution 2 contains Mg (OAc) ₂ 2mM、KOAc 100mM、NaN ₃ 0.02 percent and the balance of ultrapure water.

The DNA polymerase is rTth DNA polymerase.

Negative control: the negative control is a pseudoviral solution containing an internal standard specific target DNA fragment.

(II) detection method

1. Nucleic acid extraction:

and extracting nucleic acid of the sample by adopting a magnetic bead method, and simultaneously extracting a negative control and a positive control. After the extraction of nucleic acid is completed, the nucleic acid can be immediately used for PCR detection, or the extracted nucleic acid is transferred into a centrifugal tube and stored at the temperature of-20 ℃ for subsequent nucleic acid detection.

2. Preparing a reaction system:

3. And (3) computer detection:

4. And (4) analyzing results:

Negative control: FAM, ROX and CY5 channels have no melting peak;

The Tm value ranges for each type in each channel are shown in table 1:

TABLE 1

3) If the internal standard has a melting peak at the position corresponding to the Tm value and each type of the FAM, ROX and CY5 channels has no melting curve at the position corresponding to the Tm value, the internal standard can be judged as negative of the corresponding type;

(III) results of the experiment

And (3) taking a positive pseudovirus sample containing one or more types of HPV16, HPV18, HPV31, HPV33, HPV45, HPV52, HPV58, HPV59 and HPV68 for detection according to the detection method in the step (II). The results are shown in FIGS. 1 to 13.

Example 2: primer and probe reagent combination 2 for detecting HPV DNA and mRNA

Only the amount of the primer probe in the PCR reaction solution 1 was adjusted, and the other conditions were the same as in example 1.

The PCR reaction solution 1 includes: tricine (pH 8.3) 100mM, DMSO 2%, naN ₃ 0.02%, 0.3. Mu.L UNG enzyme at a concentration of 1U/. Mu.L, 1. Mu.L rTth enzyme at a concentration of 5U/. Mu.L, 0.3mM each of dATP, dGTP, dCTP, and dUTP, primers and probes (final concentrations of the primers and probes: 0.05. Mu.M for the limiting primer, 0.1. Mu.M for the non-limiting primer, and 0.4. Mu.M for the specific probe), and the balance ultrapure water; the PCR reaction solution 2 contains Mn (OAc) ₂ 2mM、Mg(OAc) ₂ 2mM、KOAc 100mM、NaN ₃ 0.02% and the balance ultrapure water.

Taking a positive pseudovirus sample containing HPV58 and HPV52 for detection. The results are shown in FIGS. 14 and 15.

Example 3: primer and probe reagent combination 3 for detecting HPV DNA and mRNA

The PCR reaction solution 1 includes: tricine (pH 8.3) 100mM, DMSO 2%, naN ₃ 0.02%, 0.3. Mu.L UNG enzyme at a concentration of 1U/. Mu.L, 1. Mu.L rTth enzyme at a concentration of 5U/. Mu.L, 0.3mM each of dATP, dGTP, dCTP and dUTP, primers and probes (final concentrations of the primers and probes: 0.03. Mu.M for limiting primer, 0.45. Mu.M for non-limiting primer and 0.4. Mu.M for specific probe), and the balance ultrapure water; the PCR reaction solution 2 contains Mn (OAc) ₂ 2mM、Mg(OAc) ₂ 2mM、KOAc 100mM、NaN ₃ 0.02% and the balance ultrapure water.

Taking a positive pseudovirus sample containing HPV18 or HPV16 for detection. The results are shown in FIGS. 16 and 17.

Example 4: sensitivity and specificity experiments

Sensitivity test: diluting HPV types in the detection range in the second generation human papilloma virus complete genome national reference products to 1 x 10 by using TE solution ³ ～1×10 ⁴ The results of the detection by copies/reaction are shown in Table 2, which shows that the HPV types in the detection range of the method provided by the invention are all detected and can be accurately typed.

