CN115927753A - Multiplex connection probe amplification identification kit capable of detecting various porcine respiratory pathogens - Google Patents

Abstract

The invention relates to the field of inspection and quarantine, and aims to provide a multiple connection probe amplification identification kit capable of detecting multiple porcine respiratory pathogens. The kit comprises: the pre-amplification primer mixture contains a pre-amplification primer with a sequence shown in SEQ ID NO:1 to 14; the probe mixed solution comprises a left probe and a right probe, and the sequences are shown as SEQ ID NO:15 to 28; MLPA buffer solution; connecting a buffer solution A; connecting a buffer solution B; ligase Ligase-65; a PCR reaction mixture comprising a sequence as set forth in SEQ ID NO:29 and 30; SALSA polymerase; negative control; and (4) positive control. The invention has the characteristics of high flux, good specificity and high sensitivity; the operation is simpler and more convenient, and the detection time is shorter.

Description

Multiple connection probe amplification identification kit capable of detecting various porcine respiratory pathogens

Technical Field

The invention provides a multiple connection probe amplification identification detection kit, primers and probes for detecting porcine reproductive and respiratory syndrome virus, porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, porcine respiratory coronavirus, porcine influenza virus, haemophilus parasuis and porcine circovirus type 2, can realize simultaneous detection of 7 pathogens causing porcine respiratory disease, and belongs to the field of inspection and quarantine.

Background

Porcine reproductive and respiratory syndrome virus, actinobacillus pleuropneumoniae, pasteurella multocida, porcine respiratory coronavirus, porcine influenza virus, haemophilus parasuis and porcine circovirus type 2 are common pathogens causing porcine respiratory diseases.

As more than one disease causing the respiratory symptoms of the pigs has similar clinical manifestations and is often infected by different mixed pathogens, the diagnosis of pathogenic causes is difficult to be determined according to clinical symptoms and pathological changes. At present, no method can identify various diseases causing porcine respiratory symptoms at one time. Therefore, a detection method capable of accurately, quickly and efficiently distinguishing different pathogens is established, and is important for identifying and diagnosing the porcine respiratory pathogens.

Disclosure of Invention

The invention aims to solve the technical problem of overcoming the defects in the prior art and provides a multiplex ligation probe amplification identification kit capable of detecting multiple porcine respiratory pathogens.

In order to solve the technical problem, the invention adopts the following technical scheme:

provides a multiple connection probe amplification identification kit capable of detecting multiple porcine respiratory pathogens, which comprises:

(1) Pre-amplifying primer mixed liquor;

the mixed solution comprises a pre-amplification primer, and the sequence of the pre-amplification primer is shown as SEQ ID NO:1 to 14;

(2) Probe mixed liquid;

the mixed solution comprises a left probe and a right probe, and the sequences of the probes are shown as SEQ ID NO:15 to 28;

(3) MLPA buffer solution;

(4) Connecting a buffer solution A;

(5) Connecting a buffer solution B;

(6) Ligase Ligase-65;

(7) A PCR reaction mixture comprising a sequence as set forth in SEQ ID NO:29 and 30;

(8) SALSA polymerase;

(9) Negative control;

(10) A positive control;

in the pre-amplification primer of the pre-amplification primer mixture solution: sequence SEQ ID NO:1 and the sequence SEQ ID NO:2 are respectively a forward primer and a reverse primer of porcine reproductive and respiratory syndrome virus pre-amplification; sequence SEQ ID NO:3 and the sequence SEQ ID NO:4 are respectively the forward and reverse primers of the preamplification of the porcine actinobacillus pleuropneumoniae; sequence SEQ ID NO:5 and the sequence SEQ ID NO:6 are respectively a forward primer and a reverse primer of porcine pasteurella multocida pre-amplification; the sequence of SEQ ID NO:7 and SEQ ID NO:8 are respectively the forward and reverse primers of porcine respiratory coronavirus pre-amplification; sequence SEQ ID NO:9 and SEQ ID NO:10 are forward and reverse primers for pre-amplification of swine influenza virus, respectively; sequence SEQ id no:11 and SEQ ID NO:12 are respectively the forward and reverse primers for the pre-amplification of haemophilus parasuis; the sequence of SEQ ID NO:13 and SEQ ID NO:14 are forward and reverse primers for porcine circovirus type 2 pre-amplification, respectively;

in the probe of the probe mixture solution: sequence SEQ ID NO:15 and SEQ ID NO:16 are a left side probe and a right side probe for detecting porcine reproductive and respiratory syndrome virus, respectively; sequence SEQ ID NO:17 and SEQ ID NO:18 are respectively a left side probe and a right side probe for detecting the porcine actinobacillus pleuropneumoniae; sequence SEQ ID NO:19 and SEQ ID NO:20 are respectively a left side probe and a right side probe for detecting the swine pasteurella multocida; sequence SEQ ID NO:21 and SEQ ID NO:22 are a left side probe and a right side probe for detecting the porcine respiratory coronavirus respectively; the sequence of SEQ ID NO:23 and SEQ ID NO:24 are a left side probe and a right side probe for detecting swine influenza virus respectively; the sequence of SEQ ID NO:25 and SEQ ID NO:26 are a left side probe and a right side probe for detecting haemophilus parasuis respectively; sequence SEQ ID NO:27 and SEQ ID NO:28 are a left side probe and a right side probe for detecting porcine circovirus type 2 respectively;

in the primer of the PCR reaction mixture, the sequence of SEQ ID NO:29 and SEQ ID NO:30 are universal forward and reverse primers, respectively;

wherein, the sequence SEQ ID NO: 16. SEQ ID NO: 18. the amino acid sequence of SEQ ID NO: 20. SEQ ID NO: 22. SEQ ID NO: 24. SEQ ID NO:26 and SEQ ID NO:28, carrying out phosphorylation treatment on the 5' end;

the positive control is a mixture of in vitro transcribed RNA of the gene and positive recombinant plasmid DNA; the in vitro transcription RNA of the gene is the in vitro transcription RNA of the M gene of porcine reproductive and respiratory syndrome virus, the S gene of porcine respiratory coronavirus and the M gene of porcine influenza virus, and the positive recombinant plasmid DNA refers to the positive recombinant plasmid DNA of the ApxIVA gene of porcine actinobacillus pleuropneumoniae, the toxA gene of porcine pasteurella multocida, the 16S rRNA gene of haemophilus parasuis and the ORF2 gene of porcine circovirus type 2.

The invention further provides a method for simultaneously detecting multiple porcine respiratory pathogens by utilizing the multiple connection probe amplification of the kit to realize the purpose of non-disease detection, which comprises the following steps:

(1) Extracting DNA/RNA of a sample by a magnetic bead method;

simultaneously extracting DNA and RNA in a sample by using a magnetic bead DNA/RNA co-extraction kit and a full-automatic nucleic acid extractor to obtain a 100 mu L sample;

(2) Reverse transcription of RNA into cDNA and preamplification

Carrying out one-step reverse transcription RT-PCR reaction;

prepare 25 μ L reaction system: mu.L of OnESTep Ahead RT-PCR Master Mix, 1. Mu.L of OnESTep Ahead RT-Mix, 5. Mu.L of DNA or RNA, 5. Mu.L of Q-solution, 1. Mu.L of pre-amplification primer mixture (final concentration of 0.25. Mu.M per primer), 3. Mu.L of H ₂ O is complemented; reaction conditions are as follows: 10min at 50 ℃ and 5min at 95 ℃; 1, 10 cycles of 95 ℃, 15s,55 ℃, 20s,72 ℃ and 30 cycles; 2min at 72 ℃;

