CN115927596A - Biomarker for diagnosing mouse cerebellum aging and application thereof - Google Patents

Abstract

The invention discloses a biomarker for diagnosing mouse cerebellum aging and application thereof, and provides a method for constructing a mouse model for the mouse cerebellum aging.A LncRNA marker of the invention is low expressed in a mouse, which can cause the expression level of cerebellum aging-related proteins P53, P21, P16, P38MAPK, IL-6 and gamma H2AX (a marker of DNA damage) to be averagely increased, and the LncRNA marker is knocked out, so that the learning memory function, the motor ability and the motor coordination ability of the mouse are seriously damaged, and obvious symptoms of the mouse cerebellum aging are shown; knocking out LncRNA markers to construct a mouse cerebellum aging model, wherein the aging state of the constructed mouse aging model is easy to detect and characterize; the breeding period is short, a complicated molding process is not needed, and stable propagation can be realized.

Description

Biomarker for diagnosing mouse cerebellum aging and application thereof

Technical Field

The invention belongs to the technical field of biomedicine, and particularly relates to a biomarker for diagnosing mouse cerebellum aging and application thereof.

Background

It was found that thousands of lncrnas are involved in the expression during brain development, of which up to 40% are brain tissue specific, and that these lncrnas are specifically highly expressed in specific developmental time points and specific brain regions of the brain, such as cerebral cortex, hippocampus and cerebellum. The incrnas expressed in the brain are evolutionarily more conserved than other organs, suggesting that incrnas may play an important role in development and functional maintenance of the nervous system. For example, oligodendrocyte limiting lncOL1 interacts with Suz protein, promotes differentiation of oligodendrocyte precursors to produce mature oligodendrocytes, and regulates the processes of central nervous system myelin production and myelin repair. Also, BACE1-Antisense transcript (BACE 1-Antisense) modulates the production of β -amyloid by modulating the expression of BACE protein (β -secretase 1). Studies find that lncRNA GM12371 is enriched in cell nucleus, and GM12371 is related to chromatin with active transcription, and regulates the expression of key genes involved in the growth and development of hippocampal neurons, and is crucial to the synaptic function in hippocampal neurons. A large number of researches show that lncRNA is beneficial to neuron cell type recognition, plasticity, synaptic transmission, high-grade cognitive activity and brain development, and in the aspect of nervous system research, scientists mainly research the changes of learning, memory, cognitive function, motor function and the like of mammals through electrophysiological experiments, animal behavioral experiments and other means. There are many unknown effects of lncrnas specific to brain regions in brain aging and neurodegenerative diseases. The research on the function and mechanism of the specific lncRNA in the brain is necessary, and theoretical support and potential therapeutic targets can be provided for clinical prediction and diagnosis and treatment of diseases related to brain aging. Cerebellum mainly has the functions of maintaining body balance, regulating muscle tension, controlling gait and body posture, coordinating random movement and the like, and cerebellum aging can cause movement and ataxia thereof and also can cause certain influence on language. By utilizing the research on the mouse aging, an effective tool and a theoretical basis thereof can be provided for the clinical conversion research of human beings.

Disclosure of Invention

Based on the above background, the first objective of the invention is to provide an lncRNA marker for diagnosing mouse cerebellar aging, so as to provide a molecular level tool for the research of mouse cerebellar aging; the second object is to provide a kit for diagnosing mouse cerebellar aging; the third purpose is to provide a method for constructing a cerebellum aging mouse model, which provides a foundation for the research of related medicines for treating and preventing cerebellum aging.

The technical scheme of the invention is as follows:

one of the objects of the present invention is to provide: an lncRNA marker for diagnosing mouse cerebellar aging, wherein the lncRNA marker is lncRNA Gm2694.

Further, the low expression of lncRNA Gm2694 in mice leads to the increase of the expression level of cerebellum aging-related proteins P53, P21, P16, P38MAPK, IL-6 and gamma H2 AX.