TABLE 2

And (3) specific experiments: diluting HPV types which are not in a detection range in the second generation human papilloma virus complete genome national reference products to 1 x 10 by using TE solution ⁴ ～1×10 ⁵ copies/reactions, assay results are shown in Table 3, illustrating the method provided by the inventionHas no cross reaction with other pathogens and other types of HPV, and has better specificity.

TABLE 3

Example 5: repeatability test

1. The amount of each component in each reaction solution was the same as that described in example 1 in the patent, and 68 types of samples and three duplicate wells were tested, and the results are shown in FIG. 18, which indicates that the Tm values of the respective types were less different and the reproducibility was better.

2. The amount of each component in each reaction solution was the same as that described in example 1 of the patent, and the results of testing the 18, 45, 59 type mixed samples and three duplicate wells are shown in FIG. 19, which indicates that the Tm values of the respective types were small in difference and good in reproducibility.

3. The amount of each component in each reaction solution was the same as that described in example 1 in the patent, and the results of testing the mixed samples of

types

16, 33 and 58 and two duplicate wells are shown in FIG. 20, which indicates that the Tm values of the respective types are smaller and the repeatability is better.

Comparative example: other primer Probe combinations

The usage amount of each component in each reaction solution is consistent with that described in example 1 in the patent, and the detection method is carried out according to the detection method described in example 1, multiple groups of primer groups of each type are selected preferentially, and one group with higher melting peak height is selected for multiple combination.

1. Primer combination type 58

The HPV type 58 experimental group is the final selected sequence combination, the other two control groups are the sequence combinations with poor effect, and the detection concentration is 1 multiplied by 10 ⁵ copies/mL of pseudovirus samples.

HPV58 control groups 1-R:5 'ATACTCACTTTATTTTAGATAGCAATCGT-3' (SEQ ID NO: 22)

HPV58 control group 2-R:5 'CAATCGTAACACACATTTTACATACTG-3' (SEQ ID NO: 23)

As can be seen from FIG. 21 and the data therein, the melting peak height of the experimental group is significantly higher than that of the control group in the three combinations of HPV type 58, and the primer probe for HPV type 58 is determined to be the experimental group.

2. Type 52 primer combination

The HPV52 type experimental group is the final selected sequence combination, the other two groups of control groups are the sequence combinations with poor effect, and the detection concentration is 1 multiplied by 10 ⁵ copies/mL pseudovirus samples.

HPV52 control groups 1-F:5 'AGAATTAAATTGCCGGACCTCTAAT-3' (SEQ ID NO: 24)

HPV52 control groups 1-R:5 'CCAAATTTATTAGGGTCCGGCAA-3' (SEQ ID NO: 25)

HPV52 control group 2-F:5 'TTGCCGGACCCTAATAAATTTGGTT-3' (SEQ ID NO: 26)

HPV52 control group 2-R:5' TTATCTATATACCAGGTTTTACCAGCA-

As can be seen from FIG. 22 and the data therein, the heights of the melting peaks in the experimental groups of the three combinations of HPV type 52 are significantly higher than those in the corresponding pairs

According to the control group, the primer probe for determining the HPV type 52 is an experimental group.

3. Type 59 primer combination

The HPV59 type experimental group is the sequence combination selected finally, the other two groups of control groups are the sequence combinations with poor effect, and the detection concentration is 1 multiplied by 10 ⁵ copies/mL pseudovirus samples.

HPV59 control groups 1-F:5 'ACCTCTTGTTTTCTTCCCAGG-3' (SEQ ID NO: 28)

HPV59 control groups 1-R:5 'AGGAATTGTAAATGCAGTGTTGG-3' (SEQ ID NO: 29)

HPV59 control group 2-F:5 'ATTGCAACCTCTTGTTCTTCCCAG-3' (SEQ ID NO: 30)

HPV59 control group 2-R:5 'flag TGTAAATGCAGTGTTGGCAGTACTA-flag 3' (SEQ ID NO: 31).