(3) MLPA detection

a. Denaturation of DNA

Taking 0.2mL PCR reaction tubes, adding 0.5 mu L DNA solution and 4.5 mu L TE into each tube, denaturing at 98 ℃ for 5min, and cooling to room temperature of 25 ℃;

b. hybridization of the Probe with sample DNA

Preparing 3 mu L of mixed probe liquid: 1.5. Mu.L MLPA buffer solution + 1.5. Mu.L probe mixture; adding the probe mixture into the PCR tube, incubating at 95 deg.C for 1min, hybridizing at 60 deg.C for 1-1697 h, and incubating at 54 deg.C;

c. ligation of hybridization probes

Prepare 32 μ L ligase mix: 25 μ L dH ₂ O + 3. Mu.L ligation buffer A + 3. Mu.L ligation bufferB +1. Mu.L Ligase Ligase-65; cooling the temperature of the PCR instrument to 54 ℃, opening a tube cover, adding 32 mu L of ligase mixture, incubating at 54 ℃ for 15min, heating at 98 ℃ for 5min to inactivate the ligase, and incubating at 20 ℃;

d. PCR amplification of ligated probes

Prepare 10 μ L of PCR mix: 7.5 uL dH ₂ O + 2. Mu.L of PCR reaction mixture + 0.5. Mu.L of SALSA polymerase; taking out the PCR tube, and adding 10 mu L of PCR mixture at room temperature; the PCR reaction was started under the following conditions: 30s at 95 ℃, 30s at 60 ℃, 60s at 72 ℃ and 35 cycles; incubating at 72 deg.C for 20min, and cooling to 15 deg.C;

e. analysis by a full-automatic nucleic acid analyzer:

taking a PCR amplification product, and analyzing by using a full-automatic nucleic acid analyzer;

(4) Result description and determination

a. Quality control standard:

the positive control has specific amplification bands at 94bp, 98bp, 112bp, 116bp, 122bp, 130bp and 140 bp;

negative control no specific amplification band;

if the negative control and the positive condition do not satisfy the above conditions, the test is regarded as invalid;

b. and (5) judging a result:

positive: a specific amplification strip exists at the position of 94bp, which indicates that the porcine reproductive and respiratory syndrome virus nucleic acid exists in the sample; a specific amplification strip exists at the position of 98bp, which indicates that the actinobacillus pleuropneumoniae nucleic acid exists in the sample; a specific amplification band at 112bp indicates that the swine pasteurella multocida nucleic acid exists in the sample; a specific amplification band exists at a position of 116bp, which indicates that the porcine respiratory coronavirus nucleic acid exists in the sample; a specific amplification strip exists at 122bp, which indicates that swine influenza virus nucleic acid exists in the sample; a specific amplification band exists at a position of 130bp, which indicates that Haemophilus parasuis nucleic acid exists in the sample; a specific amplification band exists at 140bp, which indicates that porcine circovirus type 2 nucleic acid exists in the sample;

negative: and (3) no specific amplification strip shows that the sample does not contain porcine reproductive and respiratory syndrome virus nucleic acid, porcine actinobacillus pleuropneumoniae nucleic acid, porcine pasteurella multocida nucleic acid, porcine respiratory coronavirus nucleic acid, porcine influenza virus nucleic acid, haemophilus parasuis nucleic acid and porcine circovirus type 2 nucleic acid.

3. The method according to claim 2, wherein the MLPA amplification product is sequenced when the result is judged, and the result is confirmed.

Compared with the prior art, the invention has the beneficial effects that:

1. high flux. 7 pathogens are detected simultaneously, 96 samples can be detected simultaneously each time by using a full-automatic nucleic acid analyzer, and a high-throughput detection technology is provided for differential diagnosis and emergency diagnosis of the pathogens.

2. The specificity is good. Through probe design, sequence alignment and blast analysis, the probe is ensured to be only combined with the target gene. And common pathogens are detected clinically, the method can only amplify target fragments with corresponding sizes from corresponding templates, and other pathogens are not amplified.

3. The sensitivity is high. Due to differences of sampling individuals or sampling sites, the samples may have different pathogen contents. As is the case in the prior art, the reagents used in the detection process need to be adjusted for various different differences, which leads to a dramatic increase in workload. Aiming at the problem, the invention provides the method for pre-amplifying the pathogenic nucleic acid, exponentially increases the content of the pathogen in the sample, effectively improves the detection sensitivity and avoids repeated work. The conventional MLPA method requires at least 6000 copies of the target DNA. By adding the step of RT-PCR, the target gene is enriched, and 1 copy of the target gene can be detected at the minimum.

4. The traditional detection of the porcine respiratory pathogens is generally carried out by pathogen isolation culture, ELLSA detection, RT-PCR detection and the like, and the identification formed by the detection and the pathogen detection technology tend to be mature and are in a development stable stage. The MLPA analysis provided by the invention is a new method and technology for detecting DNA copy number change, not only combines the principle of DNA probe hybridization, but also is integrated with PCR technology.

Compared with a virus and bacterium separation method, the method is simpler and more convenient to operate and shorter in detection time. Compared with the common PCR detection technology, the invention can distinguish two closely related sequences due to the combination of MLPA probes, and has higher specificity and sensitivity. And finally, the capillary electrophoresis result is presented in a gel image and a peak image, so that different fragments in the same lane can be compared conveniently, the peak image can be selected for analysis, wherein the fragments with different lengths correspond to different peaks on the peak image, and the gel image is more convenient to compare the difference between different lanes, and can be flexibly selected according to the requirement.

5. Different from the prior art, the invention can detect two types of pathogens including viruses and bacteria through MLPA analysis, simultaneously extract the nucleic acids of the viruses and the bacteria and simultaneously detect the nucleic acids. The result shows that the peak values generated by different pathogens can be clearly distinguished on a capillary electrophoresis apparatus according to the sizes of different hybridization probes, and the mutual cross reaction does not exist in the detection of the simultaneous existence of viruses and bacteria in a sample.

Drawings

FIG. 1 is a diagram of a peak of a multiplex ligation probe amplification capillary electrophoresis of porcine reproductive and respiratory syndrome virus, porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, porcine respiratory coronavirus, porcine influenza virus, haemophilus parasuis and porcine circovirus type 2.

The figures show that: specific amplification peak of porcine reproductive and respiratory syndrome virus at 94 bp; specific amplification peaks of actinobacillus pleuropneumoniae at 98 bp; specific amplification peak of swine pasteurella multocida at 112 bp; specific amplification peak of the porcine respiratory coronavirus at 116 bp; specific amplification peak of swine influenza virus at 122 bp; specific amplification peaks of the haemophilus parasuis at 130 bp; the specific amplification peak of porcine circovirus type 2 at 140 bp.

FIG. 2 is a capillary electrophoresis gel diagram of multiple ligation probes amplification of porcine reproductive and respiratory syndrome virus, porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, porcine respiratory coronavirus, porcine influenza virus, haemophilus parasuis and porcine circovirus type 2.

M:1000bp DNA marker, NC: no template control is carried out, and the Lane1, 2, 3, 4, 5, 6 and 7 respectively use the in vitro transcription RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus and porcine influenza virus, and the positive recombinant plasmid DNA of porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, haemophilus parasuis and porcine circovirus type 2 as templates, and carry out MLPA detection by using a mixed probe.

FIG. 3 is a capillary electrophoresis gel diagram of MLPA detection by using porcine reproductive and respiratory syndrome virus probes, using in vitro transcription RNAs of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and porcine influenza virus, and positive recombinant plasmid DNAs of porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, haemophilus parasuis, and porcine circovirus type 2 as templates, respectively.

M:1000bp DNA marker, lane 1: in vitro transcription RNA of porcine reproductive and respiratory syndrome virus is taken as a template, lane2, lane 3, lane 4, lane 5, lane 6 and Lane 7 respectively take in vitro transcription RNA of porcine respiratory coronavirus and porcine influenza virus, and positive recombinant plasmid DNA of porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, haemophilus parasuis and porcine circovirus type 2 as a template, and NC: no template control.

