CN115948537A

CN115948537A - Application of gene CHST3 composite heterozygous mutation, detection reagent and application

Info

Publication number: CN115948537A
Application number: CN202211629032.9A
Authority: CN
Inventors: 曾桥; 安灿荣; 彭谦; 刘亚宁
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2022-12-19
Filing date: 2022-12-19
Publication date: 2023-04-11
Anticipated expiration: 2042-12-19
Also published as: CN115948537B

Abstract

The invention provides an application of gene CHST3 complex heterozygous mutation, a detection reagent and an application, belonging to the technical field of medical diagnosis. The present inventors have found for the first time that complex hybrid mutations at the sites CHST3: NM _004273.5 exon 3. The reagent for detecting the gene mutation site is used for genetic diagnosis and bearing-for-good-birth instruction of congenital spondyloepiphyseal hypoplasia, provides a new basis and way for the pathogenesis research of congenital spondyloepiphyseal hypoplasia, and can provide a possible drug target for treating congenital spondyloepiphyseal hypoplasia.

Description

Application of gene CHST3 composite heterozygous mutation, detection reagent and application

Technical Field

The invention belongs to the technical field of medical diagnosis, and particularly relates to application of gene CHST3 composite heterozygous mutation, a detection reagent and application.

Background

Spondyloepiphyseal dysplasia (spondiloepiphyseal dyslasia SED) is an inherited bone disease that affects the spine epiphyseal and metaphyseal cartilage. The genetic modes comprise autosomal dominant inheritance, autosomal recessive inheritance and X chromosome linked recessive inheritance. The common characteristics of the disease are that vertebral bodies and epiphyses are involved, and patients mainly show that after birth, the growth and development are slow, the short trunk has short stature and limp walking. The X-ray shows lateral curvature of thoracolumbar vertebra, irregular vertebral body, osteoporosis, broken and cracked head of femur, high density of acetabulum, etc. According to the classification criteria of hereditary osteopathy (2010), SED can be classified into nine clinical types according to clinical features, image characteristics and different manifestations of molecular genetics: 1) Congenital spondylodysplasia collectisias (SEDC); 2) Delayed spinal bone 16 dysplasia (SEDT); 3) Delayed spinal bone augmentation with progressive osteoarthropathy (SEDT-PA); 4) Omani type SED (spondyloepiphyseal dyssplasia Omani type, SED-OT); 5) Kimberley type SED (spondyloepiphyseal dyssplasia Kimberley type, SEDK); 6) (ii) a Wolcott-Rallison type SED (spondyloepiphyseal dysplassa Wolcott-Rallison type, SED-WR); 7) Mild SED with prematurity set arthritis (cold SED with prematurity arthritis); 8) SED with bone shortening (SED with meta short); (9) Autosomal recessive Late-onset SED (Late onset type). To date, there are 8 SED-related disease-causing genes recorded in the human genome mutation database (HGMD Professional 2012.3), including COL2A1, TRAPPC2 (SEDL), WISP3, CHST3, ACAN (AGCl), EIF2AK3, MATN3 and PAPSS2. The congenital spondyloepiphyseal hypoplasia (MIM 143095) is caused by CHST3 gene mutation, and the disease is an autosomal recessive genetic disease.

The CHST3 gene (MIM 603799) is positioned on chromosome 10q22.1 and comprises 3 exons and 2 introns, the gene is 48.2kb in length and has an open reading frame of 1440bp, and the protein carbohydrate sulfotransferase 3 (CHST 3) encodes 479 amino acid sequences, the CHST3 is a key enzyme for catalyzing sulfation of chondroitin sulfate, catalyzes sulfation of the 6 th carbon atom of a GalNAc residue to introduce negative charge after sulfation reaction, the water absorption performance of the negative charge-dependent chondroitin sulfate endows proteoglycan with water retention capacity, and sufficient water content of intervertebral discs is a necessary condition for maintaining normal osmotic pressure and tissue elasticity, so the CHST3 is an important protective gene in the intervertebral discs, and the activity of the CHST3 plays an important role in maintaining the structure and the function of the intervertebral discs. Abnormal enzyme activity caused by CHST3 gene mutation in human bodies can cause abnormal recessive genetic diseases of bones, such as spondyloepiphyseal dysplasia and the like.

Gene mutation is an important genetic basis for the development of congenital spondyloepiphyseal hypoplasia, and gene diagnosis is the gold standard for determining congenital spondyloepiphyseal hypoplasia. Corresponding detection techniques need to be established aiming at different mutations clinically and are used for determining causes of diseases and disease diagnosis, and other methods such as restriction fragment length polymorphism, single-strand conformation polymorphism, allele-specific oligonucleotide hybridization and the like can be adopted for detecting the genotype of a gene mutation site in the prior art, but the detection methods cannot simultaneously fulfill the aims of determining the sequence of a mutant gene in a qualitative, quantitative and definite manner.

Disclosure of Invention

In view of the above, the present invention aims to provide an application of a composite heterozygous mutation of a pathogenic gene CHST3 causing congenital spondyloepiphyseal hypoplasia, and develop a novel composite heterozygous mutation of a pathogenic gene which can be used as a biomarker for diagnosing congenital spondyloepiphyseal hypoplasia to distinguish patients, carriers and normal people with congenital spondyloepiphyseal hypoplasia.

The invention also aims to provide a reagent for detecting the composite heterozygous mutation of the pathogenic gene CHST3 causing congenital spondyloepiphyseal hypoplasia and an application thereof, and the reagent can help to screen and diagnose the congenital spondyloepiphyseal hypoplasia gene mutation.

The invention provides an application of a CHST3 composite hybrid mutation site in preparing a congenital spondyloepiphyseal hypoplasia diagnostic reagent or a medicine for preventing and treating congenital spondyloepiphyseal hypoplasia, wherein the CHST3 composite hybrid mutation site of a pathogenic gene is CHST3: NM _ 004273.5.