The second object of the present invention is to provide: a kit for diagnosing mouse cerebellar aging, characterized in that it comprises primers for specifically detecting lncRNA markers, which are lncRNA Gm2694;

the primer comprises nucleotide sequence primers shown as SEQ ID NO.1 and SEQ ID NO.2, and comprises the following steps:

forward primer SEQ ID No.1: ACCAAGCATGTCCTGAAGATG;

reverse primer SEQ ID NO.2: CTGGGGATACTGCTGAATCAA;

the third purpose of the invention is to provide: a method for constructing a cerebellum aging mouse model is characterized by comprising the following steps:

1) Introducing a gene editing system targeting lncRNA Gm2694 into the nucleus of a mouse fertilized egg cell to obtain a recombinant cell;

2) Implanting the recombinant cells into a surrogate mother to obtain an F0 generation, and mating with a wild type to obtain an F1 generation heterozygote;

3) Selfing the F1 generation heterozygote to obtain an F2 generation homozygote, namely a cerebellum aging mouse model.

Further, the gene editing system comprises a sgRNA targeting lncRNA Gm2694, wherein the sgRNA comprises a sgRNA 1 and a sgRNA2, the sgRNA 1 comprises a nucleotide sequence shown in SEQ ID No.3, and the sgRNA2 comprises a nucleotide sequence shown in SEQ ID No. 4.

Further, the gene editing system further comprises Cas9; the Cas9 includes Cas9 nuclease and/or mRNA of Cas9 nuclease.

The fourth purpose of the invention is to provide the application of the cerebellum aging mouse model constructed as above in screening drugs for treating or preventing cerebellum aging.

Compared with the prior art, the marker has the beneficial effects that:

the lncRNA marker is low in expression in a mouse, so that the expression level of cerebellum aging-related proteins P53, P21, P16, P38MAPK, IL-6 and gamma H2AX (a marker of DNA damage) is averagely increased, and the lncRNA marker is knocked out, so that the learning and memory function, the motor ability and the motor coordination ability of the mouse are seriously damaged, and the obvious symptom of cerebellum aging is shown, therefore, the lncRNA marker can be used as a biomarker for diagnosing the aging of the mouse in the aging research process of the cerebellum of the mouse, and a new direction and thought are provided for the research of the aging of the cerebellum of the mouse on the molecular level;

and knock-out of lncRNA markers is utilized to construct a mouse cerebellum aging model, the expression level of cerebellum aging-related proteins P53, P21, P16, P38MAPK, IL-6 and gamma H2AX (a marker of DNA damage) in the constructed mouse aging model is higher, and the aging state is easy to detect and characterize; the breeding period is short, a complicated molding process is not needed, and stable propagation can be realized; the gene knockout background mice have the advantages of small individual difference and the like.

Drawings

FIGS. 1A-B: the expression levels of lncRNA Gm2694 in different brain partitions (cerebellum, hypothalamus, hippocampus and olfactory bulb), organs (heart, liver, spleen, lung, kidney) and young and old cerebellar tissues (n = 3) were examined by RT-qPCR.

FIG. 2A: schematic representation of positional information of LncRNA Gm2694, cbln1 (adjacent gene of lncRNA Gm 2694), sgRNAs and genotype identifying primers (F, forward primer; R, reverse primer).

FIG. 2B: the offspring mouse genotype is detected by PCR amplification and agarose gel electrophoresis.

FIG. 2C: RT-qPCR detected the expression level of lncRNA Gm2694 in wild-type and knockout adult mouse cerebellum (n = 3), with statistical significance expressed as P < 0.0001.

FIG. 3A: mice from male mice of 3 months of age were tested by Western blot for changes in expression levels of senescence-associated proteins p16, p53 and p21 (n = 3).

FIG. 3B: imageJ software was used to make quantitative statistics on changes in protein levels. Data results are expressed as mean ± standard deviation, statistical significance is expressed in ns, significance is expressed as P <0.05, P <0.01, P < 0.001.

