CN115948534A - Application of RIPK1 gene mutation form in diagnosis of autoinflammation with paroxysmal fever and lymphadenectasis - Google Patents

Abstract

The invention discloses application of RIPK1 gene mutation form in diagnosis of autoinflammation with paroxysmal fever and lymph node enlargement. The invention provides a mutant protein, which is obtained by mutating the 646 th amino acid residue of human RIPK1 protein from valine to glutamic acid. The invention also provides a mutant gene, which is obtained by mutating the RIPK1 gene; the RIPK1 gene is a gene which codes RIPK1 protein in a human genome; the mutation is to mutate the codon of the 646 th amino acid residue of the RIPK1 protein from the codon of the valine to the codon of the glutamic acid. The mutant protein or the mutant gene can be used as a target substance to develop a reagent or a kit for diagnosing autoinflammation with paroxysmal fever and lymphadenectasis, and a new direction is provided for clinical diagnosis and treatment of autoinflammation diseases.

Description

Application of RIPK1 gene mutation form in diagnosis of autoinflammation with paroxysmal fever and lymph node enlargement

Technical Field

The invention belongs to the field of molecular biomedicine, and relates to application of a RIPK1 gene mutation form in diagnosis of autoinflammation with paroxysmal fever and lymphadenectasis.

Background

Auto-inflammatory diseases (SAIDs) are a rare group of multiple system rheumatic immune diseases caused by innate immune abnormalities, mainly manifested by recurrent fever of unknown origin and systemic multiple system autoinflammation. In the last two decades, due to the intensive and intensive genomics research of human beings and the rapid development of sequencing technologies, more and more genes are identified as causative genes of auto-inflammatory diseases, and the disease spectrum of auto-inflammatory diseases is expanding. The establishment of databases and the intensive research of pathogenic genes also provide valuable data bases for the diagnosis and treatment of patients with autoinflammatory diseases.

Autoinflammation with paroxysmal fever and lymphadenectasis (AIEFL) is a newly defined group of autoinflammatory diseases in 2019, and is collected in the human mendelian genetic database (https:// OMIM. Org /), with OMIM number 618852. In 2019, two groups of teams have a back-to-back study in Nature, the clinical characteristics of AIEFL and the functional verification of a disease-causing gene RIPK1 are described in detail, and disease-causing heterozygous mutations of D324N, D324H, D324Y and the like at a 324-locus with highly conserved protein sequence are reported. The genetic pattern of AIEFL is autosomal dominant with spontaneous fever and lymphadenopathy. Because the protein RIPK1 coded by the RIPK1 gene is a key regulatory molecule for programmed cell death such as apoptosis, necrotic apoptosis and the like, the mutation of the conserved sequence of RIPK1 can cause the abnormal activation of innate immunity and cause the occurrence of autoinflammatory diseases. Mutation sites of the gene RIPK1 are continuously reported in genetic autoinflammatory disease gene mutation Infevers databases (https:// inflvers. Umai-montpellier. Fr/web /), and the deepening of the knowledge can provide a basis for clinically determining and diagnosing autoinflammatory diseases.

Disclosure of Invention

The invention aims to provide application of a mutant form of a gene RIPK1 related to autoinflammation with paroxysmal fever and lymphadenectasis.

In a first aspect, the present invention provides the use of a substance for detecting specific mutations in the preparation of a kit;

the specific mutation is as follows: mutation in RIPK1 gene in human genome, which causes change in cDNA forming transcript, so that the translated protein is mutated from the protein shown in sequence 2 of the sequence table to the protein shown in sequence 4 of the sequence table;

the function of the kit is as follows (c 1), (c 2) or (c 3):

(c1) Screening or auxiliary screening of patients with autoinflammation with paroxysmal fever and lymphadenectasis;

(c2) Screening or auxiliary screening of autoinflammation with paroxysmal fever and lymph node enlargement embryos;

(c3) Patients with autoinflammation with paroxysmal fever and lymphadenectasis are diagnosed or assisted.