FIG. 4 is a capillary electrophoresis gel chart of MLPA detection by using porcine actinobacillus pleuropneumoniae probe with the positive recombinant plasmid DNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus and porcine influenza virus type 2, in vitro transcription RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus and porcine influenza virus as templates.

M:1000bp DNA marker, lane 1: the recombinant plasmid DNA of the porcine actinobacillus pleuropneumoniae is taken as a template, lane2, lane 3, lane 4, lane 5, lane 6 and Lane 7 respectively take in-vitro transcription RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus and porcine influenza virus, and positive recombinant plasmid DNA of porcine pasteurella multocida, haemophilus parasuis and porcine circovirus type 2 as a template, NC: no template control.

FIG. 5 is a capillary electrophoresis gel diagram of MLPA detection with a swine pasteurella multocida probe, using in vitro transcription RNA of swine breeding and respiratory syndrome virus, swine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of swine actinobacillus pleuropneumoniae, swine pasteurella multocida, haemophilus parasuis, and porcine circovirus type 2 as templates, respectively.

M:1000bp DNA marker, lane 1: taking recombinant plasmid DNA of porcine pasteurella multocida as a template, taking RNA transcribed in vitro of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus and porcine influenza virus, and positive recombinant plasmid DNA of porcine actinobacillus pleuropneumoniae, haemophilus parasuis and porcine circovirus type 2 as templates for Lane2, 3, 4, 5, 6 and 7 respectively, and NC: no template control.

FIG. 6 is a capillary electrophoresis gel chart of MLPA detection with porcine respiratory coronavirus probes, using in vitro transcription RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus and porcine influenza virus, and positive recombinant plasmid DNA of porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, haemophilus parasuis and porcine circovirus type 2 as templates, respectively.

M:1000bp DNA marker, lane 1: taking RNA transcribed in vitro by the porcine respiratory coronavirus as a template, taking RNA transcribed in vitro by porcine reproductive and respiratory syndrome virus and swine influenza virus, and positive recombinant plasmid DNA of porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, haemophilus parasuis and porcine circovirus type 2 as templates for Lane2, lane 3, 4, 5, 6 and 7 respectively, and NC: no template control.

FIG. 7 is a capillary electrophoresis gel chart of MLPA detection with swine influenza virus probe using in vitro transcription RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and swine influenza virus, and positive recombinant plasmid DNA of actinobacillus pleuropneumoniae, pasteurella multocida, haemophilus parasuis, and porcine circovirus type 2 as templates, respectively.

M:1000bp DNA marker, lane 1: taking RNA transcribed in vitro of a swine influenza virus as a template, taking RNA transcribed in vitro of a swine reproduction and respiratory syndrome virus and a swine respiratory coronavirus, taking positive recombinant plasmid DNA of actinobacillus pleuropneumoniae, pasteurella multocida, haemophilus parasuis and porcine circovirus type 2 as templates, and taking Lane2, 3, 4, 5, 6 and 7 as NC: no template control.

FIG. 8 is a capillary electrophoresis gel diagram of MLPA detection with Haemophilus parasuis probe using in vitro transcription RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and porcine influenza virus, and positive recombinant plasmid DNA of Actinobacillus pleuropneumoniae, pasteurella multocida, haemophilus parasuis, and porcine circovirus type 2 as templates.

M:1000bp DNA marker, lane 1: taking recombinant plasmid DNA of haemophilus parasuis as a template, taking RNA transcribed in vitro of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus and swine influenza virus, and positive recombinant plasmid DNA of porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida and porcine circovirus type 2 as templates for Lane2, 3, 4, 5, 6 and 7 respectively, and NC: no template control.

FIG. 9 is a capillary electrophoresis gel diagram of MLPA detection with porcine circovirus type 2 probe, using in vitro transcription RNA of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus, and porcine influenza virus, and positive recombinant plasmid DNA of porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, haemophilus parasuis, and porcine circovirus type 2 as templates, respectively.

M:1000bp DNA marker, lane 1: porcine circovirus type 2 recombinant plasmid DNA is taken as a template, lane2, lane 3, lane 4, lane 5, lane 6 and Lane 7 are respectively taken as templates of porcine reproductive and respiratory syndrome virus, porcine respiratory coronavirus and porcine influenza virus in-vitro transcription RNA, and porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida and haemophilus parasuis positive recombinant plasmid DNA, NC: no template control.

Detailed Description

The multiplex ligation-dependent probe amplification (MLPA) is a new technology for qualitative and quantitative analysis of target sequence in nucleic acid to be detected with high throughput. The technology combines the hybridization detection of nucleic acid and PCR chain amplification, thereby realizing the high-efficiency specific analysis of target molecules, and detecting and quantitatively analyzing 60 different target genes in the same reaction tube. The basic principle of MLPA includes hybridization between probe and target sequence DNA, connection, PCR amplification, separation of product by capillary electrophoresis and data collection, and analysis of the collected data by DNA analysis software. Each MLPA probe comprises two oligonucleotide fragments, one chemically synthesized and one prepared by M13 phage derivation; each probe comprises a primer sequence and a specific sequence. In the MLPA reaction, both oligonucleotide fragments hybridize to the target sequence, followed by ligation of the two part probes using ligase. The ligation reaction is highly specific, and only when the two probes are completely hybridized with the target sequence, namely the target sequence is completely complementary with the probe specific sequence, the ligase can connect the two probes into a complete nucleic acid single chain; on the other hand, if the target sequence is not completely complementary to the probe sequence, hybridization will be incomplete even if there is a single base difference, and the ligation reaction will not proceed. After the ligation reaction is completed, the ligated probes are amplified with a pair of universal primers, the length of the amplification product of each pair of probes is unique, and for chemically synthesized probes, the range is 90-150 bp. Finally, separating the amplified product by capillary electrophoresis, and analyzing by software to obtain a conclusion.

The invention establishes the MLPA differential detection method which has strong specificity, high sensitivity and good repeatability and can simultaneously detect 7 pathogens causing the porcine respiratory disease, and provides a high-throughput detection technology for differential diagnosis and emergency diagnosis of the pathogens.

At least 6000 copies of the target DNA are required for a standard MLPA reaction. In order to improve the sensitivity of detecting pathogens, the invention improves the pathogens and introduces a pre-amplification step. The lower limit of detection is increased by reverse transcribing the RNA to cDNA and pre-amplifying the target DNA using PCR. Primers and probes were designed against the most conserved genes of the virus, sequences were obtained from GenBank and sequence alignments were performed with MUSCLE Alignment (Geneius 8.1.4) to determine the most conserved regions in each gene. Primers were designed using Primer3 (sequences see table 1) for specific reverse transcription and pre-amplification, and the fragments amplified by these primers contained the region to which the MLPA probe bound. The probe design was performed according to the protocol published by MRC-Holland (design synthetic MLPA probes, version 04). The probes are respectively combined with the most conserved regions (the sequence is shown in a table 2) in the M gene of the porcine reproductive and respiratory syndrome virus, the ApxIVA gene of the actinobacillus pleuropneumoniae, the toxA gene of the pasteurella multocida, the S gene of the porcine respiratory coronavirus, the M gene of the swine influenza virus, the 16S rRNA gene of the haemophilus parasuis and the ORF2 gene of the porcine circovirus type 2, and finally a pair of universal primers for PCR amplification is designed (the sequence is shown in a table 3). The left probe consists of two sections of nucleotides, one section is a universal primer for PCR amplification, and the other section is a virus specific sequence (LHS); the right probe consists of two sections of nucleotides, one section is a virus specific sequence (RHS), the other section is a universal primer for PCR amplification, and the 5' end of the right probe is subjected to phosphorylation treatment. Different pathogens are distinguished by designing probes of different lengths. All primers and probes were blast analyzed in the NCBI database to ensure primer and probe specificity. PCR products with different sizes are obtained through template denaturation, probe hybridization, connection and PCR amplification of universal primers, and the simultaneous detection of 7 pathogens is realized through analysis of a full-automatic nucleic acid analyzer.

