CN108728578A - Detect the method and kit of a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction - Google Patents
Detect the method and kit of a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction Download PDFInfo
- Publication number
- CN108728578A CN108728578A CN201810600850.3A CN201810600850A CN108728578A CN 108728578 A CN108728578 A CN 108728578A CN 201810600850 A CN201810600850 A CN 201810600850A CN 108728578 A CN108728578 A CN 108728578A
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- specific probe
- variety
- single tube
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/708—Specific hybridization probes for papilloma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
This case is related to a kind of in single tube reaction while the method that detects a variety of high-risk human mammilla papillomavirus and its hypotype, it recycles Single-tube multiplex-PCR amplified reaction to obtain target fragment by designing specific primer, and designs specific probe and obtained target fragment is detected with fluorescence quantitative PCR method.The present invention passes through the improvement to existing HPV nucleic acid detection kit formula so that 5 forward primers and 7 reverse primers can be used only in the technical solution of the application can realize each two hypotypes that are highly sensitive, detecting 8 kinds of high-risk human mammilla papillomavirus and other 6 kinds of high-risk human mammilla papillomavirus with high specificity simultaneously in single tube reaction.
Description
Technical field
The present invention relates to in-vitro diagnosis fields, and a variety of high-risk-type people are detected simultaneously in single tube reaction more particularly to one kind
The method and kit of papillomavirus and its hypotype.
Background technology
Human papilloma virus (human papillomavirus, HPV) is a kind of thermophilic epithelial double-stranded DNA spherical virus,
Belong to Papillomaviridae, main infection skin and mucosal tissue.HPV infection can cause wart, benign tumour and cancer.At present
It can cause to include the kinds cancers such as cervical carcinoma, carcinoma of vagina, carcinoma of penis, cancer of anus, oropharyngeal cancer evidence show HPV infection.According to
International human papilloma virus reference center (International Human Papillomavirus Reference Center)
Recent statistics, at present altogether find more than 200 kinds HPV genotype.However not all HPV genotype can induce cancer
Disease.The infection of low risk HPV can induce the mankind's verruca vulgaris being grown on reproductive organs neighbouring skin and mucous membrane, condyloma acuminatum
And benign lesions, the infection of high-risk HPV only few in number such as papilloma being grown on mucous membrane are potentially carcinogenic.Mesh
The example carcinogenic most deep HPV of preceding understanding is women cervical carcinoma.Exactly because also pioneer's sex work in this respect, German section
Scholar Harald zur Hausen obtained Nobel's physiology and Medicine in 2008.
Cervical carcinoma is the malignant tumour being happened at womb hypomere uterine neck, is the 4th malignant tumour occurred frequently in women,
Account for the 4th of the woman cancer death rate.According to the International Cancer Research Center (IARC) of International Health Organization (WHO), 2012
Year, global cervical carcinoma new cases were 52.8 ten thousand, and there are about 26.6 ten thousand women to die of cervical carcinoma.The generation of nearly all cervical carcinoma
All be caused by the persistent infection of high-risk HPV, and need from initial infection to cancer to undergo 5 to 10 years when
Between.Therefore, using using the hereditary material DNA of high-risk HPV cervical carcinoma is carried out as the HPV molecular diagnostic techniques of detection object
Screening can find the etiological cause of the disease in advance, effectively early prevention be carried out to cervical carcinoma, to reduce morbidity and mortality.With vinegar
Acid is visually inspected, Pap smear is compared with traditional cervical carcinoma screening means such as liquid based cytology, and the diagnosis of HPV molecules has sensitivity
The advantage of subjective judgement that is high and not depending on pathologist.Therefore, HPV molecules diagnosis has become current developed country's cervical carcinoma
The prefered method of screening.