As can be seen from FIG. 23 and the data therein, the melting peak height of the experimental group is significantly higher than that of the control group in the three HPV59 types, and the primer probe for determining HPV59 type is the experimental group.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Claims

1. A primer, characterized by comprising a primer 1, a primer 2, a primer 3, a primer 4, a primer 5, a primer 6, a primer 7, a primer 8, a primer 9, a primer 10, a primer 11, a primer 12, a primer 13, a primer 14, a primer 15, a primer 16 or a primer 17;

the primer 1 has:

(1) The nucleotide sequence shown as SEQ ID NO. 1; or

(2) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (1) has the same or similar functions as the nucleotide sequence in (1); or

the primer 2 has:

(4) The nucleotide sequence shown as SEQ ID NO. 2; or

the primer 3 has:

(7) The nucleotide sequence shown as SEQ ID NO. 3; or

the primer 4 has:

(10) The nucleotide sequence shown as SEQ ID NO. 4; or

(11) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (10) has the same or similar function as that of (10); or

the primer 5 has:

(13) A nucleotide sequence shown as SEQ ID NO. 6; or

(14) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (13) has the same or similar functions as the nucleotide sequence shown in (13); or

the primer 6 has:

(16) The nucleotide sequence shown as SEQ ID NO. 7; or

(17) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (16) has the same or similar function as that of (16); or

the primer 7 has:

(19) The nucleotide sequence shown as SEQ ID NO. 8; or

(20) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (19) has the same or similar functions as the nucleotide sequence shown in (19); or

the primer 8 has:

(22) And a nucleotide sequence shown as SEQ ID NO. 9; or

(23) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (22) has the same or similar functions as the nucleotide sequence shown in (22); or

the primer 9 has:

(25) The nucleotide sequence shown as SEQ ID NO. 10; or

the primer 10 has:

(28) And a nucleotide sequence shown as SEQ ID NO. 12; or

the primer 11 has:

(31) A nucleotide sequence shown as SEQ ID NO. 13; or

the primer 12 has:

(34) 14 as shown in SEQ ID NO; or

(35) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (34) has the same or similar functions as the nucleotide sequence shown in (34); or

the primer 13 has:

(37) 15, as shown in SEQ ID NO; or

the primer 14 has:

(40) The nucleotide sequence shown as SEQ ID NO. 16; or

the primer 15 has:

(43) A nucleotide sequence shown as SEQ ID NO. 17; or

(44) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (43) has the same or similar function as that of (43); or

the primer 16 has:

(46) Nucleotide sequence shown as SEQ ID NO. 19; or

the primer 17 has:

(49) The nucleotide sequence shown as SEQ ID NO. 20; or

the plurality is 2 to 7.

2. A probe comprising probe 1, probe 2, probe 3 or probe 4;

the probe 1 has:

(52) 5 as shown in SEQ ID NO; or

(53) The nucleotide sequence obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (52) has the same or similar functions as those of (52); or

the probe 2 has:

(55) A nucleotide sequence shown as SEQ ID NO. 11; or

the probe 3 has:

(58) A nucleotide sequence shown as SEQ ID NO. 18; or

the probe 4 has:

(61) The nucleotide sequence shown as SEQ ID NO. 21; or

the plurality is 2 to 7.

3. A primer probe set comprising one or more of combination 1, combination 2, combination 3, combination 4, combination 5, combination 6, combination 7, combination 8, or combination 9;

the combination 1 comprises the primer 1 in the primer of claim 1, the primer 2 in the primer of claim 1, and the probe 1 in the probe of claim 2;

the combination 2 comprises the primer 1 in the primer of claim 1, the primer 3 in the primer of claim 1, and the probe 1 in the probe of claim 2;

the combination 3 comprises the primer 1 in the primer of claim 1, the primer 4 in the primer of claim 1, and the probe 1 in the probe of claim 2;