The invention provides a reagent for detecting a pathogenic gene CHST3 composite heterozygous mutation site of congenital spondyloepiphyseal hypoplasia, which comprises a primer for detecting a pathogenic gene CHST3 mutation site c.675C > A: p.S225R and a primer for detecting a pathogenic gene CHST3 mutation site c.1072_ 1089dupCAGCCCGCCTGGCCTGCGG p.Q358 vu R363dup, wherein the primers comprise the following components in parts by weight;

the primer for detecting the mutant site c.675C > A: p.S225R of the pathogenic gene CHST3 comprises CHST3-1F with the nucleotide sequence shown as SEQ ID NO.1 and CHST3-1R with the nucleotide sequence shown as SEQ ID NO. 2;

the primer for detecting the mutation site c.1072-1089dupCAGCCCGCCTGGCTGGCTGG p.Q358. R363dup of the pathogenic gene CHST3 comprises CHST3-2F with a nucleotide sequence shown as SEQ ID NO. 3 and CHST3-2R with a nucleotide sequence shown as SEQ ID NO. 4.

Preferably, a sequencing primer is also included;

the sequencing primer comprises a sequencing primer of a pathogenic gene CHST3 mutation site c.675C > A: p.S225R and/or a sequencing primer of a pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGCCTGGCTGGCTGG;

the sequencing primer of the pathogenic gene CHST3 mutation site c.675C > A: p.S225R comprises CHST3-SEQ1F with the nucleotide sequence shown as SEQ ID NO. 5 and CHST3-SEQ1R with the nucleotide sequence shown as SEQ ID NO. 6;

the sequencing primer of the pathogenic gene CHST3 mutation site c.1072_ 1089dupCAGCCCGCCTGGCTGGCTGG p.Q358 [ u R363dup comprises CHST3-SEQ2F with a nucleotide sequence shown as SEQ ID NO. 7 and CHST3-SEQ2R with a nucleotide sequence shown as SEQ ID NO. 8.

The invention provides a congenital spondyloepiphyseal hypoplasia diagnostic kit, which comprises the reagent and a PCR amplification reagent.

Preferably, the PCR amplification reagent comprises dNTP, 10 XPCR buffer, magnesium ions and Tap polymerase;

the 10 × PCR buffer comprises an aqueous solution of: 500mmol/LKCl, 100mmol/L Tris-Cl at pH 8.3 and 15mmol/LMgCl ₂ 。

The invention provides application of the reagent in preparing a kit for detecting a mutant site of a pathogenic gene CHST3 of congenital spondyloepiphyseal hypoplasia.

The invention provides application of a primer for detecting a composite heterozygous mutant site of a pathogenic gene CHST3 in preparing a kit for assisting in diagnosing congenital spondyloepiphyseal dysplasia, wherein the composite heterozygous mutant site of the pathogenic gene CHST3 is as follows, the sequence is CHST3: NM _004273.5 exon 3.

Preferably, the primer is the reagent described in the above scheme.

Preferably, the method for auxiliary diagnosis of congenital spondyloepiphyseal hypoplasia comprises the following steps: the kit is used for detecting the genotype of the gene mutation site in the sample to diagnose whether the individual is at risk of congenital spondyloepiphyseal hypoplasia:

when the detected genotype is a' c.675C > A: p.S225R heterozygote + c.1072_1089 dupCAGCCCGCCTGGCTGGCTGGG;

if the genotype tested is a single heterozygous mutation "c.675c > a: p.s225r heterozygous mutation" or "c.1072_ 1089dupcagcccgcctggctgcggggg p.q358 [ u r363dup heterozygous mutation", then the individual is a carrier;

if the mutation site is detected to have no mutation, the CHST3 gene is judged to be a wild type, and the individual is a normal person.

Preferably, the sample is at least one of blood, amniotic fluid and biopsy tissue.

The invention discovers for the first time that CHST3: NM-004273.5. In one aspect, the genetic diagnosis for screening or diagnosing congenital spondyloepiphyseal dysplasia is used to guide treatment by detecting whether a subject carries the above mutations. In particular, the diagnostic kit provided by the invention can be used for quickly and effectively predicting or diagnosing congenital spondyloepiphyseal dysplasia. On the other hand, the invention lays an important foundation for the research of pathogenesis of congenital epiphyseal hypoplasia and provides a brand new theoretical basis for the treatment of patients with congenital epiphyseal hypoplasia. In a third aspect, the invention can provide a possible drug target for treating congenital spondyloepiphyseal hypoplasia.

The invention also provides a kit for detecting the mutation site of the pathogenic gene CHST3 of congenital spondyloepiphyseal hypoplasia, which comprises the reagent and a PCR amplification reagent. By optimizing a primer and a reaction system for detecting a mutation site of a pathogenic gene CHST3, the accuracy and reliability of a detection result are greatly improved, the screening and diagnosis of congenital spondyloepiphyseal dysplasia gene mutation are greatly assisted, and a new technical support is provided for drug screening, drug efficacy evaluation and targeted therapy of the congenital spondyloepiphyseal dysplasia gene mutation.

Drawings

FIG. 1 shows a family genetic map of congenital spondyloepiphyseal dysplasia No. 1; wherein, the first and the second end of the pipe are connected with each other,

indicates a male carrier to be present>

Representing female carriers,. Diamond-solid representing the diseased fetus, ↗ representing probands.

Fig. 2 shows a graph of results of using Sanger sequencing to detect the genotype of CHST3: NM — 004273.5.

FIG. 3 shows a plot of the results of using Sanger sequencing to detect CHST3: NM-004273.5.