Specifically, the changes of the above-mentioned cDNA forming a transcript are: the DNA molecule shown in the sequence 1 of the sequence table is mutated into the DNA molecule shown in the sequence 3 of the sequence table.

In a second aspect, the present invention also provides a kit comprising a substance for detecting a specific mutation;

the specific mutation is as follows: mutation in RIPK1 gene in human genome, which causes change in cDNA forming transcript, so that the translated protein is mutated from the protein shown in sequence 2 of the sequence table to the protein shown in sequence 4 of the sequence table;

the function of the kit is as follows (c 1), (c 2) or (c 3):

(c1) Screening or auxiliary screening of patients with autoinflammation with paroxysmal fever and lymphadenectasis;

(c2) Screening or auxiliary screening of autoinflammation with paroxysmal fever and lymphadenectasis embryos;

(c3) Patients with autoinflammation with paroxysmal fever and lymphadenectasis are diagnosed or assisted.

Specifically, the changes in the cDNA forming the transcript are: the DNA molecule shown in the sequence 1 of the sequence table is mutated into the DNA molecule shown in the sequence 3 of the sequence table.

In the foregoing, the substance for detecting specific mutation is a specific primer pair, and is composed of a single-stranded DNA molecule represented by sequence 5 of the sequence table and a single-stranded DNA molecule represented by sequence 6 of the sequence table.

The screening target is derived from patients with autoinflammatory diseases or patients with intermittent fever and clinical characteristics of large lymph node swelling during fever.

In a third aspect, the invention also provides a mutant protein, which is obtained by mutating the 646 th amino acid residue of the RIPK1 protein from valine to glutamic acid.

Specifically, the mutant protein is shown as a sequence 4 in a sequence table.

In a fourth aspect, the invention also provides a mutant gene, which is obtained by mutating the RIPK1 gene; the RIPK1 gene is a gene which codes RIPK1 protein in a human genome; the mutation is to mutate the codon of the 646 th amino acid residue of the RIPK1 protein from the codon of valine to the codon of glutamic acid.

Specifically, the mutant gene is shown as a sequence 3 in a sequence table.

In a fifth aspect, the invention also provides the use of:

use of a mutein of the foregoing or a mutated gene of the foregoing as a target for the development of a reagent or kit for the diagnosis or assisted diagnosis of patients with autoinflammation with paroxysmal fever and lymphadenectasis.

Use of a mutein of the foregoing or a mutated gene of the foregoing as a target in the development of a reagent or kit for treating a patient with autoinflammation with paroxysmal fever and lymphadenectasis.

The invention discovers a new mutation form of pathogenic genes of autoinflammation with paroxysmal fever and lymphadenectasis by carrying out high-throughput sequencing on proband, and the mutation can be used as a molecular marker for clinical diagnosis of autoinflammation with paroxysmal fever and lymphadenectasis and a target for research and development of novel medicaments. The discovery of the invention provides a basis for analyzing the pathogenic mechanism of the autoinflammatory disease, and also provides a new direction for clinical diagnosis and treatment of the autoinflammatory disease.

Drawings

FIG. 1 shows the changes of proband C-reactive protein during the febrile phase and the febrile interval.

FIG. 2 shows the results of RIPK1 gene mutation in whole genome sequencing.

FIG. 3 shows the sequencing results of the target sites of proband and family members thereof.

FIG. 4 shows the results of GSEA analysis of proband transcriptome sequencing.

FIG. 5 is a frequency chart of protein conserved sequences.

FIG. 6 shows IL-1. Beta. Content of predecessor and healthy persons after different stimulation in ELISA.

FIG. 7 is a Western blot assay of protein expression in inflammatory pathways after different stimuli for proband and healthy persons.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The human RIPK1 protein and the coding gene thereof are shown in GENBANK ACCESSION NO. NM-003804.6.