FIG. 4A: changes in the expression levels of senescence-associated proteins P38MAPK, IL-6 and γ H2AX were examined in the brains of 3-month-old male mice by Western blot experiments (n = 3).

FIG. 4B: imageJ software was used to make quantitative statistics on changes in protein levels. Data results are expressed as mean ± standard deviation, statistical significance is expressed in ns, significance is expressed as P <0.05, P <0.01, P < 0.001.

FIG. 5A: 2. comparison of cognitive function in 6, 10 and 14 month old male wild type and knockout mice (wild type: 2, 6, 10 and 14 month old mice n =6; knockout: 2, 6 and 10 month old mice n =6, 14 month old mice n = 8). The new object recognition index is calculated by subtracting the time spent exploring the old object from the time spent exploring the new object by dividing the total time of exploration of the mouse.

FIG. 5B: male mice of 2, 6, 10 and 14 months of age were tested for residence time on the rotarod, respectively, and the experiment was repeated 6 times per age group (the number of experiments is numbered according to T1-T6). (wild type: 2, 6 and 10 month mice n =10, 14 month mice n =6; knockout: 2 month mice n =8,6, 10 and 14 month mice n = 7). Statistical significance is expressed in ns, significance is expressed in P <0.05, P <0.01, P < 0.001.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to embodiments thereof; it should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The lncRNA marker is lncRNA Gm2694,the describedThe total length of lncRNA Gm2694 is 52743bp, and the specific sequence of the nucleotide sequence is derived from NCBI and specifically comprises the following steps:

Gm2694predictedgene 2694[Musmusculus(house mouse)]-Gene-NCBI (nih.gov)，

the queryable addresses are as follows:

https://www.ncbi.nlm.nih.gov/nuccore/NC_000074.7report＝fasta&from＝ 88199440&to＝88252182；

the primer for specifically detecting lncRNA comprises nucleotide sequence primers shown as SEQ ID NO.1 and SEQ ID NO.2, and comprises the following components:

forward primer SEQ ID No.1: ACCAAGCATGTCCTGAAGATG;

reverse primer SEQ ID NO.2: CTGGGGATACTGCTGAATCAA;

in order to facilitate a clearer understanding of the context of the present invention, reference will now be made in detail to the following specific embodiments. Unless otherwise specified, the experimental procedures referred to in the following examples are those commonly used in molecular biology procedures, and the reagents and instruments referred to are conventional commercially available reagents or instruments.

Example 1: expression level of LncRNA Gm2694 in aged mouse cerebellum tissue is obviously reduced

In this example, 4 mouse brain tissues (cerebellum, medulla bovis Seu Bubali, and medulla bovis Seu Bubali) were collected the hypothalamus hippocampus and olfactory bulb), 5 organ samples (heart, brain, heart, blood, and blood liver, spleen, lung,Kidney), TRIzol was used ^TM Reagent (Invitrogen) ^TM 15596026), according to the reagent instruction, extracting RNA from each sample, and detecting the expression level of lncRNA Gm2694 gene in different tissues using a reverse transcription reagent (Vazyme, R212-01/02) and a real-time fluorescent quantitative PCR reagent (Vazyme, Q111-02-AA) provided by nozan. The real-time fluorescent quantitative PCR primer sequences are shown in Table 1.

Table 1: real-time fluorescent quantitative PCR primer sequence information

Serial number	Name (R)	Experimental use	Sequence information (5 '-3')
					GAPDH_F	RT_qPCR	ACATCATCCCTGCATCCACTG
	GAPDH_R	RT_qPCR	CCTGCTTCACCACCTTCTTG
				SEQ ID NO.1	Gm2694_F	RT_qPCR	ACCAAGCATGTCCTGAAGATG
SEQ ID NO.2	Gm2694_R	RT_qPCR	CTGGGGATACTGCTGAATCAA

As shown in the results of fig. 1A, lncRNA Gm2694 is largely enriched in cerebellar tissues of adult mice.