FIG. 4 shows a family genetic map of congenital spondyloepiphyseal dysplasia No. 2; wherein the content of the first and second substances,

indicates a male carrier to be present>

Representing a female carrier, ● a female patient, ↗ a proband. />

Fig. 5 shows a graph of the results of using the kit to detect the genotype of the ancestral CHST3: NM — 004273.5.

FIG. 6 shows a graph of the results of using the kit to detect the genotype of the loci of family 2, CHST3: NM-004273.5.

Detailed Description

In the invention, exon sequencing is firstly utilized to screen pathogenic gene mutation highly related to congenital spondyloepiphyseal hypoplasia, in order to avoid the occurrence of false positive results, and then Sanger sequencing is used for verification, so as to finally obtain the pathogenic gene complex hybrid mutation of congenital spondyloepiphyseal hypoplasia, specifically CHST3: NM _ 004273.5. The complex heterozygous mutation of the pathogenic gene can be used as a biomarker for diagnosing congenital spondyloepiphyseal hypoplasia, and can be used for distinguishing patients with congenital spondyloepiphyseal hypoplasia from normal people. Wherein the CHST3: NM-004273.5: 9 (CTCCAGACGCTCC). Compared with the protein encoded by the wild-type CHST3 gene, the CHST3 mutant protein has the advantages that the 225 th amino acid is mutated from serine (S) to arginine (R), and missense mutation occurs, namely the CHST3 mutant protein contains p.S225R mutation, and the mutation is caused by missense mutation of c.675C > A; the amino acid sequence of the CHST3 mutant protein is shown as SEQ ID NO:10 (RGSRRSL).

The c.1072_1089 dupCAGCCCGCCTGGCTGGCTGCGG mutation refers to 18 base repeats (CAGCCCGCCTGGCTGCGG, SEQ ID NO: 11) at the 1072 th to 1089 th positions of the No. 3 exon of a wild-type CHST3 gene to form a CHST3 gene mutant, and the nucleotide sequence of the CHST3 gene mutant is preferably shown as SEQ ID NO:12 (CAGCCCGCCTGGCTGCGGCAGCCCGCCTGGCTGCGG). Compared with the protein coded by the wild-type CHST3 gene, the CHST3 mutant protein has 6 amino acid (QPAWLR, SEQ ID NO: 13) repeats from 358 th to 363 th, namely the CHST3 mutant protein contains a mutation of p.Q358_ R363dup, and the mutation is caused by the repeated mutation of c.1072_1089 dupCAGCCCGCCTGGCTGGCGG; the amino acid sequence of the CHST3 mutant protein is shown in SEQ ID NO.14 (QPAWLRQPAWLR).

In the invention, specific amplification primers or specific detection probes are designed according to the upstream and downstream sequences of two mutation sites of CHST3 to prepare a diagnostic reagent.

The invention provides a reagent for detecting a pathogenic gene CHST3 composite heterozygous mutant site of congenital spondyloepiphyseal hypoplasia, which comprises a primer for detecting a pathogenic gene CHST3 mutant site c.675C > A: p.S225R and a primer for detecting a pathogenic gene CHST3 mutant site c.1072_ 1089dupCAGCCCGCTGGCTGCGG; the primer for detecting the mutation site c.675C > A: p.S225R of the pathogenic gene CHST3 comprises CHST3-1F with the nucleotide sequence shown as SEQ ID NO:1 (GATTCAGCCTTCTCCCA) and CHST3-1R with the nucleotide sequence shown as SEQ ID NO:2 (CCAGCCACTTCTTCCAG); the primer for detecting the mutation site c.1072_1089 dupCAGCCCGCCTGGCTGGCTGG p.Q358 [ u ] R363dup of the pathogenic gene CHST3 comprises CHST3-2F with the nucleotide sequence shown as SEQ ID NO. 3 (GGCAACATCTTCTACCTCT) and CHST3-2R with the nucleotide sequence shown as SEQ ID NO. 4 (CCAGTTTGTAGCCGAAG).

In the present invention, the reagent preferably further comprises a sequencing primer. The sequencing primer comprises a sequencing primer of a pathogenic gene CHST3 mutation site c.675C > A: p.S225R and/or a sequencing primer of a pathogenic gene CHST3 mutation site c.1072_1089 dupCAGCCCGCCTGGCTGGCTGG. The sequencing primer of the pathogenic gene CHST3 mutation site c.675C > A: p.S225R comprises CHST3-SEQ1F with the nucleotide sequence shown as SEQ ID NO:5 (GCAGGGCAACATCTTCTA) and CHST3-SEQ1R with the nucleotide sequence shown as SEQ ID NO:6 (CCACTTCTTCCAGGTCTTAT); the sequencing primer of the pathogenic gene CHST3 mutation site c.1072_ 1089dupCAGCCCGCCTGGCTGCGG. The source of the primer is not particularly limited in the present invention, and a primer synthesis method known in the art may be used.

In the present invention, the PCR amplification reagent preferably includes dNTP, 10 XPCR buffer, magnesium ions and Tap polymerase. The 10 × PCR buffer comprises an aqueous solution of: 500mmol/L KCl, 100mmol/L Tris-Cl at pH 8.3 and 15mmol/L MgCl ₂ 。

In the present invention, the method for detecting the mutant site of CHST3, a causative gene of congenital spondyloepiphyseal hypoplasia, preferably comprises the following steps:

extracting genome DNA of a sample to be detected;

using genome DNA as a template, and using the reagent in the scheme to amplify the CHST3 gene sequence;

DNA sequencing is carried out on an amplification product of the CHST3 gene;

comparing the DNA sequencing result of a sample to be detected with the DNA sequence of a normal human genome, wherein when the results are completely consistent, the CHST3 gene in the sample to be detected is not mutated into a wild type, when the comparison result shows that the 675 base of the No. 3 exon in one allele in a chromosome has the CHST3 gene (NM _ 004273.5) is mutated from C to A, the genotype of the mutation site is ' c.675C > A: p.S225R heterozygous mutation ', and when the No. 3 exon on the chromosome has 18 bases (CAGCCCGCCTGGCTGCGG) repetition in total from 1072 to 1089, the other allele is not mutated, and the genotype of the mutation site is ' c.1072_1089 dupCAGCCCCCTGGCTGCGGCTGGGCGGG p.