the combination 4 comprises the primer 5 in the primer of claim 1, the primer 6 in the primer of claim 1, and the probe 2 in the probe of claim 2;

the combination 5 comprises the primer 5 of the primer of claim 1, the primer 7 of the primer of claim 1, and the probe 2 of the probe of claim 2;

the combination 6 comprises the primer 8 of the primer of claim 1, the primer 9 of the primer of claim 1, and the probe 2 of the probe of claim 2;

the combination 7 comprises the primer 10 in the primer of claim 1, the primer 11 in the primer of claim 1, and the probe 3 in the probe of claim 2;

the combination 8 comprises the primer 12 of the primer of claim 1, the primer 13 of the primer of claim 1, and the probe 3 of the probe of claim 2;

the combination 9 comprises the primer 14 of the primer of claim 1, the primer 15 of the primer of claim 1 and the probe 3 of the probe of claim 2.

4. The primer probe set of claim 3, further comprising combination 10;

the combination 10 comprises the primer 16 of the primer of claim 1, the primer 17 of the primer of claim 1 and the probe 4 of the probe of claim 2.

5. Use of a primer according to claim 1, a probe according to claim 2 or a primer probe set according to claim 3 or 4 for:

(I) Detecting HPV; and/or

(II) typing HPV; and/or

(III) preparing a reagent, a kit or a device for detecting HPV; and/or

(IV) preparing a reagent, kit or device for typing HPV;

the HPV comprises one or more of HPV16, HPV18, HPV31, HPV33, HPV45, HPV52, HPV58, HPV59 or HPV 68.

6. A reagent comprising the primer of claim 1, the probe of claim 2 or the primer probe set of claim 3 or 4, and an acceptable adjuvant or adjuvant.

7. The reagent of claim 6, comprising:

the concentration of the restriction primer is 0.02-0.05 mu M; and/or

The concentration of the non-limiting primer is 0.2-1 mu M; and/or

The concentration of the probe is 0.2-0.4 mu M;

the restriction primer comprises the primer 1, the primer 5, the primer 8, the primer 10, the primer 12, the primer 14 or the primer 16;

the non-limiting primer includes the primer 2, the primer 3, the primer 4, the primer 6, the primer 7, the primer 9, the primer 11, the primer 13, the primer 15 or the primer 17.

8. A kit comprising the agent of claim 6 or 7, and an acceptable adjuvant or adjuvant.

9. The kit of claim 8, comprising: PCR reaction solution 1, PCR reaction solution 2, negative control and positive control;

the PCR reaction solution 1 includes:

(a) Tricine with a pH of 8.3; and/or

(b) DMSO; and/or

(c)、NaN ₃ (ii) a And/or

(d) UNG enzyme; and/or

(e) A DNA polymerase; and/or

(f)、dNTP；

The DNA polymerase includes rTth DNA polymerase;

A method for typing HPV16, HPV18, HPV31, HPV33, HPV45, HPV52, HPV58, HPV59 or HPV68, comprising amplifying a sample using the primer probe sets and amplification reagents of claim 3 or 4 to obtain a melting curve and a temperature corresponding to a melting peak, and comparing the melting curve and the temperature to obtain typing results when a negative control and a positive control are established;

the comparing comprises:

(i) If the temperature corresponding to the melting peak of the channel 1 falls within 70 +/-1.5 ℃, and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 16; and/or

(iii) If the temperature corresponding to the melting peak of the channel 1 falls within 50 +/-1.5 ℃ and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 58; and/or

(vi) If the temperature corresponding to the melting peak of the channel 2 falls within 50 +/-1.5 ℃ and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 59; and/or

(vii) If the temperature corresponding to the melting peak of the channel 3 falls within 67 +/-1.5 ℃ and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 31; and/or

(viii) If the temperature corresponding to the melting peak of the channel 3 falls within 63 +/-1.5 ℃ and the temperature corresponding to the melting peak of the channel 4 falls within 61 +/-1.5 ℃, the sample is positive for HPV 52; and/or