In addition, we also collected normal young and old wild type mouse cerebellum tissue samples, extracted RNA in the samples by similar experimental reagents, and detected the expression level of lncRNA Gm2694 in young and old mouse cerebellum tissues by RT-qPCR.

As shown in the results of fig. 1B, lncRNA Gm2694 was significantly down-regulated in the cerebellar tissue of aged mice.

Example 2: successful construction of lncRNA Gm2694 knock-out mouse model

According to the experimental result of the example 1, the lncRNA Gm2694 is knocked out to construct a mouse cerebellar premature aging model.

In particular to a CRISPR/Cas9 technology which is a technology for guiding Cas9 nuclease to carry out specific modification on a target gene by sgRNA. In this example, sgRNAs targeting 3' ends of the first exon and the last exon of lncRNA Gm2694 gene are designed to successfully construct lncRNA Gm2694 knockout mice, which deletes most lncRNA Gm2694 gene sites and avoids deletion of promoter regions shared with Cbln1 gene (shown in fig. 2A). F1 generation heterozygous knockout mice were provided by Jiangsu Baige Gene technology, inc. The sgRNA and genotype identifying primer sequences are shown in table 2.

Table 2: sgRNA and genotype identification primer sequence information

Serial number	Name(s)	Experimental use	Sequence information (5 '-3')
				SEQ ID NO.3	sgRNA1	CRISPR/Cas9	TCCGGCCGGGAGTCAGACGA
SEQ ID NO.4	sgRNA2	CRISPR/Cas9	AAGGGCATGGTGGGTTGGCG
					genotype_F1	Genotyping	GAGCCAATGGTTGCCCTGTC
	genotype_F2	Genotyping	ACAAAGGCGCGGATCAAGC
					genotype_F3	Genotyping	GGATACCCACCCTGCATTATC
	genotype_R1	Genotyping	AACTCCACTGTTACTGCTAATACA
					genotype_R2	Genotyping	CTCCTACCTGAAAGCCCACGAA

The F1 generation mice carrying the heterozygous alleles were then caged and mated, resulting in F2 generation mice. A small amount of rat tail end tissues are cut, 80 mu l of 5mM NaOH (national drug group, 10019762) is added into each sample, the sample is placed in a metal bath at 100 ℃ for heating for 35 minutes, 40 mu l of 1M Tris-HCl pH 7.5 (Vetec reagent grade, WXBD 0982V) is added after cooling, and after vortex oscillation mixing, the sample and corresponding primers are taken for PCR amplification analysis, and the genotype of a progeny mouse is identified.

As shown in the results of fig. 2B, lncRNA Gm2694 homozygous knockout mice and littermate wild type control mice were initially selected.

In addition, the present example also collects lncRNAGm2694 homozygous knockout mouse and littermate wild type control mouse, extracts cerebellum tissue RNA, and detects the expression level of lncRNA Gm2694 in the cerebellum of wild type and knockout adult mice by RT-qPCR.

As shown in the results of fig. 2C, the RT-qPCR results also confirmed that lncRNA Gm2694 was hardly expressed at all in homozygous knockout mice compared to wild-type mice.

Example 3: mice with LncRNA Gm2694 knockout mice have aging and impaired learning, memory and motor abilities

To further observe whether lncRNAGm2694 knockout would accelerate cerebellar tissue aging and functional deterioration, this example developed a cerebellar aging phenotype test.