TABLE 1 Pre-amplification names and sequences for porcine reproductive and respiratory syndrome Virus, actinobacillus pleuropneumoniae, pasteurella multocida, porcine respiratory coronavirus, porcine influenza Virus, haemophilus parasuis, and porcine circovirus type 2

TABLE 2 porcine reproductive and respiratory syndrome Virus, porcine Actinobacillus pleuropneumoniae, porcine Pasteurella multocida, porcine respiratory coronavirus, porcine influenza Virus, haemophilus parasuis and porcine circovirus type 2 left and right probe names and sequences

Wherein, the SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22,

the amino acid sequence of SEQ ID NO:24, SEQ ID NO:26 and SEQ ID NO:28, carrying out phosphorylation treatment on the 5' end;

TABLE 3 Universal primer sequences

/>

The invention adopts a multiple connection probe amplification technology to establish a detection method for simultaneously detecting porcine reproductive and respiratory syndrome virus, porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, porcine respiratory coronavirus, porcine influenza virus, haemophilus parasuis and porcine circovirus type 2 and assemble a kit.

The multiplex ligation-dependent probe amplification detection kit for detecting porcine reproductive and respiratory syndrome virus, porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, porcine respiratory coronavirus, porcine influenza virus, haemophilus parasuis and porcine circovirus type 2 consists of the following components:

(1) A pre-amplification primer mixed solution, which comprises reverse transcription and pre-amplification primers of porcine reproductive and respiratory syndrome virus, porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, porcine respiratory coronavirus, porcine influenza virus, haemophilus parasuis and porcine circovirus type 2, wherein the sequences of the primers are shown in table 1, and the concentration of each primer in the mixed solution is 0.25 mu M;

(2) A probe mixture comprising left and right probes for detecting porcine reproductive and respiratory syndrome virus, porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, porcine respiratory coronavirus, porcine influenza virus, haemophilus parasuis and porcine circovirus type 2, the probes having the sequences shown in table 2, wherein the sequences of SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26 and SEQ ID NO:28, carrying out phosphorylation treatment on the 5' end; the concentration of each probe in the mixture was 1.33nM;

(3) MLPA buffer solution;

(4) Connecting a buffer solution A;

(5) Connecting a buffer solution B;

(6) Ligase Ligase-65;

(7) A PCR reaction mixture comprising SEQ ID NO:30, a universal primer;

(8) SALSA polymerase;

(9) Negative control: TE;

(10) Positive control: the gene in vitro transcription RNA is the M gene of porcine reproductive and respiratory syndrome virus, the S gene of porcine respiratory coronavirus and the in vitro transcription RNA of the M gene of porcine influenza virus, and the positive recombination plasmid DNA is the positive recombination plasmid DNA of the ApxIVA gene of porcine actinobacillus pleuropneumoniae, the toxA gene of porcine pasteurella multocida, the 16S rRNA gene of haemophilus parasuis and the ORF2 gene of porcine circovirus type 2.

Preparing in vitro transcription RNA of the porcine reproductive and respiratory syndrome virus M gene: through sequence comparison in a database, a sequence of 269bp which is relatively conserved in the porcine reproductive and respiratory syndrome virus M gene is selected for in vitro gene synthesis, and is cloned to a pUC57 vector (purchased from Promega corporation) and named as pUC-PRRSV. Using purified plasmid as template, linearizing the plasmid with MluI enzyme, performing in vitro transcription with MEGAscript T7 kit of Ambion company, precipitating the in vitro transcription product with LiCl, washing with 70% ethanol, and dissolving in RNase-free ddH ₂ In O, nucleic acid electrophoresis was used to check the integrity and correctness of RNA synthesis and to determine the RNA concentration. The RNA transcribed in vitro by the porcine reproductive and respiratory syndrome virus M gene is named as PRRSV-M-RNA. The porcine reproductive and respiratory syndrome virus M gene is shown as SEQ ID NO: shown at 31.

Preparation of porcine actinobacillus pleuropneumoniae ApxIVA gene positive recombinant plasmid: through sequence comparison in a database, a sequence of 223bp which is relatively conserved in a porcine actinobacillus pleuropneumoniae ApxIVA gene is selected for in vitro gene synthesis, and the sequence is cloned to a pUC57 vector (purchased from Promega company) and named as pUC-APP. The porcine actinobacillus pleuropneumoniae ApxIVA gene is shown as SEQ ID NO: as shown at 32.

Preparation of positive recombinant plasmid of porcine pasteurella multocida toxA gene: through sequence comparison in a database, a relatively conserved 280bp sequence in a porcine pasteurella multocida toxA gene is selected for in vitro gene synthesis and cloned to a pUC57 vector (purchased from Promega corporation) which is named as pUC-PM. The gene of the porcine pasteurella multocida toxA is shown as SEQ ID NO: shown at 33.

Preparation of porcine respiratory coronavirus S gene in vitro transcription RNA: through sequence comparison in a database, a relatively conserved 310bp sequence in the porcine respiratory coronavirus S gene is selected for in vitro gene synthesis and cloned to a pUC57 vector (purchased from Promega corporation) which is named as pUC-PRCV-S. Using purified plasmid as template, linearizing the plasmid with MluI enzyme, performing in vitro transcription with MEGAscript T7 kit from Ambion company, precipitating the in vitro transcription product with LiCl, washing with 70% ethanol, and dissolving in RNase-free ddH ₂ In O, nucleic acid electrophoresis was used to check the integrity and correctness of RNA synthesis and to determine the RNA concentration. The RNA transcribed in vitro from the S gene of the porcine respiratory coronavirus is named as PRCV-S-RNA. The porcine respiratory coronavirus S gene is shown as SEQ ID NO: shown at 34.

Preparation of swine influenza virus M gene in vitro transcription RNA: a349 bp sequence which is relatively conserved in swine influenza virus M gene is selected for in vitro gene synthesis through sequence comparison in a database, and is cloned to a pUC57 vector (purchased from Promega corporation) and named as pUC-SIV-M. Using purified plasmid as template, linearizing the plasmid with MluI enzyme, performing in vitro transcription with MEGAscript T7 kit from Ambion company, precipitating the in vitro transcription product with LiCl, washing with 70% ethanol, and dissolving in RNase-free ddH ₂ In O, nucleic acid electrophoresis was used to check the integrity and correctness of RNA synthesis and to determine RNA concentration. The RNA transcribed in vitro from the swine influenza virus M gene is named SIV-M-RNA. The swine influenza virus M gene is shown as SEQ ID NO: shown at 35.

Preparation of a Haemophilus parasuis 16s rRNA gene positive recombinant plasmid: through sequence comparison in a database, a sequence of 338bp which is relatively conserved in a haemophilus parasuis 16s rRNA gene is selected for in vitro gene synthesis, and the sequence is cloned to a pUC57 vector (purchased from Promega company) and named as pUC-HPS-16s. The haemophilus parasuis 16s rRNA gene is shown as SEQ ID NO: shown at 36.

Preparation of porcine circovirus type 2 ORF2 gene positive recombinant plasmid: through sequence alignment in a database, a relatively conserved 312bp sequence in the porcine circovirus type 2 ORF2 gene is selected for in vitro gene synthesis and cloned into a pUC57 vector (purchased from Promega corporation) which is named as pUC-PCV2-ORF2. The porcine circovirus type 2 ORF2 gene sequence is shown as SEQ ID NO: shown at 37.