The maximum challenge of HPV molecular diagnostic techniques is while ensureing detection sensitivity effectively by high-risk-type
HPV is distinguished with low risk HPV, to avoid excessively diagnosis and over-treatment and thus being produced to patient caused by due to mistaken diagnosis
Raw unnecessary stress.As previously mentioned, presently found HPV genotype alreadys exceed 200 kinds, wherein only 14 kinds of height
Danger type can induce cervical carcinoma, i.e. HPV16,18,31,33,35,39,45,51,52,56,58,59,66 and 68.In addition, even if
Be in this 14 kinds of high-risk HPVs it is not each genotype carciongenic potency all having the same yet.HPV16 and 18 is wherein to endanger
Maximum two genotype of evil, the two lead to 55% and 15% cases of cervical cancer respectively.Therefore, it is possible to HPV16 and 18 into
The high-risk HPV molecular diagnostic techniques of row parting have original advantage for the HPV shuntings for detecting positive patient.Further more, simultaneously
The patient that not all uterus neck has infected high-risk HPV is just bound to suffer from cervical carcinoma, and most of such infection is a mistake
Sexuality dye, i.e., the immune function of human body itself can effectively be removed in 6 to 24 months.Can high-risk HPV be exempted from
The determinant that epidemic disease system is removed is various, has both included the ability that patients immune system removes infection, also includes being infected
The virus load of HPV.Epidemiological study for many years shows high-risk HPV infection, and there are a clinical threshold values.Virus load
It is often transient infection less than the infection of the high-risk HPV of this threshold value, can seldom induces cervical carcinoma；And virus load is higher than this
The probability of the infection-induced cervical carcinoma of one threshold value will increase significantly.Therefore, it is used for the high-risk HPV molecule of cervical carcinoma early screening
Diagnostic techniques should also distinguish the transient infection of low carrying capacity with certain quantitation capabilities and may finally induce cervical carcinoma
High carrying capacity infection.
Mainly there are hybrid capture, PCR- revert dot blot hybridizations, liquid chip method for the detection method of HPV nucleic acid at present
With fluorescence quantitative PCR method etc..The characteristics of for above-mentioned high-risk HPV molecular diagnostic techniques for cervical carcinoma early screening and
The performance indicator of other aspects summarises the main advantage and disadvantage of these types of method in following table：
As can be seen from the above table, consider from methodology angle, can most meet the detection of cervical carcinoma early screening requirement at present
Means are fluorescent quantitative PCR techniques.The sensitivity and specificity of the technology are above hybrid capture and miscellaneous with PCR- reversal points
Friendship method and liquid chip method are suitable.Fluorescence quantitative PCR method can be accurately fixed to be carried out within the scope of very large span to detection object
Amount, and hybridized with the probe being fixed on film or microballoon using PCR final products and realize that the PCR- reversal points of target sequence detection are miscellaneous
Friendship method and liquid chip rule cannot quantify.
In the prior art, HPV nucleic acid detection is carried out using fluorescent quantitative PCR technique, needs to be directed to each HPV gene
Type provides a specific probe, a forward primer and a reverse primer, and multiple HPV bases are detected simultaneously in single tube reaction
When because of type, several groups specific probe, forward primer and reverse primer will certainly cause more non-specific bindings, this is one
Determine to affect sensitivity and the precision of detection in degree.
Invention content
Place against the above deficiency, it is a variety of for being detected simultaneously in single tube reaction that the purpose of the present invention is to provide one kind
The method and kit of high-risk human mammilla papillomavirus and its hypotype.
Technical scheme of the present invention is summarized as follows：
A method of detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction, wherein logical
Cross design specific primer recycle Single-tube multiplex-PCR amplified reaction obtain target fragment, and design specific probe use
Fluorescence quantitative PCR method is detected obtained target fragment.
Preferably, the side for detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, wherein the specific primer includes：
For expanding this 8 kinds of genotype of HPV16,18,31,33,39,56,59 and 68 and the and of HPV35,45,51,52,58
Each two hypotypes of 66 this 6 kinds of genotype, the specific primer of totally 20 kinds of genotype and hypotype, forward primer quantity are 5, sequence
It is classified as SEQ ID NO.21-25.
Preferably, the side for detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, wherein the specific primer includes：
For expanding this 8 kinds of genotype of HPV16,18,31,33,39,56,59 and 68 and the and of HPV35,45,51,52,58
Each two hypotypes of 66 this 6 kinds of genotype, the specific primer of totally 20 kinds of genotype and hypotype, reverse primer quantity are 6, sequence
It is classified as SEQ ID NO.26-32.