The research shows that the biological activity in the senescent cells is obviously changed, such as the activation of cell cycle regulatory proteins p53, p21 and p16, the increase of beta-galactosidase activity and the like. But not all aging cells display all of the aging markers, and cells that do not also may display some of the aging markers. Thus, a single senescence signature does not account for cellular senescence and multiple marker association assays are required to determine whether a cell is senescent. For this purpose, cerebellum tissues of 3-month-old wild-type and knockout mice were collected in this example. 200 μ l of pre-cooled cell lysate (abcam, ab 288006) and protease inhibitor (Roche Complete, 11836145001) were added to each sample, the tissue was initially minced, homogenized on ice for 2min, supplemented with 300 μ l of lysate, and placed in a refrigerator at 4 ℃ for 60 min for rotary lysis. The samples were centrifuged at 14000g for 10min at 4 ℃. Then, 2 XSDS loading buffer was added to the cell lysate supernatant in a volume ratio of 1:1. The protein samples were heat treated in a metal bath at 100 ℃ for 7 minutes. After cooling on ice and brief centrifugation, the protein expression levels of p53 (Proteintetech, 10442-1-AP), p21 (Millipore, 05-345), p16 (Abcam, ab 51243), internal reference GAPDH (Proteintetech, 60004-1-Ig) and beta-Tubulin (Proteintetech, 66240-1-Ig) were measured in a subsequent Western blot experiment.

As shown in the results of fig. 3A, the protein expression levels of p53, p21, and p16 were all increased in lncRNA Gm2694 knock-out mice at 3 months of age, compared to wild-type mice.

Thereafter, in this example, changes in the expression levels of the aging-associated proteins P38MAPK (Proteintetech, 14064-1-AP), IL-6 (Proteitech, 66146-1-Ig) and γ H2AX (Cell Signaling Technology,20E 3) were examined in 3 additional cerebellums by Western blot experiments.

As shown in the results of fig. 3B, the expression levels of P38MAPK, IL-6 and γ H2AX proteins were increased in lncRNA Gm2694 knock-out mice of 3 months of age compared to wild-type mice.

The cerebellum is important for the motor coordination and the learning and memory functions of the body. The experimental result shows that after the lncRNA Gm2694 is knocked out, the level of the protein related to the mouse cerebellum aging is obviously increased. This suggests that lncRNA Gm2694 knockout may accelerate mouse cerebellar aging to some extent and may also present cerebellar dysfunction in motor and cognition.

To verify, this example also performed a new object recognition experiment and a rotarod experiment on 2, 6, 10 and 14 months old wild-type mice and lncRNA Gm2694 knockout mice, respectively, after birth.

The novel object recognition experiment is one of the basic experiments for evaluating the learning and memory ability of mice. The experiment was performed in the dark, and we prepared a square black box (40 cm x 30 cm) with camera equipment. In the training phase, wild type mice and lncRNA Gm2694 knockout mice were each free to explore two identical objects in black boxes for 3 minutes. During the next day of testing, one of the objects was replaced with a new one and the mice were allowed to explore freely for 3 minutes, the time of exploration of the mice being recorded by the ANY-size video tracking system (Stoelting, usa).

The rotarod test is one of the effective behavioural methods currently used to assess the motor coordination ability of rodents. The experimental mice were placed in a behavioral laboratory at least 30 minutes in advance to acclimate to the environment prior to training. Then, the mice were previously left on the rotarod for 2 minutes. Subsequently, the synchronous start channel was clicked immediately after starting the motor for about 2 seconds, and the rotating rod apparatus (shanghai soft, XR 1514) began to accelerate slowly to a speed of 40 rpm. When the mouse falls off the wand, it is immediately removed and the infrared is covered by hand to indicate completion, and the instrument will automatically record the time the mouse remains on the wand. Mice were tested three times a day for two consecutive days for a total of six experiments.

As shown in fig. 5A-B, lncRNA Gm2694 knockout mice were severely impaired in learning and memory function (shown in fig. 5A), motor ability, and motor coordination ability. These results further verify that lncRNA Gm2694 knockout mice do have severely impaired cerebellar function. The potential value of the lncRNA Gm2694 in the research of diseases related to brain aging and the potential of drug development to a certain degree are further illustrated.