In the present invention, the reaction system for amplifying the CHST3 gene sequence is preferably 10 XPCR buffer solution 2.0. Mu.L, 10mmol/LdNTPs 0.4. Mu.L, 100 ng/. Mu.L of LCHST3-1F (or CHST 3-2F) 0.5. Mu.L, 100 ng/. Mu.L of LCHST3-1R (or CHST 3-2R) 0.5. Mu.L, 100 ng/. Mu.L of extracted DNA 1.0. Mu.L, 5U/. Mu.L of LTaq enzyme 0.2. Mu. L, ddH ₂ O15.4. Mu.L. For CHST3 NM — 004273.5>The PCR amplification reaction program of the p.S225R mutation site is preferably as follows: the first step is as follows: 5 minutes at 95 ℃; the second step is that: 30 cycles (95 ℃,30 seconds → 50 ℃,30 seconds → 72 ℃,60 seconds); the third step: 7 minutes at 72 ℃; the fourth step: keeping the temperature at 4 ℃. For CHST3: NM-004273.5. Exon 3. C.1072. U.1089dupCAGCCCGCCTGGCTGCGG: the first step is as follows: 5 minutes at 95 ℃; the second step is that: 30 cycles (95 ℃,30 seconds → 48 ℃,30 seconds → 72 ℃,60 seconds); the third step: 7 minutes at 72 ℃; the fourth step: keeping the temperature at 4 ℃.

The invention provides an application of a primer for detecting a composite heterozygous mutant site of a pathogenic gene CHST3 in preparing a kit for assisting in diagnosing congenital spondyloepiphyseal hypoplasia, wherein the composite heterozygous mutant site of the pathogenic gene CHST3 is CHST3: NM _004273.5

1089dupCAGCCCGCCTGGCTGCGG:p.Q358_R363dup。

In the invention, specific primers are designed based on the upstream and downstream sequences of the mutation site of the pathogenic gene CHST3, the primers are adopted to amplify a DNA fragment containing the mutation site, and the genotype of the DNA fragment is used for judging whether the risk of congenital spondyloepiphyseal hypoplasia exists. In the present embodiment, the primer is preferably the reagent described in the above embodiment.

In the present invention, the method for auxiliary diagnosis of congenital spondyloepiphyseal hypoplasia preferably comprises the following steps: and (3) detecting the genotype of the gene mutation site in the sample by using the kit to diagnose whether the individual has the risk of congenital spondyloepiphyseal hypoplasia: when the detected genotype is a' c.675C > A: p.S225R heterozygote + c.1072_1089 dupCAGCCCGCCTGGCTGGCTGGG; if the genotype tested is a single heterozygous mutation "c.675c > a: p.s225r heterozygous mutation" or "c.1072_ 1089dupcagcccgcctggctgcggggg p.q358 [ u r363dup heterozygous mutation", then the individual is a carrier; if the mutation site is detected to have no mutation, the CHST3 gene is judged to be a wild type, and the individual is a normal person.

In the present invention, the sample is preferably at least one of blood, amniotic fluid and biopsy tissue.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, the molecular genetics, nucleic acid chemistry and molecular biology-related terms and laboratory procedures used herein are all terms and routine procedures used extensively in the relevant art. Meanwhile, in order to better understand the present invention, the definitions and explanations of related terms are provided below.

The term "diagnosis" as used herein includes the prediction of risk of a disease, the diagnosis of the onset or absence of a disease, and the assessment of prognosis of a disease.

The term "mutation" as used herein refers to a change in the sequence of a wild-type polynucleotide to a variant, which may or may not be naturally occurring.

In the present invention, the term "heterozygous mutation" means that the mutation is present in only one gene of a pair of alleles.

In the present invention, the term "compound heterozygous mutation" means a heterozygous mutation wherein 1 or more alleles are present, that is, a biallelic mutation, and each chromosome is mutated.

The term "prenatal diagnosis" refers to the definite diagnosis of high-risk fetus based on genetic counseling, mainly through genetic detection and imaging examination, and the purpose of fetus selection is achieved through selective abortion of the affected fetus, so that the birth defect rate is reduced, and the birth quality and population quality are improved.

In the present invention, "primer" refers to a polynucleotide fragment, typically an oligonucleotide, for amplifying a target nucleic acid in a PCR reaction, e.g., a polynucleotide fragment containing at least 5 bases, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases. The primer does not have to be completely complementary to the gene of interest to be amplified or its complementary strand, as long as it can specifically amplify the gene of interest. As used herein in the context of the present invention,

the term "specifically amplify" means that the primers are capable of amplifying the gene of interest by PCR reaction without amplifying other genes. For example, specifically amplifying the CHST3 gene means that only the CHST3 gene is amplified by primers in a PCR reaction, and other genes are not amplified.

The application, detection reagent and application of the complex heterozygous mutation of the pathogenic gene CHST3 causing congenital spondyloepiphyseal hypoplasia provided by the invention are explained in detail with the following examples, but they should not be construed as limiting the scope of the invention.

The experimental procedures for the specific conditions not noted in the following examples are generally performed according to conventional conditions such as those described in Sambrook et al, molecular cloning laboratories handbook (Molecular cloning: alarotoryanual 1SECOND EDITION, new York.