Preferably, the side for detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, wherein the specific primer further includes having and the hemoglobin β gene DNA complementary pairings as Quality Control in human body cell
Specific primer, forward primer be SEQ ID NO.34, reverse primer be SEQ ID NO.35.
Preferably, the side for detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, wherein the specific probe includes：
For the specific probe of HPV16, sequence is SEQ ID NO.1；
For the specific probe of HPV18, sequence is SEQ ID NO.2；
For the specific probe of HPV31, sequence is SEQ ID NO.3；
For the specific probe of HPV33, sequence is SEQ ID NO.4；
For the specific probe of HPV39, sequence is SEQ ID NO.7；
For the specific probe of HPV56, sequence is SEQ ID NO.14；
For the specific probe of HPV59, sequence is SEQ ID NO.17；
For the specific probe of HPV68, sequence is SEQ ID NO.20；
The specific probe of two hypotypes for HPV35, sequence are SEQ ID NO.5 and SEQ ID NO.6；
The specific probe of two hypotypes for HPV45, sequence are SEQ ID NO.8 and SEQ ID NO.9；
The specific probe of two hypotypes for HPV51, sequence are SEQ ID NO.10 and SEQ ID NO.11；
The specific probe of two hypotypes for HPV52, sequence are SEQ ID NO.12 and SEQ ID NO.13；
The specific probe of two hypotypes for HPV58, sequence are SEQ ID NO.15 and SEQ ID NO.16；
The specific probe of two hypotypes for HPV66, sequence are SEQ ID NO.18 and SEQ ID NO.19.
Preferably, the side for detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, wherein the specific probe further includes and hemoglobin β gene DNA complementary pairings as Quality Control in human body cell
Specific probe, sequence are SEQ ID NO.33.
A kind of kit detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction, wherein
It uses the above-mentioned method progress for detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction high-risk
Type human papilloma virus detects.
Preferably, the kit includes reaction mixture and thermal starting polymerase.
Preferably, the reaction mixture includes：The MgCl of 4mM2Solution, the dNTPs of 0.2mM, 1X without Mg2+Ion
PCR buffer solutions, 21 a concentration of 0.01-0.05 μM of specific probe；21 a concentration of 0.01-0.05 μM of specificity is visited
Needle；6 a concentration of 0.1-0.9 μM of forward primer；8 a concentration of 0.1-0.8 μM of reverse primer.
The beneficial effects of the invention are as follows：
(1) present invention passes through the improvement to existing HPV nucleic acid detection kit formula so that the technical solution of the application can
It can be by 20 kinds of high-risk human mammilla papillomavirus and its hypotype DNA cloning 5 forward primers and 7 reverse primers are used only
Out, and in single tube reaction realize simultaneously it is highly sensitive, detect 8 kinds of high-risk human mammilla papillomavirus and in addition with high specificity
Each two hypotypes of 6 kinds of high-risk human mammilla papillomavirus；The kit of this case is to existing for HPV35,45,51,52,58 and 66
Two hypotypes of DNA sequence dna have similar testing result；The HPV of different genotype is mixed carry out in a joint manner by the present invention
Detection so that the detection number of samples tested every time increases, to improve detection efficiency.
Each primer in (2) 5 forward primers and 7 reverse primers is not only to act solely on 20 kinds of high-risk-types
One kind in HPV and its hypotype, but contribute to multiple HPV genotype and its hypotype simultaneously, and 5 forward primers and 7 it is anti-
As a whole to primer, the demand of 20 kinds of high-risk HPVs of amplification and its hypotype is met while contributed just.
Description of the drawings
HPV Ct value testing result of the kit of the present invention of 6 different batches of Fig. 1 to same group of standard items；
HBB Ct value testing result of the kit of the present invention of 6 different batches of Fig. 2 to same group of standard items.
Specific implementation mode
With reference to embodiment, the present invention is described in further detail, to enable those skilled in the art with reference to specification
Word can be implemented according to this.