Example 1 discovery of mutant forms of RIPK1 Gene

1. Proband information

Male, 31 years old, repeatedly fever for 5 years. The patient has no incentive 5 years agoRepeatedly generate heatThe body temperature is 39.4 ℃ at the maximum, and the fever lasts for 3-7 days each time and is released again at intervals of several weeks. While generating heatThe swelling of the lymph nodes at the neck part,headache, pharyngalgia, tonsillitis, myalgia, arthralgia and nauseaVomiting of heart, abdominal pain, abdominal distension, conjunctivitis, tinnitus. White blood cell count, blood sedimentation and C-reactive protein increase in the febrile stage, and the febrile period returns to normal (the change of C-reactive protein in febrile stage and febrile period is shown in figure 1), and neck lymph node swelling and disappearance of type-B ultrasonography is rechecked. Other fever causing factors such as infections, tumors and connective tissue diseases have been excluded.

Clinically diagnosed, the patient is a patient with the autoinflammatory disease, and has clinical characteristics of intermittent fever and lymph node enlargement during fever (underlined parts in proband information are typical phenotypes of autoinflammatory with paroxysmal fever and lymph node enlargement), so the patient is highly suspected to be the patient with the related autoinflammatory disease of the RIPK1 gene.

2. Whole genome sequencing of proband

1. Collecting a specimen: collecting EDTA anticoagulation under the premise of informed consent.

2, DNA extraction: genomic DNA in peripheral blood was extracted using a blood genome column type quantitative extraction kit (Tiangen), and the procedures were performed according to the kit instructions. And (3) performing quality inspection on the extracted DNA sample by using a Qubit 2.0 type fluorimeter and 0.8% agarose gel electrophoresis, and continuing the subsequent steps after the quality inspection is qualified.

3. Library construction: by IDT Inc

An Exome Research Panel v2.0 capture probe is subjected to liquid hybridization with a gDNA library sequence, DNA fragments in a target region are enriched, a whole exon library is constructed, coding regions and partial non-coding regions of 19396 genes in a human genome are covered, and the capture interval is 39Mb.

4. Sequencing: high-throughput sequencing (PE 150) was performed by DNBSEQ-T7 sequencer of Huada Zhi Ltd, and the target sequence sequencing coverage was not less than 99%.

5. Bioinformatics analysis:

(1) Quality control: and (4) performing quality control on the original data by using fastp software, and removing joints, low-quality reads and the like.

(2) Obtaining variation: aligning the sequenced sequences to the Ensemble reference genome GRCh37/hg19 using Burrows-Wheeler Aligner (BWA) software; then, analyzing SNP and Indel by using GATK software; and finally, filtering and screening the detected SNP and Indel according to the sequencing depth and the mutation quality to obtain high-quality and reliable mutation.

(3) Variant annotation and prediction: the high quality variation detected was annotated by association with large databases (e.g., frequency databases such as dbSNP, thousand human genome, exAC, ESP, OMIM, HGMD, clinVar, etc.) using autonomously developed variation annotation software. And analyzing the hazard of protein structure prediction software such as Provean, SIFT, polyphen2-HVAR, polyphen2-HDIV, M-Cap, revel, mutatemaster and the like and MaxEntScan shearing site prediction software, and the like to screen out the variation which has harmful influence on the protein structure.

The results are as follows:

the RIPK1 gene of the proband has the following mutations: NM-003804 (exon 11) T > A (p.Val646Glu), and the mutation type is heterozygote (see FIG. 2). That is, the proband has a single nucleotide mutation of T → A in exon11 of RIPK1 gene, thereby causing mutation of valine at position 646 to glutamic acid in the encoded protein. Namely, a normal RIPK1 gene transcript (a cDNA is represented by a sequence 1 in a sequence table and expresses a protein represented by a sequence 2 in the sequence table) is formed in one chromosome of the proband, and a mutant RIPK1 gene transcript (a cDNA is represented by a sequence 3 in the sequence table and expresses a protein represented by a sequence 4 in the sequence table) is formed in the other chromosome of the proband.