The invention provides a multiplex ligation probe amplification detection method for simultaneously detecting porcine reproductive and respiratory syndrome virus, porcine actinobacillus pleuropneumoniae, porcine pasteurella multocida, porcine respiratory coronavirus, porcine influenza virus, haemophilus parasuis and porcine circovirus type 2, which comprises the following specific operation processes:

1. extracting DNA/RNA of a sample by a magnetic bead method;

DNA and RNA in the sample were simultaneously extracted using a magnetic bead DNA/RNA co-extraction kit from TIANGEN, using a Tianlong NP968 full-automatic nucleic acid extractor, to give 100. Mu.L of the sample.

Reverse transcription of RNA into cDNA and Pre-amplification

The one-step reverse transcription RT-PCR reaction was performed according to the QIAGEN OneStep Ahead RT-PCR Kit instructions. Prepare 25 μ L reaction system: mu.L of OnESTep Ahead RT-PCR Master Mix, 1. Mu.L of OnESTep Ahead RT-Mix, 5. Mu.L of DNA or RNA, 5. Mu.L of Q-solution, 1. Mu.L of pre-amplification primer mixture (final concentration of 0.25. Mu.M per primer), 3. Mu.L of H ₂ And (4) complementing O. Reaction conditions are as follows: 10min at 50 ℃ and 5min at 95 ℃; 1, 10 cycles of 95 ℃, 15s,55 ℃, 20s,72 ℃ and 30 cycles; 72 ℃ for 2min.

MLPA detection

1) Denaturation of DNA

0.2mL of PCR reaction tube was taken, 0.5. Mu.L of DNA solution and 4.5. Mu.L of TE were added to each tube, denatured at 98 ℃ for 5min, and cooled to room temperature of 25 ℃.

2) Hybridization of the Probe with sample DNA

Preparing 3 mu L of mixed probe liquid: mu.L MLPA buffer + 1.5. Mu.L probe mix. The probe mixture was added to the PCR tube described above, incubated at 95 ℃ for 1min, hybridized at 60 ℃ for 1-1697 h, and incubated at 54 ℃.

3) Ligation of hybridization probes

Prepare 32. Mu.L ligase mixture：25μL dH ₂ O + 3. Mu.L ligation buffer A + 3. Mu.L ligation buffer B +1. Mu.L Ligase Ligase-65. The temperature of the PCR instrument was lowered to 54 deg.C, the lid was opened, 32. Mu.L of the ligase mixture was added, incubated at 54 deg.C for 15min, heated at 98 deg.C for 5min to inactivate the ligase, and incubated at 20 deg.C.

4) PCR amplification of ligated probes

Prepare 10 μ L of PCR mix: 7.5 μ L dH ₂ O + 2. Mu.L of PCR reaction mix + 0.5. Mu.L of SALSA polymerase. The PCR tube was removed and 10. Mu.L of the PCR mixture was added at room temperature. The PCR reaction was started under the following conditions: 30s at 95 ℃, 30s at 60 ℃, 60s at 72 ℃ and 35 cycles; incubating at 72 deg.C for 20min, and cooling to 15 deg.C.

5) Analysis by a full-automatic nucleic acid analyzer:

the PCR amplification product was analyzed by a fully automatic nucleic acid Analyzer (Qsep 100 DNA Analyzer).

4. Result description and determination

1) Quality control standard:

the positive control has specific amplification bands at 94bp, 98bp, 112bp, 116bp, 122bp, 130bp and 140 bp.

Negative control no specific amplified band.

If the negative control and the positive condition do not satisfy the above conditions, the test is regarded as invalid.

2) And (4) judging a result:

positive: a specific amplification strip is arranged at 94bp, which indicates that porcine reproductive and respiratory syndrome virus nucleic acid exists in the sample; a specific amplification band exists at a position of 98bp, which indicates that the actinobacillus pleuropneumoniae nucleic acid exists in the sample; a specific amplification band at 112bp indicates that the swine pasteurella multocida nucleic acid exists in the sample; a specific amplification band exists at a position of 116bp, which indicates that the porcine respiratory coronavirus nucleic acid exists in the sample; a specific amplification strip exists at 122bp, which indicates that swine influenza virus nucleic acid exists in the sample; a specific amplification band exists at a position of 130bp, which indicates that Haemophilus parasuis nucleic acid exists in the sample; a specific amplification band exists at a position of 140bp, which indicates that the porcine circovirus type 2 nucleic acid exists in the sample; the MLPA amplification product can be sequenced and further confirmed;

negative: and (3) no specific amplification band indicates that the sample does not contain porcine reproductive and respiratory syndrome virus nucleic acid, porcine actinobacillus pleuropneumoniae nucleic acid, porcine pasteurella multocida nucleic acid, porcine respiratory coronavirus nucleic acid, porcine influenza virus nucleic acid, haemophilus parasuis nucleic acid and porcine circovirus type 2 nucleic acid.

The present invention will be described in detail with reference to specific examples.

1. Use of the kit

1 composition of the kit

Among them, MLPA buffer, ligation buffer A, ligation buffer B, ligase Ligase-65 and SALSA polymerase were purchased from MRC-Holland, inc.

Storage conditions were as follows:

1) Except for the positive control, the other components were stored at-15 ℃ to-25 ℃. Positive controls were stored at-80 ℃.

2) In order to ensure the experimental effect, the kit product is used within one year.

2 method of use

2.1 extracting DNA/RNA of a sample by a magnetic bead method;

DNA and RNA in the sample were extracted simultaneously using a magnetic bead DNA/RNA co-extraction kit from TIANGEN, inc. and a fully automatic nucleic acid extractor, tianlong NP968, to give 100. Mu.L of sample.

2.2 Reverse transcription of RNA into cDNA and preamplification

The one-step reverse transcription RT-PCR reaction was performed according to the QIAGEN OneStep Ahead RT-PCR Kit instructions. Preparing 25 mu L of reaction system: mu.L of OnESTep Ahead RT-PCR Master Mix, 1. Mu.L of OnESTep Ahead RT-Mix, 5. Mu.L of DNA or RNA, 5. Mu.L of Q-solution, 1. Mu.L of pre-amplification primer mixture (final concentration of 0.25. Mu.M per primer), 3. Mu.L of H ₂ And O is complemented. The reaction conditions are as follows: 10min at 50 ℃ and 5min at 95 ℃; 1, 10 cycles of 95 ℃, 15s,55 ℃, 20s,72 ℃ and 30 cycles; 72 ℃ for 2min.

2.3 MLPA detection

2.3.1DNA denaturation

0.2mL of PCR reaction tube was taken, 0.5. Mu.L of DNA solution and 4.5. Mu.L of TE were added to each tube, denatured at 98 ℃ for 5min, and cooled to room temperature of 25 ℃.

2.3.2 hybridization of Probe to sample DNA

Preparing 3 mu L of mixed probe liquid: mu.L MLPA buffer + 1.5. Mu.L probe mix. The probe mixture was added to the PCR tube described above, incubated at 95 ℃ for 1min, hybridized at 60 ℃ for 1-1697 h, and incubated at 54 ℃.

2.3.3 ligation of hybridization probes

Prepare 32 μ L ligase mix: 25 μ L dH ₂ O + 3. Mu.L ligation buffer A + 3. Mu.L ligation buffer B +1. Mu.L Ligase Ligase-65. The PCR instrument temperature was lowered to 54 deg.C, the tube cap was opened, 32. Mu.L of the ligase mixture was added, the ligase was inactivated by incubation at 54 deg.C for 15min, heating at 98 deg.C for 5min, and incubation at 20 deg.C.

2.3.4 PCR amplification of ligation probes

Prepare 10. Mu.L of PCR mixture: 7.5 μ L dH ₂ O + 2. Mu.L of PCR reaction mix + 0.5. Mu.L of SALSA polymerase. The PCR tube was removed and 10. Mu.L of the PCR mixture was added at room temperature. The PCR reaction was started under the following conditions: 30s at 95 ℃, 30s at 60 ℃, 60s at 72 ℃ and 35 cycles; incubating at 72 deg.C for 20min, and cooling to 15 deg.C.