A kind of detection detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction of the present invention
Method includes the following steps：
(1) extraction of sample human papillomavirus HPV DNA；
(2) specific primer is designed, then Single-tube multiplex-PCR amplification is carried out to the sample human papillomavirus HPV DNA of extraction
Target fragment is obtained by the reaction；
(3) specific probe is designed to be detected obtained target fragment with fluorescence quantitative PCR method；
(4) testing result is analyzed, by fluorescence signal value (Ct values) in the PCR reaction systems that detect with comprising
The Ct values of the outer Quality Control of the positive of known concentration HPV standard items determine the content of HPV in sample compared to relatively.
As the another embodiment of this case, specific primer includes：For expanding HPV16,18,31,33,39,56,59 and 68
Each two hypotypes of this 8 kinds of genotype and this 6 kinds of genotype of HPV35,45,51,52,58 and 66, totally 20 kinds of genotype and Asia
The specific primer of type, forward primer quantity are 5, and sequence is：SEQ ID NO.21-25；Reverse primer quantity is 6, sequence
It is classified as：SEQ ID NO.26-32.
As the another embodiment of this case, specific primer further includes having and the hemoglobin β as Quality Control in human body cell
The specific primer of gene DNA complementary pairing, forward primer are SEQ ID NO.34, and reverse primer is SEQ ID NO.35.
As the another embodiment of this case, specific probe includes：
For the specific probe of HPV16, sequence is SEQ ID NO.1；
For the specific probe of HPV18, sequence is SEQ ID NO.2；
For the specific probe of HPV31, sequence is SEQ ID NO.3；
For the specific probe of HPV33, sequence is SEQ ID NO.4；
For the specific probe of HPV39, sequence is SEQ ID NO.7；
For the specific probe of HPV56, sequence is SEQ ID NO.14；
For the specific probe of HPV59, sequence is SEQ ID NO.17；
For the specific probe of HPV68, sequence is SEQ ID NO.20；
The specific probe of two hypotypes for HPV35, sequence are SEQ ID NO.5 and SEQ ID NO.6；
The specific probe of two hypotypes for HPV45, sequence are SEQ ID NO.8 and SEQ ID NO.9；
The specific probe of two hypotypes for HPV51, sequence are SEQ ID NO.10 and SEQ ID NO.11；
The specific probe of two hypotypes for HPV52, sequence are SEQ ID NO.12 and SEQ ID NO.13；
The specific probe of two hypotypes for HPV58, sequence are SEQ ID NO.15 and SEQ ID NO.16；
The specific probe of two hypotypes for HPV66, sequence are SEQ ID NO.18 and SEQ ID NO.19.
As the another embodiment of this case, specific probe further includes and the hemoglobin β bases as Quality Control in human body cell
Because of the specific probe of DNA complementary pairings, sequence is SEQ ID NO.33.
A kind of kit detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction, uses
The above-mentioned method progress high-risk-type human milk head for detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Tumor virus detects.
As the another embodiment of this case, kit includes reaction mixture and thermal starting polymerase.
As the another embodiment of this case, reaction mixture includes：The MgCl of 4mM2Solution, the nothing of the dNTPs of 0.2mM, 1X
Mg2+Ion PCR buffer solutions, 21 a concentration of 0.01-0.05 μM of specific probe；21 a concentration of 0.01-0.05 μM of spy
Specific probes；6 a concentration of 0.1-0.9 μM of forward primer；8 a concentration of 0.1-0.8 μM of reverse primer.
Table 1 shows the sequence of specific specific primer and probe：
Table 1：
In table 1, the fluorophor that HPV16 probes (SEQ ID NO.1) use is FAM；HPV18 probes (SEQ ID
NO.2 the fluorophor) used is JOE；This 6 genotype of HPV31,33,39,56,59 and 68 and HPV35,45,51,52,58
It is ROX, SEQ with the fluorophor that 18 probes (SEQ ID NO.3-20) of each two hypotypes of 66 this 6 kinds of genotype use
Fluorophor used in ID NO.33 is CY5.