Autoinflammatory diseases are divided into monogenic autoinflammatory diseases and polygenic multifactorial autoinflammatory diseases. The multi-gene multifactorial autoinflammatory diseases include adult still disease, behcet disease, etc., the etiology is not clear, and the diseases are not caused by a specific pathogenic gene. The clinical manifestations of the proband are inconsistent with those of the multi-gene multi-factor autoinflammatory diseases, and the RIPK1 gene mutation exists, so that the multi-gene multi-factor autoinflammatory diseases can be excluded. On the other hand, diagnosis of monogenic autoinflammatory diseases requires a definite diagnosis combining clinical manifestations with genetic testing results. The clinical phenotype of the proband accords with the phenotype expression of autoinflammation with paroxysmal fever and lymph node enlargement, and besides the heterozygous mutation of the RIPK1 gene c.1937T > A (p.Val646Glu), the gene mutation which can explain the clinical expression of a patient is not found, the RIPK1 gene mutation can also fully explain the clinical phenotype of the proband, therefore, the remaining single-gene autoinflammation diseases can be eliminated, and finally, the proband is diagnosed as the RIPK1 gene related autoinflammation diseases.

Therefore, the patient can be judged to be the patient with the RIPK1 gene-related autoinflammatory disease by combining the first step and the second step.

3. Target site sequencing of family members of proband

According to the verified site chr6:3113494c.1937 (exon 11) T > A of RIPK1 gene

The sequence design primers are as follows.

RIPK1_ F (sequence 5 of the sequence listing): GGCCAGATGTAAGCGGAGAA

RIPK1_ R (sequence 6 of a sequence table): GGCTGACGTAAATCAAGCTGC

The test person: proband, father of proband, mother of proband.

1. The peripheral blood of the test subject was collected and genomic DNA was extracted. And (3) performing quality inspection on the extracted genome DNA by using Nanodrop 2000, wherein quality inspection is marked: the DNA concentration is more than or equal to 20 ng/. Mu.L.

2. And (3) taking the genome DNA obtained in the step (1) as a template, performing PCR amplification by adopting a primer pair consisting of RIPK1_ F and RIPK1_ R, recovering a PCR amplification product and sequencing.

Gene sequence analysis: PCR amplification products of verified sites of the RIPK1 gene are sequenced by an ABI 3730XL sequencer, and the sequencing primer adopts the original PCR primer. Gene sequence analysis and alignment were performed using DNASTAR software.

The sequencing results of the mutation sites of proband and their periphery are shown in FIG. 3A. The sequencing results of the mutation sites of the father of the proband and the periphery thereof are shown in FIG. 3B. The sequencing results of the mutation sites of the mother of proband and their periphery are shown in FIG. 3C.

The results show that: the RIPK1 gene on two chromosomes of the father of the proband has no mutation (the father of the proband has no clinical expression related to the autoinflammatory disease); one chromosome RIPK1 gene of the mother of the proband generates the mutation, and the other chromosome RIPK1 gene does not generate the mutation (the mother of the proband has clinical manifestations related to autoinflammatory diseases and intermittent fever); the mutation of one chromosome RIPK1 gene of the proband is not generated in the other chromosome RIPK1 gene.

The mutation is normal RIPK1 gene transcript (cDNA is shown as a sequence 1 in a sequence table and expresses protein shown as a sequence 2 in the sequence table) to form mutant RIPK1 gene transcript (cDNA is shown as a sequence 3 in the sequence table and expresses protein shown as a sequence 4 in the sequence table).

The mutation of the proband belongs to a newly found mutation site of a pathogenic gene, the mutation is from mother, the mother also has the typical expression of inflammatory diseases of the mother and has intermittent fever, and the pathogenicity of the mutation can be verified.

Example 2 implementation of patient transcriptome sequencing

1. Extraction of RNA from peripheral blood of patient

1. Adding peripheral blood of proboscis and phosphate buffer solution into a 15ml centrifuge tube, blowing, diluting and mixing uniformly.