Example 1

Sample acquisition

The inventor found 1 congenital spondyloepiphyseal hypoplasia family (called family 1 for short), and the clinical information of the family members is shown in Table 1. FIG. 1 is a family map, which shows male carriers,

1. Diagnostic criteria:

reference may be made to "human monogenic genetic diseases" 2010 edition.

Mutations in the CHST3 gene can lead to spondyloepiphyseal dysplasia with congenital dislocation with autosomal recessive inheritance. Clinically, it is mainly manifested as short stature, chest deformity and joint degeneration. Image features include vertebral flattening, epiphyseal dysplasia, and articular cartilage destruction.

The method specifically comprises the following steps: <xnotran> , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , (), , , , . </xnotran>

TABLE 1 clinical information on family members of congenital spondyloepiphyseal dysplasia No.1 and No. 2

As shown in FIG. 1, I (first generation) and II (second generation) are used as the numbering.

The peripheral blood DNA of family 1, I1 (proband father), I2 (proband present) and II 1 (proband) was used for sequencing.

Example 2

Exon sequencing

1. The instrumentation is shown in table 2.

Table 2 Instrument and Equipment List

2. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96-well plate (Axygen), different model tips (Axygen), 200 μ L centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye terminator v3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB stain (amereco).

3. Reagent formulation

A stock solution of 5 XTBE electrophoresis solution was prepared as shown in Table 3.

TABLE 3 formulation of 5 XTBE electrophoretic solutions

Reagent	Tris	Boric acid	EDTA(pH8.0，0.5mol/L)	ddH ₂ O
					Volume/weight	5.4g	750mg	2mL	90mL

By ddH ₂ O adjusted the final volume to 100mL.

Working solution of 0.5 XTBE electrophoresis solution, ddH ₂ Diluting with O10 times.

10 × erythrocyte lysates were prepared according to table 4.

TABLE 4 erythrocyte lysate recipe

Reagent	NH ₄ Cl	KHCO ₃	EDTA	Add ddH ₂ O
					Volume/weight	82.9g	10g	0.37g	To 1000mL

Autoclaving, and storing at 4 deg.C.

1 × cell nucleus lysate was prepared as in Table 5.

TABLE 5 cell nucleus lysate recipe

/>

4. Experimental procedure

After signing the informed consent, 3-5mL of peripheral blood of I1 (proband father), I2 (proband mother) and 5-10 mL of amniotic fluid of II 1 (proband) in the family No.1 were collected.

4.1 sample DNA extraction

1) 3-5mL of the sample is put into a 15mL centrifuge tube, 1 Xerythrocyte lysate with the volume of 2-3 times of that of the sample is added, the mixture is uniformly mixed, and the mixture is kept stand on ice for 30 minutes until the solution becomes transparent.

2) Centrifuge at 3000 rpm for 10 minutes at 4 ℃ and carefully remove the supernatant. The pellet was mixed with 1mL of 1 Xcell nucleus lysate, followed by addition of 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS, and the mixture was shaken until it became viscous and transparent. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion was carried out at 37 ℃ for more than 6 hours or overnight.

3) Adding equal volume of saturated phenol, shaking gently, mixing, and centrifuging at 3000 rpm for 10 minutes at room temperature.

4) The supernatant was carefully transferred to another centrifuge tube, mixed with an equal volume of phenol/chloroform (1 v/v), and centrifuged at 3000 rpm for 10 minutes at room temperature.

5) The supernatant was carefully removed and, if it was not clear, extracted once more with an equal volume of chloroform.

6) The supernatant was transferred to another centrifuge tube, and two times the volume of absolute ethanol was added thereto, followed by shaking to obtain white flocculent DNA. The DNA was hooked out using a flame-sterilized glass hook needle, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. Measuring the OD value by ultraviolet.

7) TE-solubilized DNA can be stored at 4 ℃ for one year, and if long-term storage is required, 2 times the volume of absolute ethanol is added and the DNA is stored at-70 ℃.

4.2 exon sequencing

Reference is made to the human whole exon sequencing kit (Agilent) instructions and the Molecular cloning laboratory Manual (third edition; molecular cloning ALABORATORYMANUAL 1SECOND EDITION, new York.

1) Taking 2 mu g of DNA, mechanically breaking the DNA to ensure that the size of the fragment is about 200bp, cutting the gel and recovering a 150-250bp fragment;

2) Carrying out end repair on the DNA fragment and adding A at the 3' end;

3) Connecting a sequencing joint, purifying a connecting product, performing PCR amplification, and purifying an amplification product;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing quality control analysis by agarose gel electrophoresis on a small sample;

5) NextSeq500 sequencer and data analysis.

4.3 results

Finally, 1 gene complex hybrid mutation CHST3 with pathogenic significance, NM-004273.5; wherein c.675C > A is mutated into 675 th base C to A, missense mutation is caused, and 225 th amino acid is mutated from serine (S) to arginine (R); c.1072_1089 dupCAGCCCGCCTGGCTGGCGG mutation is a repeat of bases CAGCCCGCCTGGCTGCGG at positions 1072 to 1089, resulting in a repeat mutation, and 6 amino acids 358 to 363 (QPAWLR) repeat mutation. The genotype at the site of p.q358\ r.3dupcagcccgcctggctgcgg is a "c.675c > a + c.1072_1089 dupcagcccgcctgcggctgcgg" composite heterozygous mutation in family 1 patient (proband) CHST3: NM — 004273.5; the genotype of the carrier in family No.1 at the site is the "c.675C > A" heterozygous mutation or the "c.1072-1089 dup CAGCCCGCCTGGCTGCGG" heterozygous mutation.

Example 3

Sanger sequencing validation

The sites of CHST3: NM — 004273.5 a. The gene type detection of the CHST3: NM _ 004273.5.