2.3.5 analysis by a full-automatic nucleic acid analyzer:

the PCR amplification product was analyzed by a fully automatic nucleic acid Analyzer (Qsep 100 DNA Analyzer).

2.4. Result description and determination

1) Quality control standard:

the positive control has specific amplification bands at 94bp, 98bp, 112bp, 116bp, 122bp, 130bp and 140 bp.

The negative control did not specifically amplify the band.

If the negative control and the positive condition do not satisfy the above conditions, the test is regarded as invalid.

2) And (5) judging a result:

positive: a specific amplification strip is arranged at 94bp, which indicates that porcine reproductive and respiratory syndrome virus nucleic acid exists in the sample; a specific amplification band exists at a position of 98bp, which indicates that the actinobacillus pleuropneumoniae nucleic acid exists in the sample; a specific amplification band at 112bp indicates that the swine pasteurella multocida nucleic acid exists in the sample; a specific amplification band exists at a position of 116bp, which indicates that the porcine respiratory coronavirus nucleic acid exists in the sample; a specific amplification strip exists at a position of 122bp, which indicates that swine influenza virus nucleic acid exists in a sample; a specific amplification band exists at a position of 130bp, which indicates that haemophilus parasuis nucleic acid exists in a sample; a specific amplification band exists at 140bp, which indicates that porcine circovirus type 2 nucleic acid exists in the sample; MLPA amplification products can be sequenced and further confirmed;

negative: and (3) no specific amplification band indicates that the sample does not contain porcine reproductive and respiratory syndrome virus nucleic acid, porcine actinobacillus pleuropneumoniae nucleic acid, porcine pasteurella multocida nucleic acid, porcine respiratory coronavirus nucleic acid, porcine influenza virus nucleic acid, haemophilus parasuis nucleic acid and porcine circovirus type 2 nucleic acid.

Note that:

1) DNA sample:

a. the contents of salt ions, alcohols and the like in the DNA solution are reduced as much as possible.

b. TE is used for dissolving or diluting DNA instead of water, so that depurination of DNA at high temperature is avoided.

c. All DNA samples were diluted to approximately equal concentrations (20-40 ng/ul suggested) prior to the experiment.

2) The probe, the Ligase Ligase-65, the connection buffer solution A and the connection buffer solution B are separately packaged before use, so that repeated freeze thawing is avoided;

3) Before the buffer solution and the reagent are used, the buffer solution and the reagent are vibrated, uniformly mixed and centrifuged, and the buffer solution and the reagent are lightly blown and uniformly mixed by a gun head during mixing, so that bubbles are prevented from being generated or the buffer solution and the reagent are beaten on the tube wall, and all enzyme-containing steps cannot be centrifuged;

4) When the ligase is added for reaction, the PCR tube is placed in a PCR instrument and is not taken out;

5) Evaporation quality control: 8 μ L TE/water blank connections, leaving at least 5 μ L of the tube bottom after completion of the connection.

6) Setting a full-automatic nucleic acid analyzer: the injection voltage and time are optimized, and the PCR product can be diluted by a diluent and then loaded, so that the signal is in the optimal analysis range.

2. Specificity of the kit

1 Material

RNA extract of porcine reproductive and respiratory syndrome virus, DNA extract of Actinobacillus pleuropneumoniae, DNA extract of Pasteurella multocida, RNA extract of porcine respiratory coronavirus, RNA extract of porcine influenza virus, DNA extract of Haemophilus parasuis and DNA extract of porcine circovirus type 2.

2 method

2.1 verifying the specificity of the probe by using a single pathogenic probe for RNA extract of porcine reproductive and respiratory syndrome virus, DNA extract of porcine actinobacillus pleuropneumoniae, DNA extract of porcine pasteurella multocida, RNA extract of porcine respiratory coronavirus, RNA extract of porcine influenza virus, DNA extract of haemophilus parasuis and DNA extract of porcine circovirus type 2.

2.2 the mixed seven pathogeny probes are used for respectively carrying out MLPA detection on the RNA extract of the porcine reproductive and respiratory syndrome virus, the DNA extract of the porcine actinobacillus pleuropneumoniae, the DNA extract of the porcine pasteurella multocida, the RNA extract of the porcine respiratory coronavirus, the RNA extract of the porcine influenza virus, the DNA extract of the haemophilus parasuis and the DNA extract of the porcine circovirus type 2, and the specificity of the probes is verified.

3 results of

3.1 any group of designed probes is used for detection, and only a band with a corresponding size can be amplified from a corresponding pathogen template, which indicates that the specificity of the probes is good.

3.2 the MLPA detection is carried out on the virus template by using the probes mixed with seven pathogens respectively, and only the bands with corresponding sizes can be amplified from the corresponding pathogen template, which indicates that the established method has good specificity.

3. Sensitivity of the kit

1 materials

Contains a positive recombinant plasmid of a porcine reproductive and respiratory syndrome virus M gene, a porcine actinobacillus pleuropneumoniae ApxIVA gene, a porcine pasteurella multocida toxA gene, a porcine respiratory coronavirus S gene, a porcine influenza virus M gene, a haemophilus parasuis 16S rRNA gene and a porcine circovirus type 2 ORF2 gene.

2 method

2.1 construction of plasmids and in vitro transcription of RNA

Preparing in vitro transcription RNA of the porcine reproductive and respiratory syndrome virus M gene: through sequence comparison in a database, a sequence of 269bp which is relatively conserved in the porcine reproductive and respiratory syndrome virus M gene is selected for in vitro gene synthesis, and is cloned to a pUC57 vector (purchased from Promega corporation) and named as pUC-PRRSV. Using purified plasmid as template, linearizing the plasmid with MluI enzyme, performing in vitro transcription with MEGAscript T7 kit of Ambion company, precipitating the in vitro transcription product with LiCl, washing with 70% ethanol, and dissolving in RNase-free ddH ₂ In O, nucleic acid electrophoresis was used to check the integrity and correctness of RNA synthesis and to determine RNA concentration. The RNA transcribed in vitro by the porcine reproductive and respiratory syndrome virus M gene is named as PRRSV-M-RNA. The porcine reproductive and respiratory syndrome virus M gene is shown as SEQ ID NO: shown at 31.

SEQ ID NO：31

PRRSV

GTACAAATAAGGTCGCGCTCACTATGGGAGCAGTAGTTGCACTCCTTTGGGGGGTGTACTCAGCCATAGAAACCTGGAAATTCATCACCTCCAGATGCCGTTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTTGAAAGTGCCGCAGGCTTTCATCCGATTGCGGCAAATGATAACCACGCATTTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACATTGGTGCCCGGGTTGAAAAGCCTCGTGTTG

Preparation of porcine actinobacillus pleuropneumoniae ApxIVA gene positive recombinant plasmid: through sequence comparison in a database, a sequence of 223bp which is relatively conserved in a porcine actinobacillus pleuropneumoniae ApxIVA gene is selected for in vitro gene synthesis, and the sequence is cloned to a pUC57 vector (purchased from Promega company) and named as pUC-APP. The porcine actinobacillus pleuropneumoniae ApxIVA gene is shown as SEQ ID NO: as shown at 32.

SEQ ID NO：32

APP

GTGCGGGTAATGATACGGTTAATGGCGGTAATGGCGATGACACCCTCATCGGCGGCAAAGGTAATGATATTCTAAGAGGTGGCTACGGTGCGGACACCTATATCTTTAGCAAAGGACACGGACAGGATATCGTTTATGAAGATACCAATAATGATAACCGCGCAAGAGATATCGACACCTTAAAATTTACTGATATTAATTTATCCGAACTTTGGTTTAGCCG

Preparation of positive recombinant plasmid of porcine pasteurella multocida toxA gene: through sequence comparison in a database, a relatively conserved 280bp sequence in a porcine pasteurella multocida toxA gene is selected for in vitro gene synthesis and cloned to a pUC57 vector (purchased from Promega corporation) which is named as pUC-PM. The gene of the porcine pasteurella multocida toxA is shown as SEQ ID NO: shown at 33.