2. And adding 4ml of human lymphocyte separation liquid to the bottom of another 15ml of centrifuge tube, inclining the centrifuge tube to an angle of 30-45 degrees, sucking 8ml of diluted blood, slowly adding the blood to the upper part of the liquid level of the human lymphocyte separation liquid, and keeping the interface of the two liquid levels clear.

3. The 15ml centrifuge tubes were transferred to a high speed refrigerated centrifuge and centrifuged for 20 minutes with an acceleration up to 3, a deceleration up to 3, and a centrifugal force of 1800 rpm.

4. After the centrifugation is finished, the PBMCs cell layer is sucked and transferred to a 15ml centrifuge tube, the centrifuge tube is filled with phosphate buffer saline solution, and the centrifuge tube is covered with a cover and is turned upside down to be mixed evenly. The 15ml centrifuge tubes were transferred to a high speed refrigerated centrifuge for cell washing.

5. And after the centrifugation is finished, taking out the centrifuge tube enriched with the cell precipitate from the centrifuge, discarding the supernatant, adding phosphate buffer solution to resuspend the cells, centrifuging again, discarding the supernatant, and adding a TRlzol Reagent to reserve RNA.

2. Implementation of RNAseq

1. Experimental procedure

RNA of the total sample was isolated and purified, and then the amount and purity of total RNA were controlled by NanoDrop ND-1000 (NanoDrop, wilmington, DE, USA) and integrity of RNA was checked by Bioanalyzer 2100 (Agilent, CA, USA); the concentration is more than 50 ng/. Mu.L, the RIN value is more than 7.0, and the total RNA > 1. Mu.g meets the downstream experiment. mRNA carrying PolyA (poly A) was specifically captured using two rounds of purification using Oligo (dT) magnetic beads (Dynabeads Oligo (dT), cat.25-61005, thermo Fisher, USA). The captured mRNA was fragmented under high temperature conditions using a Magnesium Fragmentation kit (NEBNextR Magnesium RNA Fragmentation Module, cat. E6150S, USA) for 5-7 min at 94 ℃. The fragmented RNA was subjected to Reverse Transcriptase (Invitrogen SuperScriptTM II Reverse Transcriptase, cat.1896649, CA, USA) to synthesize cDNA. Coli DNA polymerase I (NEB, cat. M0209, USA) and RNase H (NEB, cat. M0297, USA) were then used for duplex synthesis to convert the complex duplexes of these DNAs and RNAs into DNA duplexes, while dUTP Solution (Thermo Fisher, cat. R0133, CA, USA) was incorporated into the duplexes to fill the ends of the duplex DNA with blunt ends. And adding an A base at each of two ends of the magnetic beads, connecting the A bases with a joint with a T base at the tail end, and screening and purifying the fragment size by using magnetic beads. Both strands were digested with UDG enzyme (NEB, cat. M0280, MA, US) and were held for 3 minutes by PCR-pre-denaturation at 95 ℃ for a total of 8 cycles each for 15 seconds at 98 ℃, annealed to 60 ℃ for 15 seconds, extended at 72 ℃ for 30 seconds, and finally extended at 72 ℃ for 5 minutes to form a library (strand-specific library) with fragment sizes of 300bp + -50 bp. Finally, it was paired-end sequenced using illumina NovaseqTM 6000 (LC Bio Technology co., ltd. Hangzhou, china) according to standard procedures in the sequencing mode PE150.

2. Analytical procedures

Obtaining sequencing off-line Data, filtering the off-line Data to obtain high-quality sequencing Data (Clean Data), comparing the high-quality sequencing Data to a reference genome of the project species, quantifying gene expression, analyzing expression quantity information based on all genes by using GSEA (generalized genetic algorithm), sequencing the genes by taking Signal2Noise as a standard (default descending order arrangement), analyzing the ranking of a specific gene set on all genes, and scoring a path or Term where the gene set is located, wherein a score is called an ES (enrichment score) value. Performing permatation test based on the gene set, calculating a significance p value, and finally performing various inspection corrections on the standardized ES value (NES value) to obtain an FDR value. It is generally considered that a gene set of | NES | >1, NOM.pval <0.05, FDR.qval <0.25 is meaningful, and GSEA analysis was performed on a gene set of 15-500 size.