What table 2 provided a specific embodiment includes above-mentioned all specific primers and specific probe, can detect simultaneously
All PCR reaction solutions for single tube multiple fluorescence quantitative PCR of 20 kinds of HPV genotype and hypotype.The reaction formula of liquid is shown in Table
2：
Table 2
In order to verify the technical performance of kit of the present invention, this team is prepared for 20 and separately includes above-mentioned 20 kinds of HPV bases
Because of type and its plasmid of the DNA target sequence of hypotype, and mix from human genome DNA to prepare different components and various concentration
Standard items.The purpose that human genome DNA is added into standard items is to simulate the human DNA certainly existed in clinical sample.
Human genome DNA origin in these standard items is cultivated cell purification derived from the Jurkat of T cell leukaemic and is obtained.Separately
Outside, the present invention is to MgCl2Concentration, enzyme, dUTPs, primer and probe dosage optimize so that the amplification curve of real-time PCR
It is more beautiful and stable, so that testing result is relatively reliable.
Embodiment 1：
In order to verify the stability of kit formulation of the present invention, 6 laboratory technicians use 6 sets of different batches in not same date
Raw material reagent is prepared for the kit of 6 different batches, and gained kit is used in combination to be detected same group of standard items.Gained
As a result it shows that the testing result of 6 batches of kits is very close (table 3 and Fig. 1, Fig. 2), illustrates that the stabilization of kit performance of this case is high.
The kit of the present invention of 3. 6 different batches of table detects same group of standard items acquired results：
Embodiment 2：
It is detection object, kit of the present invention and Roche Holding Ag of Switzerland (Roche) cobas with 436 clinical samples
4800HPV kits carry out contrast experiment.Similar to kit of the present invention, cobas kits are also with quantitative fluorescent PCR skill
Art detects this 14 kinds of high-risk HPV genotypes, and can realize parting to HPV16 and 18, and other 12 kinds of genotype are then by same
A fluorescence channel detection.It is completed to these samples first, in accordance with cobas kit specifications by certain third party's clinical examination mechanism
Detection.This case be directed to remaining sample, the DNA extraction kit invented using this team (《Cervical cell preserves and DNA is fast
The integrated kit of speed extraction and extracting method》, application number：201510896289.4) complete sample in DNA extraction；Then make
DNA after purification is detected with kit of the present invention.The contrast and experiment shows the testing result of two kits
Overall concordance rate reaches 92.2% (table 4).
4. kit of the present invention of table is with cobas kits using clinical sample as the contrast and experiment of object：
Although the embodiments of the present invention have been disclosed as above, but its is not only in the description and the implementation listed
With it can be fully applied to various fields suitable for the present invention, for those skilled in the art, can be easily
Realize other modification, therefore without departing from the general concept defined in the claims and the equivalent scope, the present invention is simultaneously unlimited
In specific details.
Number title sequence two is terminal modified
SEQ ID NO.1 HPV16 probe TTATGTGCTGCCATATCTACTTCAGAAACT 5'-FAM, 3'-BHQ1
SEQ ID NO.2 HPV18 probe CTACACAGTCTCCTGTACCTG 5'-JOE, 3'-BHQ1
