CN115927661A - SNP molecular marker for identifying yellow skin traits of broiler chickens and application of SNP molecular marker in detection of yellow skin traits of broiler chickens - Google Patents

Abstract

The invention relates to an SNP molecular marker for identifying yellow skin traits of broiler chickens and application thereof in detecting the yellow skin traits of the broiler chickens, wherein the molecular marker is positioned on No. 24 chromosome of a chicken genome, and a nucleotide sequence is shown as SEQ 1; the molecular marker is positioned at the-104 th site, and the mutant base is C or G. The application comprises the following steps: step 1), extracting chicken genome DNA; step 2), designing specific amplification primers BCO2-F1 and BCO2-R1 aiming at BCO2 (G-104C), and then carrying out PCR amplification reaction by taking the DNA in the step 1) as a template to obtain a PCR product; wherein, the sequence of BCO2-F1 is shown as SEQ ID NO.2, and the sequence of BCO2-R1 is shown as SEQ ID NO.3; and 3) carrying out gene sequence sequencing on the PCR product obtained in the step 2), and judging the chicken skin color genotype through a gene sequencing sequence and a peak image. According to the invention, scientific basis is provided for purposefully selecting the properties of the yellow skin of the chicken, and the breeding population can be purified on the target yellow skin of the chicken through detection.

Description

SNP molecular marker for identifying yellow skin traits of broiler chickens and application of SNP molecular marker in detection of yellow skin traits of broiler chickens

Technical Field

The invention relates to an SNP molecular marker for identifying yellow skin traits of broiler chickens and application thereof in detecting the yellow skin traits of the broiler chickens, belonging to the technical field of zootechnics and molecular biology.

Background

For livestock and poultry, the skin color character is one of important variety characteristics. Market research shows that under the market environment of popularization of iced fresh chicken, the color of chicken skin influences the selection of people, and consumers in different regions have different preferences on the color of the chicken skin. In order to provide an accurate and efficient yellow skin breeding method, the method is one of the key problems to be solved urgently for poultry genetic resource protection.

SNPs (Single Nucleotide polymorphisms), called Single Nucleotide polymorphisms, are third generation genetic markers that are ubiquitous on all species genomic chromosomes. Researches find that SNP (single nucleotide polymorphism) positioned in a gene can directly influence the protein structure or the expression level, finally causes phenotypic difference, and can be used as an important molecular marker for the protection of genetic resources and the breeding of important economic traits.

Disclosure of Invention

The invention aims to provide an SNP molecular marker for identifying yellow skin traits of broilers and application thereof in detecting the yellow skin traits of the broilers, in particular to a method for accurately distinguishing yellow skin from non-yellow skin by adopting an SNP molecular marker technology, and the molecular marker is utilized to carry out specific identification on genetic resources of the broilers.

The purpose of the invention is realized as follows: an SNP molecular marker for identifying yellow skin traits of broiler chickens is characterized in that the molecular marker is positioned on a No. 24 chromosome of a chicken genome, and a nucleotide sequence is shown as SEQ 1; the molecular marker is positioned at the-104 th site, and the mutation base is C or G.

The SNP molecular marker for identifying the yellow skin character of the broiler chicken is applied to detecting the yellow skin character of the broiler chicken. The application is characterized by comprising the following steps:

step 1), extracting chicken genome DNA;

step 2), designing specific amplification primers BCO2-F1 and BCO2-R1 aiming at BCO2 (G-104C), and then carrying out PCR amplification reaction by taking the DNA in the step 1) as a template to obtain a PCR product; wherein, the sequence of BCO2-F1 is shown as SEQ ID NO.2, and the sequence of BCO2-R1 is shown as SEQ ID NO.3;

SEQ ID NO.2:GCCGTGAGCAGCACAGCG；

SEQ ID NO.3:TTCACACCGAAGCCTCCGTAAA；

and 3) carrying out gene sequence sequencing on the PCR product obtained in the step 2), and judging the chicken skin color genotype through a gene sequencing sequence and a peak image.

In the step 1), the genome DNA of the biological test material of the individual chicken to be tested is the genome DNA of the venous blood sample under the chicken wings.

In the step 3), the obtained sequencing result is used for judging the corresponding genotype of the chicken skin color:

if the genotype is CC, the tested individual is the homozygous genotype of yellow skin;

if the genotype is CG, the tested individual is a non-yellow skin heterozygous genotype;

if the genotype is GG, the tested individual is a non-yellow skin homozygous genotype.

The method is advanced and scientific, and the invention provides a method for identifying the yellow skin character of chicken by adopting an SNP molecular marker technology, wherein the molecular marker is positioned at the G/C base mutation at the-104 th site of BCO2 gene on the No. 24 chromosome of chicken genome, the primer BCO2-F1 and the primer BCO2-R1 are utilized to amplify the molecular marker, the obtained amplification product is directly sequenced and genotyped, and the yellow skin and the non-yellow skin can be distinguished according to different genotypes. The method is simple and convenient to operate and reliable in result, and can realize rapid identification of the chicken yellow skin.