And (3) drawing and displaying the first 30 gene sets with the minimum P value and the minimum FDR value in the GSEA-GO analysis result, wherein the abscissa is the NES value of the gene set, the color represents the P value or the FDR value, the analysis result is shown in a figure 4, and the proband is shown to have I-type interferon channels, interferon gamma channels and various inflammation channel activations relative to a healthy control, so that the inflammation phenotype of the patient is verified.

Example 3 mapping of protein conserved sequence frequency

The homologous amino acid sequences corresponding to 311 spinal animals of RIPK1 protein are downloaded by using an on-line tool NCBI protein database, and are subjected to multi-sequence alignment analysis and protein conservation frequency analysis.

The analysis steps are as follows:

1. RIPK1 was retrieved in the protein database of NCBI website and clicks Orthologs in the list of Homo sapiens (human).

2. Selecting a homologous sequence: screening amino acid sequences with similar length to that of human amino acids, selecting 311 vertebrates including human, clicking Protein alignment, and performing online alignment analysis.

3. And opening the sequence after comparison in WebLoso 3 (http:// webbloo. Threeplucone. Com), and drawing a protein conserved sequence frequency diagram by adjusting corresponding parameters.

The frequency of the protein conserved sequence is shown in FIG. 5. Proband gene mutation sites were found to belong to conserved sequences in the three hundred eleven vertebrates, suggesting that site changes may be pathogenic.

Therefore, the mutant site (p.Val646Glu) of the RIPK1 gene or the mutant gene or mutant protein containing the mutant site can be used as a target for auxiliary screening whether the patient has autoinflammation with paroxysmal fever and lymphadenectasis.

The mutation site (p.Val646Glu) of the RIPK1 gene is that the 646 th valine of the sequence 2 is mutated into glutamic acid.

Example 4 proband peripheral blood mononuclear cell inflammatory factor and protein assay

1. Adding the proband, the healthy control peripheral blood and the phosphate buffered saline solution into a 15ml centrifuge tube, blowing, diluting and mixing uniformly.

2. And adding 4ml of human lymphocyte separation liquid to the bottom of another 15ml of centrifuge tube, inclining the centrifuge tube to an angle of 30-45 degrees, sucking 8ml of diluted blood, slowly adding the blood to the upper part of the liquid level of the human lymphocyte separation liquid, and keeping the interface of the two liquid levels clear.

3. The 15ml centrifuge tubes were transferred to a high speed refrigerated centrifuge and centrifuged for 20 minutes with an acceleration up to 3, a deceleration up to 3, and a centrifugal force of 1800 rpm.

4. And after the centrifugation is finished, sucking the peripheral blood single cell layer, transferring the peripheral blood single cell layer to a 15ml centrifuge tube, filling the centrifuge tube with phosphate buffer saline solution, covering the centrifuge tube with a cover, turning upside down and mixing uniformly. The 15ml centrifuge tubes were transferred to a high speed refrigerated centrifuge to wash the cells.

5. After centrifugation, the centrifuge tube enriched with cell pellet is taken out from the centrifuge, the supernatant is discarded, phosphate buffered saline is added to resuspend the cells, the centrifugation is performed again, the supernatant is discarded and then is respectively resuspended by culture medium or stimulation factor culture medium, finally, three types of cells cultured under the conditions are formed, namely a control group (the culture medium is used for resuspension and is marked as con in the figure), a TNF stimulation group (the culture medium containing TNF stimulation factor is resuspended, the final TNF stimulation concentration is 100ng/ml and is marked as TNFa in the figure) and a TNF and zVAD-fmk co-stimulation group (the TNF stimulation concentration is 100ng/ml and the zVAD-fmk stimulation concentration is 10uM and is marked as TNFa + zVAD in the figure), and the cells are placed into an incubator containing 5 CO2 at 37 ℃ for culturing for 18 hours.