SEQ ID NO.3 HPV31 probe GTGCTGCAATTGCAAACAGTGATACTAC 5'-ROX, 3'-BHQ2
SEQ ID NO.4 HPV33 probe CTTTATGCACACAAGTAACTAGTGAC 5'-ROX, 3'-BHQ2
SEQ ID NO.5 HPV35-1 probe CTGCTGTGTCTTCTAGTGACAG 5'-ROX, 3'-BHQ2
SEQ ID NO.6 HPV35-2 probe CTGCTGTGTCTACTAGTGACAG 5'-ROX, 3'-BHQ2
SEQ ID NO.7 HPV39 probe CTATAGAGTCTTCCATACCTTCTAC 5'-ROX, 3'-BHQ2
SEQ ID NO.8 HPV45-1 probe CCTGTGCCAAGTACATATGACCC 5'-ROX, 3'-BHQ2
SEQ ID NO.9 HPV45-2 probe CCTGTGCCAACTCCATATGACCC 5'-ROX, 3'-BHQ2
SEQ ID NO.10 HPV51-1 probe CTGCGGTTTCCCCAAC 5'-ROX, 3'-BHQ2
SEQ ID NO.11 HPV51-2 probe CTGCAGTTTCCCCAAC 5'-ROX, 3'-BHQ2
SEQ ID NO.12 HPV52-1 probe ACTTTATGTGCTGAGGTTAAAAAGG 5'-ROX, 3'-BHQ2
SEQ ID NO.13 HPV52-2 probe ACTTTATGTGCTGAGGTGAAAAAGG 5'-ROX, 3'-BHQ2
SEQ ID NO.14 HPV56 probe CTGCTACAGAACAGTTAAGTAAATATG 5'-ROX, 3'-BHQ2
SEQ ID NO.15 HPV58-1 probe TATGCACTGAAGTAACTAAGGAAGG 5'-ROX, 3'-BHQ2
SEQ ID NO.16 HPV58-2 probe TATGCACTGAAGTAAATAAGGAAGG 5'-ROX, 3'-BHQ2
SEQ ID NO.17 HPV59 probe CTACTTCTTCTATTCCTAATGTATACAC 5'-ROX, 3'-BHQ2
SEQ ID NO.18 HPV66-1 probe CTAAATATGATGCCCGTGAAATCAATC 5'-ROX, 3'-BHQ2
SEQ ID NO.19 HPV66-2 probe CTAAATATGATGCACGTGAAATCAATC 5'-ROX, 3'-BHQ2
SEQ ID NO.20 HPV68 probe CTGAATCAGCTGTACCAAATATTTATG 5'-ROX, 3'-BHQ2
1 TGGTAGATACTACACGCAGTAC of SEQ ID NO.21 forward primers without
2 TTGTTTGTTACTGTAGTTGATAC of SEQ ID NO.22 forward primers without
3 CAGCTTTTTATTACCTGTGTTG of SEQ ID NO.23 forward primers without
4 CAATTGTTTTTAACAGTTGTAG of SEQ ID NO.24 forward primers without
5 CAATTATTTCTTACTGTTGTGG of SEQ ID NO.25 forward primers without
1 GCACAGTTGAAAAATAAACTGTAA of SEQ ID NO.26 reverse primers without
2 GCACAATTGAAAAATAAATTGTAAA of SEQ ID NO.27 reverse primers without
3 GCATAACTGAAATATAAATTGTAAA of SEQ ID NO.28 reverse primers without
4 CATAATTGAAAAATAAATTGCAATTC of SEQ ID NO.29 reverse primers without
5 GCAAAGCTGAAAAACAAACTGTAAG of SEQ ID NO.30 reverse primers without
6 CAAACTGTAGTTCATATTCCTCCAC of SEQ ID NO.31 reverse primers without
7 CAACTGAAATATAAATTGCAAATC of SEQ ID NO.32 reverse primers without
SEQ ID NO.33 HBB probe GCTCCTGGGAGTAGATTG 5'-CY5,3'-BHQ2
SEQ ID NO.34 HBB forward primers CCAGAAGAGCCAAGGACAGGTACG without
SEQ ID NO.35 HBB reverse primers TTTGAGGTTGCTAGTGAACACAG without
Claims (9)
1. a kind of method detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction, feature exist
In recycling Single-tube multiplex-PCR amplified reaction to obtain target fragment by designing specific primer, and design specific spy
Needle is detected obtained target fragment with fluorescence quantitative PCR method.
2. according to claim 1 detect a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, which is characterized in that the specific primer includes：
For expand this 8 kinds of genotype of HPV16,18,31,33,39,56,59 and 68 and HPV35,45,51,52,58 and 66 this
Each two hypotypes of 6 kinds of genotype, the specific primer of totally 20 kinds of genotype and hypotype, forward primer quantity are 5, and sequence is
SEQ ID NO.21-25。
3. according to claim 1 detect a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, which is characterized in that the specific primer includes：
For expand this 8 kinds of genotype of HPV16,18,31,33,39,56,59 and 68 and HPV35,45,51,52,58 and 66 this
Each two hypotypes of 6 kinds of genotype, the specific primer of totally 20 kinds of genotype and hypotype, reverse primer quantity are 7, and sequence is
SEQ ID NO.26-32。
4. according to claim 1 detect a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, which is characterized in that the specific primer further includes mutual with the hemoglobin β gene DNAs Quality Control in human body cell
Recruit to specific primer, forward primer be SEQ ID NO.34, reverse primer be SEQ ID NO.35.