SEQ ID NO：33

PM

ATGCCAACAATTAATCAAAGTGCATTAGTGCCTTATAGTGCTGCACAAATGTATCAATTAGTGAATAATTATGAACGTTATCCTGAATTTGTACCGGGCTGTGTGAATGGGCGTACCTTGACCCAAAATGGTAATGAATTAACGGCGGAACTGGTGATTTCAAAAGCGGGCATTCGCCAGCAATTTACGACTCGCAATCAAATGGTGGAGAACCGTTCGATCAAAATGCAATTGGTGGAAGGTCCCTTTCGTTTTTTGCAAGGGGAATGGCAATTTGATG

Preparing in vitro transcription RNA of the S gene of the porcine respiratory coronavirus: through sequence comparison in a database, a relatively conserved 310bp sequence in the porcine respiratory coronavirus S gene is selected for in vitro gene synthesis and cloned to a pUC57 vector (purchased from Promega corporation) which is named as pUC-PRCV-S. Using purified plasmid as template, linearizing the plasmid with MluI enzyme, performing in vitro transcription with MEGAscript T7 kit of Ambion company, precipitating the in vitro transcription product with LiCl, washing with 70% ethanol, and dissolving in RNase-free ddH ₂ In O, nucleic acid electrophoresis was used to check the integrity and correctness of RNA synthesis and to determine the RNA concentration. The RNA transcribed in vitro from the S gene of the porcine respiratory coronavirus is named as PRCV-S-RNA. The porcine respiratory coronavirus S gene is shown as SEQ ID NO: shown at 34.

SEQ ID NO：34

PRCV

ATTATTACTAGCGCAGTTGATTGTGCTAGTAGTTATACCAGTGAAATAAAGTGTAAGACTCAAAGTATGAATCCCAATACGGGAGTCTATGATTTATCCGGTTACACCGTCCAACCTGTAGGACTAGTGTACCGGCGTGTTAGAAATTTGCCTGATTGTAAAATTGAGGAATGGCTTGCTGCTAACACAGTACCCTCTCCTCTCAATTGGGAGCGCAAAACATTTCAAAATTGTAACTTCAACCTGAGCAGTCTATTAAGATTTGTTCAGGCTGAGTCACTCTCATGTAGTAATATAGATGCTTCCAAGG

Preparation of swine influenza virus M gene in vitro transcription RNA: by sequence ratios in databasesIn contrast, a sequence of 349bp which is relatively conserved in the swine influenza virus M gene is selected for in vitro gene synthesis and cloned into a pUC57 vector (purchased from Promega corporation) and named as pUC-SIV-M. Using purified plasmid as template, linearizing the plasmid with MluI enzyme, performing in vitro transcription with MEGAscript T7 kit of Ambion company, precipitating the in vitro transcription product with LiCl, washing with 70% ethanol, and dissolving in RNase-free ddH ₂ In O, nucleic acid electrophoresis was used to check the integrity and correctness of RNA synthesis and to determine the RNA concentration. The RNA transcribed in vitro from the swine influenza virus M gene is named SIV-M-RNA. The swine influenza virus M gene is shown as SEQ ID NO: shown at 35.

SEQ ID NO：35

SIV

TCGGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTCTTTGCAGGGAAGAACACCGATCTCGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGGTTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGGAAATGGAGATCCAAACAACATGGATAGGGCAGTTAAACTATACAGGAAACTGAAAAGAGAGATAACATTCCATGGGGCTAAGGAGGTCGCACTCAGCTACTCAACCGGTGCACTTGCCAGTTGTATGGGTCTCATATACA

Preparation of a Haemophilus parasuis 16s rRNA gene positive recombinant plasmid: through sequence comparison in a database, a relatively conserved 338bp sequence in a haemophilus parasuis 16s rRNA gene is selected for in vitro gene synthesis and cloned to a pUC57 vector (purchased from Promega corporation) which is named as pUC-HPS-16s. The 16s rRNA gene of the haemophilus parasuis is shown as SEQ ID NO: as shown at 36.

SEQ ID NO：36

HPS

TTTTAGGGAGGGGTAGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAATACCGAAGGCGAAGGCAGCCCCTTGGGAAAATACTGACGCTCATGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGCTGTCGATTTGGGGATTGGGCTTTATGTTTGGTGCCCGTAGCTAACGTGATAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATC

Preparation of porcine circovirus type 2 ORF2 gene positive recombinant plasmid: through sequence alignment in a database, a relatively conserved 312bp sequence in the porcine circovirus type 2 ORF2 gene is selected for in vitro gene synthesis and cloned into a pUC57 vector (purchased from Promega corporation) which is named as pUC-PCV2-ORF2. The porcine circovirus type 2 ORF2 gene sequence is shown as SEQ ID NO: shown at 37.

SEQ ID NO：37

PCV2

GAATAAGAAAGGTTAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAGTTGGATCCAGTGCTATTATTCTAGATGACAACTTTGTAATAAAGGCCACAGCCCAAACCTATGACCCCTATGTAAACTACTCCTCCCGCCATACAATCCCCCAACCCTTCTCCTACCACTCCCGTTACTTCACACCCAAACCTGTTCTTGATTCCACTATTGATTACTTCCAACCAAATAACAAAAGGAATCAGCTGTGGATGAGACTACAAACCAGTAGAAATGTGGACCACGTAGGCCTCGGCACTG

2.2 sensitivity verification

In vitro transcribed RNA or recombinant plasmid DNA from 10 using TE buffer ^-1 To 10 ^-11 A two-fold dilution was performed, followed by the MLPA reaction.

3 results

The method can detect 33.7 copies of porcine reproductive and respiratory syndrome virus RNA, 4.56 copies of porcine actinobacillus pleuropneumoniae DNA, 32.57 copies of porcine pasteurella multocida DNA, 29.42 copies of porcine respiratory coronavirus RNA, 26.14 copies of porcine influenza virus RNA, 26.99 copies of haemophilus parasuis DNA and 29.23 copies of porcine circovirus type 2 DNA at the lowest.

It is emphasized that the present invention provides only one multiplex ligation probe amplification method for detecting 7 pathogenic nucleic acids capable of causing respiratory diseases in swine. However, even if the presence of a pathogen is detected, the presence of the corresponding disease in the test subject cannot be directly judged. The diagnosis conclusion of whether the detected object has the disease needs to be judged by combining various factors such as epidemiology, pathological detection and the like. The detection method of the invention can only provide detection experimental data for reference in diagnosis, and the experimental data can not directly provide a conclusion whether a detected object is diseased or not.