6. The culture was carried out for 18 hours, and the supernatant and the protein were left to examine.

7. The IL-1 beta content of the collected supernatant was detected using a human interleukin 1 beta (IL-1 beta) enzyme-linked immunosorbent assay kit (Ekesai, EH 001-96) (FIG. 6), and finally it was found that IL-1 beta was significantly increased after TNF stimulation of proband compared with healthy controls, suggesting the activation state of the inflammatory pathway.

8. Protein expression of inflammatory pathways was investigated in probands using western blot experiments, and the results (fig. 7) showed that abnormal activation of inflammatory pathways was present in patients.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Claims (10)

1. The use of a substance for detecting specific mutations in the preparation of a kit; the specific mutation is as follows: mutation in RIPK1 gene in human genome, which causes change in cDNA forming transcript, so that the translated protein is mutated from the protein shown in sequence 2 of the sequence table to the protein shown in sequence 4 of the sequence table;

the function of the kit is as follows (c 1), (c 2) or (c 3):

(c1) Screening or auxiliary screening of patients with autoinflammation with paroxysmal fever and lymphadenectasis;

(c2) Screening or auxiliary screening of autoinflammation with paroxysmal fever and lymph node enlargement embryos;

(c3) Patients with autoinflammation with paroxysmal fever and lymphadenectasis are diagnosed or assisted.

2. The use of claim 1, wherein: the changes in the transcript-forming cDNA are: the DNA molecule shown in the sequence 1 of the sequence table is mutated into the DNA molecule shown in the sequence 3 of the sequence table.

3. Use according to claim 1 or 2, characterized in that: the substance for detecting the specific mutation is a specific primer pair which consists of a single-stranded DNA molecule shown in a sequence 5 of a sequence table and a single-stranded DNA molecule shown in a sequence 6 of the sequence table.

4. A kit comprising a substance for detecting a specific mutation; the specific mutation is as follows: mutation in RIPK1 gene in human genome, which causes change in cDNA forming transcript, so that the translated protein is mutated from the protein shown in sequence 2 of the sequence table to the protein shown in sequence 4 of the sequence table;

the function of the kit is as follows (c 1), (c 2) or (c 3):

(c1) Screening or auxiliary screening of patients with autoinflammation with paroxysmal fever and lymphadenectasis;

(c2) Screening or auxiliary screening of autoinflammation with paroxysmal fever and lymphadenectasis embryos;

(c3) Patients with autoinflammation with paroxysmal fever and lymphadenectasis are diagnosed or assisted.

5. The kit of claim 4, wherein: the changes in the transcript-forming cDNA are: the DNA molecule shown in the sequence 1 of the sequence table is mutated into the DNA molecule shown in the sequence 3 of the sequence table.

6. A kit as claimed in claim 4 or 5, wherein: the substance for detecting the specific mutation is a specific primer pair which consists of a single-stranded DNA molecule shown in a sequence 5 of a sequence table and a single-stranded DNA molecule shown in a sequence 6 of the sequence table.

7. A mutant protein is obtained by mutating the 646 th amino acid residue of the RIPK1 protein from valine to glutamic acid.

8. A mutant gene is obtained by mutating RIPK1 gene; the mutation is to mutate the codon of the 646 th amino acid residue of the RIPK1 protein from the codon of the encoded valine to the codon of the glutamic acid; the RIPK1 gene is a gene for coding RIPK1 protein in a human genome.

9. Use of the mutein according to claim 7 or the mutated gene according to claim 8 as a target for the development of reagents or kits for the diagnosis, assisted diagnosis, screening or assisted screening of patients with autoinflammation with paroxysmal fever and lymphadenectasis.

10. Use of the mutein according to claim 7 or the mutated gene according to claim 8 as target for the development of a reagent or kit for the treatment of patients with autoinflammation with paroxysmal fever and lymphadenectasis.

Images