5. according to claim 1 detect a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, which is characterized in that the specific probe includes：
For the specific probe of HPV16, sequence is SEQ ID NO.1；
For the specific probe of HPV18, sequence is SEQ ID NO.2；
For the specific probe of HPV31, sequence is SEQ ID NO.3；
For the specific probe of HPV33, sequence is SEQ ID NO.4；
For the specific probe of HPV39, sequence is SEQ ID NO.7；
For the specific probe of HPV56, sequence is SEQ ID NO.14；
For the specific probe of HPV59, sequence is SEQ ID NO.17；
For the specific probe of HPV68, sequence is SEQ ID NO.20；
The specific probe of two hypotypes for HPV35, sequence are SEQ ID NO.5 and SEQ ID NO.6；
The specific probe of two hypotypes for HPV45, sequence are SEQ ID NO.8 and SEQ ID NO.9；
The specific probe of two hypotypes for HPV51, sequence are SEQ ID NO.10 and SEQ ID NO.11；
The specific probe of two hypotypes for HPV52, sequence are SEQ ID NO.12 and SEQ ID NO.13；
The specific probe of two hypotypes for HPV58, sequence are SEQ ID NO.15 and SEQ ID NO.16；
The specific probe of two hypotypes for HPV66, sequence are SEQ ID NO.18 and SEQ ID NO.19.
6. according to claim 5 detect a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Method, which is characterized in that the specific probe further includes mutual with the hemoglobin β gene DNAs Quality Control in human body cell
Recruit to specific probe, sequence be SEQ ID NO.33.
7. a kind of kit detecting a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction, feature exist
In, use as described in any one of claim 1-6 single tube reaction in and meanwhile detect a variety of high-risk-type human papillomas
The method of virus and its hypotype carries out high-risk human mammilla papillomavirus detection.
8. according to claim 7 detect a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Kit, which is characterized in that the kit includes reaction mixture and thermal starting polymerase.
9. according to claim 8 detect a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction
Kit, which is characterized in that the reaction mixture includes：The MgCl of 4mM2Solution, the dNTPs of 0.2mM, 1X without Mg2+From
Sub- PCR buffer solutions, 21 a concentration of 0.01-0.05 μM of specific probe；21 a concentration of 0.01-0.05 μM of specificity is visited
Needle；6 a concentration of 0.1-0.9 μM of forward primer；8 a concentration of 0.1-0.8 μM of reverse primer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810600850.3A CN108728578A (en) | 2018-06-12 | 2018-06-12 | Detect the method and kit of a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810600850.3A CN108728578A (en) | 2018-06-12 | 2018-06-12 | Detect the method and kit of a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108728578A true CN108728578A (en) | 2018-11-02 |
Family
ID=63929319
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810600850.3A Pending CN108728578A (en) | 2018-06-12 | 2018-06-12 | Detect the method and kit of a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108728578A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110607399A (en) * | 2019-09-20 | 2019-12-24 | 西人马（厦门）科技有限公司 | Primer combination, kit and method for LAMP amplification to detect HPV and typing |
| CN111020061A (en) * | 2019-12-31 | 2020-04-17 | 广州迈景基因医学科技有限公司 | Multiplex PCR primer group, kit and method for detecting HPV based on high-throughput sequencing |
| CN114480738A (en) * | 2022-02-16 | 2022-05-13 | 赵俊 | High-risk human papilloma virus detection kit and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105755169A (en) * | 2014-12-19 | 2016-07-13 | 上海透景生命科技股份有限公司 | Reagent kit for detecting and typing high-risk type human papilloma viruses and application of reagent kit |
| CN107828919A (en) * | 2017-12-18 | 2018-03-23 | 苏州国科闻普生物科技有限公司 | The kit of multiple high-risk HPVs is detected suitable for the single tube of four fluorescence channels |
| CN107828920A (en) * | 2017-12-18 | 2018-03-23 | 苏州国科闻普生物科技有限公司 | A variety of high-risk human mammilla papillomavirus are realized with the kit of parting |
-
2018