Claims (3)

1. A multiple connection probe amplification discrimination kit capable of detecting various porcine respiratory pathogens is characterized by comprising:

(1) Pre-amplifying primer mixed liquor;

the mixed solution comprises a pre-amplification primer, and the sequence of the pre-amplification primer is shown as SEQ ID NO:1 to 14;

(2) Probe mixed liquid;

the mixed solution comprises a left probe and a right probe, and the sequences of the probes are shown as SEQ ID NO:15 to 28;

(3) MLPA buffer solution;

(4) Connecting a buffer solution A;

(5) Connecting a buffer solution B;

(6) Ligase Ligase-65;

(7) A PCR reaction mixture comprising a sequence as set forth in SEQ ID NO:29 and 30;

(8) SALSA polymerase;

(9) Negative control;

(10) A positive control;

in the pre-amplification primers of the pre-amplification primer mixture: sequence SEQ ID NO:1 and the sequence SEQ ID NO:2 are respectively a forward primer and a reverse primer of porcine reproductive and respiratory syndrome virus pre-amplification; sequence SEQ ID NO:3 and the sequence SEQ ID NO:4 are forward and reverse primers for preamplification of Actinobacillus pleuropneumoniae, respectively; sequence SEQ ID NO:5 and the sequence SEQ ID NO:6 are respectively a forward primer and a reverse primer of porcine pasteurella multocida pre-amplification; sequence SEQ ID NO:7 and SEQ ID NO:8 are respectively the forward and reverse primers of porcine respiratory coronavirus pre-amplification; sequence SEQ ID NO:9 and SEQ ID NO:10 are forward and reverse primers for pre-amplification of swine influenza virus, respectively; sequence SEQ ID NO:11 and SEQ ID NO:12 are respectively the forward and reverse primers for the pre-amplification of haemophilus parasuis; sequence SEQ ID NO:13 and SEQ ID NO:14 are forward and reverse primers for porcine circovirus type 2 pre-amplification, respectively;

in the probe of the probe mixture solution: sequence SEQ ID NO:15 and SEQ ID NO:16 are a left side probe and a right side probe for detecting porcine reproductive and respiratory syndrome virus, respectively; sequence SEQ ID NO:17 and SEQ ID NO:18 are a left side probe and a right side probe for detecting the actinobacillus pleuropneumoniae respectively; sequence SEQ ID NO:19 and SEQ ID NO:20 are respectively a left side probe and a right side probe for detecting the swine pasteurella multocida; sequence SEQ ID NO:21 and SEQ ID NO:22 are a left side probe and a right side probe for detecting the porcine respiratory coronavirus respectively; sequence SEQ ID NO:23 and SEQ ID NO:24 are a left side probe and a right side probe for detecting swine influenza virus respectively; sequence SEQ ID NO:25 and SEQ ID NO:26 are a left side probe and a right side probe for detecting haemophilus parasuis respectively; sequence SEQ ID NO:27 and SEQ ID NO:28 are a left side probe and a right side probe for detecting porcine circovirus type 2 respectively;

in the primer of the PCR reaction mixture, the sequence of SEQ ID NO:29 and SEQ ID NO:30 are universal forward and reverse primers, respectively;

wherein, the sequence SEQ ID NO: 16. SEQ ID NO: 18. SEQ ID NO: 20. the amino acid sequence of SEQ ID NO: 22. SEQ ID NO: 24. SEQ ID NO:26 and SEQ ID NO:28, carrying out phosphorylation treatment on the 5' end;

the positive control is a mixture of in vitro transcribed RNA of the gene and positive recombinant plasmid DNA; the in vitro transcription RNA of the gene is the in vitro transcription RNA of the M gene of porcine reproductive and respiratory syndrome virus, the S gene of porcine respiratory coronavirus and the M gene of porcine influenza virus, and the positive recombinant plasmid DNA refers to the positive recombinant plasmid DNA of the ApxIVA gene of porcine actinobacillus pleuropneumoniae, the toxA gene of porcine pasteurella multocida, the 16S rRNA gene of haemophilus parasuis and the ORF2 gene of porcine circovirus type 2.

2. The method for simultaneously detecting multiple porcine respiratory pathogens by using the kit of claim 1 to realize the amplification of the multiple ligation probes for the purpose of non-disease detection, which is characterized by comprising the following steps:

(1) Extracting DNA/RNA of a sample by a magnetic bead method;

simultaneously extracting DNA and RNA in a sample by using a magnetic bead DNA/RNA co-extraction kit and a full-automatic nucleic acid extractor to obtain a 100 mu L sample;

(2) Reverse transcription of RNA into cDNA and Pre-amplification

Carrying out one-step reverse transcription RT-PCR reaction;

prepare 25 μ L reaction system: 10 μ L of OneStep Ahead RT-PCR MasterMix, 1. Mu.L of OneStep Ahead RT-Mix, 5. Mu.L of DNA or RNA, 5. Mu.L of Q-solution, 1. Mu.L of pre-amplification primer Mix (final concentration of 0.25. Mu.M per primer), 3. Mu.L of H ₂ O is complemented; reaction conditions are as follows: 10min at 50 ℃ and 5min at 95 ℃; 1, 10 cycles of 95 ℃, 15s,55 ℃, 20s,72 ℃ and 30 cycles; 2min at 72 ℃;

(3) MLPA detection

a. Denaturation of DNA

Taking 0.2mL PCR reaction tubes, adding 0.5 mu L DNA solution and 4.5 mu L TE into each tube, denaturing at 98 ℃ for 5min, and cooling to room temperature of 25 ℃;

b. hybridization of the Probe with sample DNA

Preparing 3 mu L of mixed probe liquid: 1.5. Mu.L MLPA buffer + 1.5. Mu.L probe mixture; adding the probe mixture into the PCR tube, incubating at 95 deg.C for 1min, hybridizing at 60 deg.C for 1-1697 h, and incubating at 54 deg.C;

c. ligation of hybridization probes

Prepare 32 μ L ligase mix: 25 μ L dH ₂ O + 3. Mu.L of a ligation buffer A + 3. Mu.L of a ligation buffer B +1. Mu.L of Ligase Ligase-65; cooling the temperature of the PCR instrument to 54 ℃, opening a tube cover, adding 32 mu L of ligase mixture, incubating at 54 ℃ for 15min, heating at 98 ℃ for 5min to inactivate the ligase, and incubating at 20 ℃;

d. PCR amplification of ligated probes

Prepare 10 μ L of PCR mix: 7.5 μ L dH ₂ O + 2. Mu.L PCR reaction mix + 0.5. Mu.L SALSA polymerase; taking out the PCR tube, and adding 10 mu L of PCR mixture at room temperature; the PCR reaction was started under the following conditions: 30s at 95 ℃, 30s at 60 ℃, 60s at 72 ℃ and 35 cycles; incubating at 72 deg.C for 20min, and cooling to 15 deg.C;

e. analysis by a full-automatic nucleic acid analyzer:

taking a PCR amplification product, and analyzing by using a full-automatic nucleic acid analyzer;

(4) Result description and determination

a. Quality control standard:

the positive control has specific amplification bands at 94bp, 98bp, 112bp, 116bp, 122bp, 130bp and 140 bp;

negative control no specific amplification band;

if the negative control and the positive condition do not satisfy the above conditions, the test is regarded as invalid;

b. and (5) judging a result:

positive: a specific amplification strip exists at the position of 94bp, which indicates that the porcine reproductive and respiratory syndrome virus nucleic acid exists in the sample; a specific amplification strip exists at the position of 98bp, which indicates that the actinobacillus pleuropneumoniae nucleic acid exists in the sample; a specific amplification band at 112bp indicates that the swine pasteurella multocida nucleic acid exists in the sample; a specific amplification band exists at 116bp, which indicates that the porcine respiratory coronavirus nucleic acid exists in the sample; a specific amplification strip exists at a position of 122bp, which indicates that swine influenza virus nucleic acid exists in a sample; a specific amplification band exists at a position of 130bp, which indicates that haemophilus parasuis nucleic acid exists in a sample; a specific amplification band exists at a position of 140bp, which indicates that the porcine circovirus type 2 nucleic acid exists in the sample;

negative: and (3) no specific amplification band indicates that the sample does not contain porcine reproductive and respiratory syndrome virus nucleic acid, porcine actinobacillus pleuropneumoniae nucleic acid, porcine pasteurella multocida nucleic acid, porcine respiratory coronavirus nucleic acid, porcine influenza virus nucleic acid, haemophilus parasuis nucleic acid and porcine circovirus type 2 nucleic acid.

3. The method according to claim 2, wherein the MLPA amplification product is sequenced when the result is judged, and the result is confirmed.

Images