The method comprises the following specific steps:

1. DNA extraction

Genomic DNA was extracted according to the method of example 1.

2. Candidate primer design, validation and optimization

2.1 candidate primer design reference human genome sequence database hg 19/built 36.3

(https:// www.ncbi.nlm.nih.gov/genome, or

http://genome.ucsc.edu/cgi-bin/hgGatewayredirect＝manual&source＝genome.ucsc.edu)。

2.2 design 16 pairs and 15 pairs of candidate primers (see Table 6) for mutation sites c.675C > A and c.1072_1089 dupCAGCCCGCCTGGCTGGCTGCGG, respectively, and verify and evaluate the quality of each pair of candidate primers by using PCR experiments.

TABLE 6 summary of the basic conditions and the results of the verification experiment for each pair of candidate primers

/>

/>

Note: only one specific band exists after electrophoresis of a normal PCR amplification result, and if a primer dimer band and a non-specific product band appear, the primer dimer band and the non-specific product band are both the results of primer abnormal reaction; the target primer avoids this as much as possible. The optimal primer pair is further evaluated and selected comprehensively with reference to the following principles:

(1) the length of the primer is 15-30nt, and is usually about 20 nt;

(2) the content of G + C is preferably 40-60%, the amplification effect is poor when the content of G + C is too small, and a non-specific band is easy to appear when the content of G + C is too large. ATGC is preferably randomly distributed;

(3) avoid a tandem reference of more than 5 purine or pyrimidine nucleotides;

(4) no complementary sequence should appear inside the primer;

(5) complementary sequences should not exist between the two primers, especially to avoid complementary overlapping at the 3' end;

(6) the homology of the primer with the sequence of the non-specific amplification region does not exceed 70 percent, and the continuous 8 bases at the tail end of the primer 3' can not have a complete complementary sequence outside the region to be amplified, otherwise, the non-specific amplification is easily caused;

2.3 candidate primer PCR validation reactions

Performing PCR according to the reaction system in Table 7 and keeping the reaction system on ice; 8 reaction test tubes (Nos. 1 to 8 in Table 7) were provided for each pair of primers.

TABLE 7 primer detection PCR reaction System

/>

Reaction conditions are as follows: placing the test reaction tube into a PCR instrument, and executing the following reaction procedures:

the first step is as follows: 5 minutes at 95 ℃;

the second step is that: 30 cycles (95 ℃,30 seconds → Tm,30 seconds → 72 ℃,60 seconds); (the PCR amplification parameters were set according to the Tm values of the primers in Table 6, and the Tm average value was taken for the double primers).

The third step: 72 ℃ for 7 minutes;

the fourth step: 4 ℃ until sampling.

2.4 agarose gel electrophoresis detection of the candidate primer PCR results to assess the effectiveness, specificity of the primer reaction:

1) The two ends of the cleaned and dried gel sample applicator are sealed by an adhesive tape, the gel sample applicator is placed on a horizontal table, and a comb is placed at a position of about 1cm of one end of the sample applicator.

2) Weighing 2g agar powder in a conical flask, adding 100mL 0.5 XTBE electrophoresis buffer, shaking, heating in microwave oven or electric furnace (adding asbestos gauze), boiling, taking out, shaking, heating until the gel is completely melted, taking out, and cooling at room temperature.

3) And when the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sample injector to ensure that the thickness is about 5 mm.

4) The gel is solidified, the adhesive tape is removed, and the gel and the sample injector are placed into an electrophoresis tank.

5) Adding electrophoresis buffer solution to make the liquid level 1-2mm higher than the glue surface, and pulling out the comb upwards; and (3) respectively and uniformly mixing the sample and the DNA size standard substance with the sample carrying liquid by using a micropipette, and adding the mixture into each sample adding hole, wherein the DNA sinks into the bottom of the hole due to the large specific gravity of the sucrose in the sample carrying liquid.

6) Covering the electrophoresis tank, switching on the power supply, adjusting to proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrier liquid, and determining whether to terminate the electrophoresis.

7) The power was turned off, the gel was taken out and stained in 0.5g/mL EB aqueous solution for 10-15 minutes.

8) The gel was placed under a transmission ultraviolet irradiator for observation at a wavelength of 254nm, and the results of electrophoresis were photographed with a camera with a red filter or recorded with a gel scanning system.

2.5 evaluation of results:

1) If the No. 7 tube only has a bright and clear target band and no other band, the pair of primers and the reaction system are judged to have good effectiveness and strong specificity;

2) If no target band appears in the No. 7 tube, judging that the pair of primers and the reaction system are invalid;

3) If the primer-primer dimer band outside the target entry appears in the No. 7 tube and the primer-dimer band also appears in the No. 2, 3, 4, 5 and 6 tubes, the effectiveness of the pair of primers and the reaction system is judged to be poor;

4) If the non-specific band outside the target band appears in the No. 7 tube and the non-specific band also appears in the No. 5 and No. 6 tubes, the specificity of the pair of primers and the reaction system is judged to be poor;

5) If the primer dimer and the non-specific band appear outside the target band in the No. 7 tube, and the primer dimer and the non-specific band also appear in the No. 2, 3, 4, 5, and 6 tubes, the effectiveness and the specificity of the pair of primers and the reaction system are judged to be poor.

2.6 according to the statistical results after the verification test of Table 6, selecting the optimal pair (two site No.1 candidate primers in Table 6) as the primers for detecting the mutant families:

the PCR amplification primer sequences for CHST3: NM — 004273.5 a:

5’-GATTCAGCCTTCTCCCA-3’(SEQ ID NO:1)

5’-CCAGCCACTTCTTCCAG-3’(SEQ ID NO:2)

the PCR amplification primer sequences for the CHST3: NM — 004273.5, exon3 c.1072 [ 1089dupcagcccgcctggctgcgg:

5’-GGCAACATCTTCTACCTCT-3’(SEQ ID NO:3)

5’-CCAGTTTGTAGCCGAAG-3’(SEQ ID NO:4)

PCR was performed according to the reaction system in Table 8 while keeping the reaction system on ice.