The above experiments show that the expression level of lncRNA Gm2694 in the cerebellum tissue sample of the old mouse is obviously reduced compared with the cerebellum tissue sample of the normal young mouse. Genotype identification of offspring mice is carried out by a PCR amplification technology, and an lncRNA Gm2694 homozygous knockout mouse (short for knockout) and a littermate wild type control mouse (short for wild type) are preliminarily screened out. The results of the RT-qPCR experiments also confirmed that lncRNA Gm2694 was hardly expressed at all in homozygous knockout mice compared to wild type mice. In addition, a western blot technology is used for detecting cerebellum protein samples of 3-month-old wild-type and knockout mice, the lncRNA Gm2694 knockout leads to the obvious increase of the expression level of cerebellum aging-related proteins P53, P21, P16, P38MAPK, IL-6 and gamma H2AX (a marker of DNA damage), and the data result further shows that the knockout of the lncRNA Gm2694 can accelerate the aging of cerebellum tissues to a certain extent. Finally, the learning and memory functions, motor ability and motor coordination ability of lncRNA Gm2694 knockout mice are severely impaired by mouse behavioral experiments such as new object recognition and rod rotation. These results indicate that the cerebellum of lncRNA Gm2694 knockout mice is functionally deficient. Therefore, the expression of the lncRNA Gm2694 can diagnose the mouse cerebellar premature senility from a molecular level, and a mouse cerebellar premature senility model constructed by knocking out the lncRNA Gm2694 can be used for research of screening medicines for treating or preventing the cerebellar premature senility, so that a new thought and a new direction are provided.

The above description is only of the preferred embodiments of the present invention, and it should be noted that: it will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the principles of the invention and these are intended to be within the scope of the invention.

Claims (7)

1. A IncRNA marker for diagnosing mouse cerebellar aging, characterized in that,

the lncRNA marker is lncRNA Gm2694.

2. The lncRNA marker for diagnosing cerebellar aging of mice according to claim 1, wherein the low expression of lncRNA Gm2694 in mice results in the horizontal increase of the expression levels of cerebellar aging-related proteins P53, P21, P16, P38MAPK, IL-6 and γ H2 AX.

3. A kit for diagnosing mouse cerebellar aging, characterized in that it comprises primers for specifically detecting lncRNA markers, which are lncRNA Gm2694;

the primers comprise nucleotide sequence primers shown as SEQ ID NO.1 and SEQ ID NO.2, and comprise the following components:

forward primer SEQ ID No.1: ACCAAGCATGTCCTGAAGATG;

reverse primer SEQ ID No.2: CTGGGGATACTGCTGAATCAA.

4. A method for constructing a cerebellum aging mouse model is characterized by comprising the following steps:

1) Introducing a gene editing system targeting lncRNA Gm2694 into the nucleus of a mouse fertilized egg cell to obtain a recombinant cell;

2) Implanting the recombinant cells into a surrogate mother body to obtain an F0 generation, mating with a wild type to obtain an F1 generation heterozygote;

3) Selfing the F1 generation heterozygote to obtain an F2 generation homozygote, namely a cerebellum aging mouse model.

5. The method for constructing the mouse model of cerebellar aging of claim 4, wherein the gene editing system comprises sgRNA targeting lncRNA Gm2694, the sgRNA comprises sgRNA 1 and sgRNA2, the sgRNA 1 comprises a nucleotide sequence shown in SEQ ID No.3, and the sgRNA2 comprises a nucleotide sequence shown in SEQ ID No. 4.

6. The method of claim 5, wherein the gene editing system further comprises a Cas9; the Cas9 includes Cas9 nuclease and/or mRNA of Cas9 nuclease.

7. Use of the cerebellar aging mouse model constructed by the method for constructing a cerebellar aging mouse model according to any one of claims 4 to 6 for screening a medicament for treating or preventing cerebellar aging.

Images