- 2018-06-12 CN CN201810600850.3A patent/CN108728578A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105755169A (en) * | 2014-12-19 | 2016-07-13 | 上海透景生命科技股份有限公司 | Reagent kit for detecting and typing high-risk type human papilloma viruses and application of reagent kit |
| CN107828919A (en) * | 2017-12-18 | 2018-03-23 | 苏州国科闻普生物科技有限公司 | The kit of multiple high-risk HPVs is detected suitable for the single tube of four fluorescence channels |
| CN107828920A (en) * | 2017-12-18 | 2018-03-23 | 苏州国科闻普生物科技有限公司 | A variety of high-risk human mammilla papillomavirus are realized with the kit of parting |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110607399A (en) * | 2019-09-20 | 2019-12-24 | 西人马（厦门）科技有限公司 | Primer combination, kit and method for LAMP amplification to detect HPV and typing |
| CN111020061A (en) * | 2019-12-31 | 2020-04-17 | 广州迈景基因医学科技有限公司 | Multiplex PCR primer group, kit and method for detecting HPV based on high-throughput sequencing |
| CN114480738A (en) * | 2022-02-16 | 2022-05-13 | 赵俊 | High-risk human papilloma virus detection kit and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102994651B (en) | Primer, probe and kit for fluorescence PCR (Polymerase Chain Reaction) detection of 18 high-risk human papilloma viruses | |
| CN101435002B (en) | Method for detecting human papilloma virogene type | |
| CN105603121B (en) | For detecting method, oligonucleotides and the kit of high-risk HPV | |
| CN105087827B (en) | Detection primer, probe and the kit of 16 kinds of type HPV viruses | |
| Natphopsuk et al. | Human papillomavirus genotypes and cervical cancer in northeast Thailand | |
| CN101017141A (en) | Polymerase chain reaction (PCR) method for diagnosing human papillomavirus (HPV) and reagent kit thereof | |
| Nadji et al. | Relationship between lung cancer and human papillomavirus in north of Iran, Mazandaran province | |
| CN101781686A (en) | Fluorescent PCR (Polymerase Chain Reaction) kit for quantitively detecting HPV16/18 type infection | |
| CN108728578A (en) | Detect the method and kit of a variety of high-risk human mammilla papillomavirus and its hypotype simultaneously in single tube reaction | |
| CN104560962B (en) | Fluorescent PCR kit and its primer special group for detecting HPV | |
| CN108179226B (en) | Nucleic acid composition for detecting human papilloma virus, application thereof and kit | |
| CN102140554B (en) | Fluorescent PCR kit for detecting human papilloma virus subtypes | |
| Anis et al. | Molecular characterization of the L1 gene of papillomaviruses in epithelial lesions of cats and comparative analysis with corresponding gene sequences of human and feline papillomaviruses | |
| US20150376725A1 (en) | HPV Detection in Urine | |
| CN103409560A (en) | Broad-spectrum, efficient and economical PCR (Polymerase Chain Reaction) detection method for high-risk human papilloma virus | |
| CN108085419B (en) | probe and primer composition | |
| US6902899B2 (en) | Detection of human papillomaviruses | |
| CN107828919A (en) | The kit of multiple high-risk HPVs is detected suitable for the single tube of four fluorescence channels | |
| CN107828920B (en) | Kit for realizing typing of multiple high-risk human papilloma viruses | |
| KR20160014430A (en) | HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof | |
| CN113584225A (en) | Primer and probe combination for detecting HPV (human papillomavirus), reagent for typing detection of HPV and application of HPV primer and probe combination | |
| CN111172328A (en) | Complete set of primers, complete set of probes, kit and method for HPV nucleic acid typing detection | |
| Ye et al. | High prevalence of HPV59 in cytologically abnormal cervical samples | |
| CN107988432A (en) | Detect the kit of multiple high-risk human mammilla papillomavirus at the same time in single tube reaction | |
| Ardhaoui et al. | Distribution of high-risk human papillomavirus in women with ASC-US or LSIL in Tunisian women: Place of HPV testing for women triage in Tunisia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181102 |
|
| RJ01 | Rejection of invention patent application after publication |