TABLE 8 mutant site PCR reaction System

Reaction conditions are as follows: the reaction system was placed in a PCR instrument and the following reaction sequence was performed:

the PCR amplification procedure for CHST3: NM — 004273.5 a for p.s225r site was as follows:

the first step is as follows: 5 minutes at 95 ℃;

the second step is that: 30 cycles (95 ℃,30 seconds → 50 ℃,30 seconds → 72 ℃,60 seconds);

the third step: 7 minutes at 72 ℃;

the fourth step: 4 ℃ until sampling.

The PCR amplification program for the CHST3: NM — 004273.5, exon3 c.1072, 1089dupcagcccgcctggctgcgg:

the first step is as follows: 5 minutes at 95 ℃;

the second step is that: 30 cycles (95 ℃,30 seconds → 48 ℃,30 seconds → 72 ℃,60 seconds);

the third step: 72 ℃ for 7 minutes;

the fourth step: 4 ℃ until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. And (3) carrying out enzymolysis purification on the PCR product: mu.L of each of exonuclease I (Exo I) and alkaline phosphatase (AIP) was added to 5. Mu.L of the PCR product, and the mixture was digested at 37 ℃ for 15 minutes and inactivated at 85 ℃ for 15 minutes.

6. BigDye reaction

The BigDye reaction system is shown in table 9.

TABLE 9BigDye reaction System

Reagent	DNA after purification of PCR product	3.2 pmol/. Mu.L sequencing primer	BigDye	5 xBigDye sequencing buffer	ddH ₂ O
						Volume of	2.0μL	1.0μL	0.5μL	2.0μL	4.5μL

Sequencing PCR cycling conditions:

the first step is as follows: at 96 ℃ for 1 minute;

the second step is that: 33 cycles (96 ℃,30 sec → 55 ℃,15 sec → 60 ℃,4 min);

the third step: 4 ℃ until sampling.

7. Purification of BigDye reaction product:

1) mu.L of 125mM EDTA (pH 8.0) was added to the bottom of each tube, followed by 1. Mu.L of 3mol/L NaAc (pH 5.2);

2) Adding 70 mu L of 70% alcohol, shaking and mixing uniformly for 4 times, and standing for 15 minutes at room temperature;

3) 3000g, centrifuging at 4 ℃ for 30 minutes; immediately invert the 96-well plate and centrifuge at 185g for 1 min;

4) Standing at room temperature for 5 min, allowing the residual alcohol to evaporate at room temperature, adding 10 μ LHi-Di formamide to dissolve DNA, denaturing at 96 deg.C for 4 min, rapidly placing on ice for 4 min, and performing sequencing on the machine.

8. Sequencing

And carrying out DNA sequencing on the purified BigDye reaction product.

The sequencing primer is a nested primer (the second group of primers are designed in the range of the product sequence obtained by the amplification of the first group of primers) designed on the basis of the PCR optimal primer as a sequencing primer:

sequencing primer sequences for CHST3: NM — 004273.5 c > -a at p.s225r site were as follows:

5’-GCAGGGCAACATCTTCTA-3’(SEQ ID NO:5)；

5’-CCACTTCTTCCAGGTCTTAT-3’(SEQ ID NO:6)。

the sequencing primer sequences for the CHST3: NM-004273.5. Exon 3. C.1072. Sup.1089dupCAGCCCGCCTGGCTGCGG:

5’-TGAGGGAAGAGGAGGTG-3’(SEQ ID NO:7)；

5’-CTGCGTGTTCTTTTGGA-3’(SEQ ID NO:8)。

9. analysis of results

The Sanger sequencing results of figure 2 show that

family

2, 1, was CHST3: NM — 004273.5, exon 3. The positions indicated by arrows in the sequencing diagram of fig. 2 show that the genotype at the B and C layers CHST3: NM — 004273.5; the position indicated by the arrow in the sequencing diagram of FIG. 2 shows that the genotype of individuals in layer A is wild type.

The Sanger sequencing results of figure 3 show that the genotype at the p.q358 _. R363dup site of family 1, CHST3: NM-004273.5. The positions indicated by arrows in the sequencing map of FIG. 3 show that the individual CHST3: NM-004273.5; the positions indicated by arrows in the sequencing diagram of FIG. 3 indicate that the genotype of the individuals in layer B is wild-type.

By combining the detection results, the genotype of proband CHST3 is c.675C > A, c.1072_1089dupCAGCCCGCCTGGCTGCGG composite heterozygous mutation.

Example 5

Congenital spondyloepiphyseal dysplasia diagnostic kit and application

1. The kit comprises the following components:

1) An amplification primer: as shown in example 3

2) Buffer solution

3) Taq enzyme

4)dNTPs

5) The CHST3 comprises C.675C > A and c.1072_1089 dupCAGCCCGCCTGGCTGGCTGCGG positive mutation reference substance DNA, wherein the c.675C > A positive reference substance is a section of double-stranded DNA, and the specific sequence is shown as follows:

c.1072_1089 dupCAGCCCGCCTGGCTGGCTGGG positive reference substance is a section of double-stranded DNA, and the specific sequence is shown as follows:

wherein, the single underlined base is the position of the primer at the upstream and downstream of PCR amplification, the base in the square frame is the point mutation site, and the double underlined base is the position of the primer at the upstream and downstream sequencing.

6) Sequencing primer: as shown in example 3.