Yellow skin is an important appearance characteristic of chickens, and is found in the collection and arrangement of chicken breeds by a long-term traditional breeding method, the identification of skin color is not a quick method, and meanwhile, the skin color character separation phenomenon exists in some chicken breeds, so that the uniformity of the whole group is influenced. The invention can use SNP as a molecular marker technology to carry out scientific specificity identification on the yolk skin and the non-yolk skin, provides theoretical reference for poultry genetic resource protection, provides scientific basis for purposefully selecting the yolk skin characters, and can complete the purification of breeding populations on the target yolk skin through detection.

Drawings

FIG. 1 is a diagram of genotype identification for individuals with sallowness and non-sallowness skin.

Detailed Description

The present invention will now be described in further detail with reference to examples, drawings and accompanying descriptions, which are given by way of illustration and not of limitation.

The method for identifying the skin characteristics of the chicken yellow by adopting the SNP molecular marker technology comprises the following specific steps:

1. materials and methods;

1.1 test materials;

11 yellow skin chicken species are selected, and 376 yellow skin chicken species are selected; and 5 non-yellow skin chickens, and 133 are planted.

1.2 extracting genome DNA of a tested individual;

collecting blood from wing vein of each chicken, extracting total DNA of genome by conventional phenol-chloroform method, measuring DNA concentration and purity, packaging and diluting DNA mother liquor to 50ng/μ l, and storing at-20 deg.C in refrigerator.

1.3 taking the extracted genome DNA as a template, and carrying out conventional PCR reaction by using a PCR primer;

1.3.1 amplification primers

BCO2-F1:GCCGTGAGCAGCACAGCG

BCO2-R1:TTCACACCGAAGCCTCCGTAAA

1.3.2PCR reaction system and reaction conditions;

the specific reaction system for PCR is shown in the following table:

PCR reaction system

Specific PCR reaction conditions are shown in the following table:

PCR reaction conditions

1.4 sending the obtained PCR amplification product to bio-biology GmbH for sequencing;

1.5 Contigexpress software is used for carrying out statistical analysis on the sequencing result to obtain the genotype frequency distribution of each population.

2. The result is;

the genotype of the test subject at this site is determined according to FIG. 1. Homozygous yellow skin genotype is CC; heterozygous non-yellow individuals are of the CG genotype; the homozygous non-yellow genotype is GG.

Statistical analysis was performed on the genotypes of the BCO2 (G-104C) loci in different individuals with chicken skin color (Table 1). Of these, 100% of the homozygous genotypes CC (n = 376) in the yellow-skinned chicken species population, whereas 17.31% of the heterozygous genotypes CG (n = 18) and 82.69% of the homozygous genotypes GG (n = 86) in the non-yellow-skinned chicken species population.

TABLE 1 Individual genotypes of different skin tone types (yellow, non-yellow)

Nucleotide sequence (SEQ ID NO. 1):

agctg ctcac ccgcc cggcc ccgct -140

gcggg agatg cgggg atgcg gcccg -120

gccgt gagca gcaca gcgga tgggc -100

agcac atcct ccagc ccagc ctggc -80

ctgct gccac ggctt ttatt ctgaa -60

gcgat gatgt caggc agctc ggtgc -40

aaccc tcagc gcccc gctgc gcgct -20

gccgc cgcgg ccccg ctctc ctccc 20。

Claims (5)

1. an SNP molecular marker for identifying yellow skin traits of broiler chickens is characterized in that the molecular marker is positioned on a No. 24 chromosome of a chicken genome, and a nucleotide sequence is shown as SEQ ID No. 1; the molecular marker is positioned at the-104 th site, and the mutant base is C or G.

2. The application of the SNP molecular marker for identifying the yellow skin traits of broiler chickens, described in claim 1, in detection of the yellow skin traits of broiler chickens.

3. Use according to claim 2, characterized in that it comprises the following steps:

step 1), extracting chicken genome DNA;

step 2), designing specific amplification primers BCO2-F1 and BCO2-R1 aiming at BCO2 (G-104C), and then carrying out PCR amplification reaction by taking the DNA in the step 1) as a template to obtain a PCR product; wherein, the sequence of BCO2-F1 is shown as SEQ ID NO.2, and the sequence of BCO2-R1 is shown as SEQ ID NO.3;

SEQ ID NO.2: GCCGTGAGCAGCACAGCG；

SEQ ID NO.3: TTCACACCGAAGCCTCCGTAAA；

and 3) carrying out gene sequence sequencing on the PCR product obtained in the step 2), and judging the chicken skin color genotype through a gene sequencing sequence and a peak image.

4. The use as claimed in claim 3, wherein in step 1), the genomic DNA of the biological sample of the chicken individual to be tested is genomic DNA of a chicken wing vein blood sample.

5. The use according to claim 3, wherein in step 3), the sequencing result obtained determines the corresponding genotype of the chicken skin color:

if the genotype is CC, the tested individual is the homozygous genotype of yellow skin;

if the genotype is CG, the tested individual is a non-yellow skin heterozygous genotype;

if the genotype is GG, the tested individual is a non-yellow skin homozygous genotype.

Images