2. The using method comprises the following steps:

210 individuals of 56 phylogenetic abnormal families of the skeleton were screened and tested in total, and the following families were found again, and the kit was applied to the test of patients of family 2 (see table 10).

TABLE 10 clinical information on family members of congenital spondyloepiphyseal dysplasia No. 2

As shown in FIG. 4, I (first generation) and II (second generation) are used as the numbering.

The peripheral blood DNA of the family personnel No. 2I 1 (father), I2 (mother) and II 1 (proband) is used for kit detection.

1) Extracting genome DNA: and extracting the genomic DNA of the sample.

2) Firstly, the PCR amplification primer, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like are adopted for carrying out PCR amplification reaction, as in example 3;

3) Purifying PCR amplification products;

4) Carrying out BigDye reaction on the purified PCR product by adopting the sequencing primer;

5) Purifying the BiyDye reaction product;

6) The BiyDye reaction products were sequenced and the sequence compared to the normal sequence.

The kit test results in fig. 5 show that the genotype of the parental affinity proband No. 2, CHST3: NM — 004273.5. The positions indicated by the arrows in the sequencing diagram of fig. 5 show that the a and C layers CHST3: NM — 004273.5; the positions indicated by arrows in the sequencing diagram of FIG. 5 indicate that the genotype of the individuals in layer B is wild-type. The kit test results in FIG. 6 show that the germline parent affinity proband No. 2 CHST3: NM-004273.5. The positions indicated by arrows in the sequencing map of FIG. 6 show that the B and C layers CHST3: NM-004273.5; the positions indicated by arrows in the sequencing map of FIG. 6 show that the genotype of individuals in layer A is wild-type. The detection result confirms that the proband is a patient with congenital spondyloepiphyseal hypoplasia, and the parent and father are carriers of the mutant genes; the genetic counseling opinion is that the probability of the couple to rejuvenate the patient with congenital spondyloepiphyseal dysplasia is 1/4, the probability of the offspring of the fertility carrier is 1/2, the probability of the fertility to finish the normal individual is 1/4, and the couple is advised to plan to carry out the genetic diagnosis before embryo implantation and the prenatal diagnosis in the hospital after pregnancy.

From the results of the above examples, it can be seen that the present invention finds a novel CHST3 gene mutant, and confirms that the novel mutant is closely related to the onset of the congenital spondyloepiphyseal hypoplasia, and the pathogenic mutant can be used for molecular diagnosis of the congenital spondyloepiphyseal hypoplasia and differential diagnosis of related diseases.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Claims

1. The application of a CHST3 complex hybrid mutation site in preparing a diagnostic reagent for congenital spondyloepiphyseal hypoplasia or a medicine for preventing and treating congenital spondyloepiphyseal hypoplasia is disclosed, wherein the CHST3 complex hybrid mutation site is CHST3: NM _ 004273.5.

2. A reagent for detecting a pathogenic gene CHST3 composite heterozygous mutant site of congenital spondyloepiphyseal hypoplasia is characterized by comprising a primer for detecting a pathogenic gene CHST3 mutant site c.675C > A: p.S225R and a primer for detecting a pathogenic gene CHST3 mutant site c.1072_ 1089dupCAGCCCGCCTGGCTGCGG;

the primer for detecting the mutation site c.1072_1089dupCAGCCCGCCTGG CTGCGG p.Q358 _R363dupof the pathogenic gene CHST3 comprises CHST3-2F with a nucleotide sequence shown as SEQ ID NO. 3 and CHST3-2R with a nucleotide sequence shown as SEQ ID NO. 4.

3. The reagent of claim 2, further comprising a sequencing primer;

the sequencing primer of the pathogenic gene CHST3 mutation site c.1072_ 1089dupCAGCCCGCCTGGCTGGCCGG.p.Q358. R363dup comprises CHST3-SEQ2F with the nucleotide sequence shown as SEQ ID NO. 7 and CHST3-SEQ2R with the nucleotide sequence shown as SEQ ID NO. 8.

4. A diagnostic kit for spondyloepiphyseal achondroplasia, comprising the reagent of claim 2 or 3 and a PCR amplification reagent.

5. The kit of claim 4, wherein the PCR amplification reagents comprise dNTP, 10 XPCR buffer, magnesium ions and Tap polymerase;

the 10 × PCR buffer comprises an aqueous solution of: 500mmol/L KCl, 100mmol/L Tris-Cl at pH 8.3 and 15mmol/L MgCl ₂ 。

6. Use of the reagent according to claim 2 or 3 for the preparation of a kit for detecting the site of a mutation in the causative gene CHST3 of congenital spondyloepiphyseal hypoplasia.

7. The application of a primer for detecting a composite heterozygous mutant site of a pathogenic gene CHST3 in preparing a kit for assisting in diagnosing congenital spondyloepiphyseal hypoplasia is that the composite heterozygous mutant site of the pathogenic gene CHST3 is CHST3: NM-004273.5.

8. The use of claim 7, wherein the primer is the agent of claim 2 or 3.

9. The use according to claim 7, characterized in that said method for aiding the diagnosis of congenital spondyloepiphyseal hypoplasia comprises the following steps: the kit is used for detecting the genotype of the gene mutation site in the sample to diagnose whether the individual is at risk of congenital spondyloepiphyseal hypoplasia:

a male subject is a patient if the genotype detected is CHST3: NM — 004273.5 for c.675c > a, p.s225r and CHST3: NM — 004273.5 for exon 3; a female patient if the genotype of the locus in the female is "c.675c > a heterozygote mutation" or "c.1072_1089dupCAGCCCGCCTGGCT GCGG heterozygote mutation"; if the genotype of the locus is 'wild type', the individual is a normal person;

10. The use of any one of claims 7 to 9, wherein the sample is at least one of blood, amniotic fluid and biopsy tissue.