WO2024065376A1

WO2024065376A1 - Use of novel locus of callipyge gene in sheep breeding

Info

Publication number: WO2024065376A1
Application number: PCT/CN2022/122505
Authority: WO
Inventors: 邓学梅; 王建魁
Original assignee: 中国农业大学
Priority date: 2022-09-29
Filing date: 2022-09-29
Publication date: 2024-04-04

Abstract

Disclosed in the present invention is the use of a differentially methylated region of callipyge gene in meat trait breeding. Disclosed in the present invention is a differentially methylated region from an imprinted region Dlk1-Mirg of sheep callipyge gene, the nucleotide sequence of the differentially methylated region being shown as SEQ ID NO: 1. The differentially methylated region and an associated gene Gtl2 thereof can be used for early-stage breeding of meat traits of sheep. Further disclosed in the present invention is that a differentially methylated region shown as SEQ ID NO: 2 of a Dlk1-Mirg region of mice and an associated gene Meg3 thereof can be used for regulating and controlling the body weight of mice and constructing a weight loss mouse model.

Description

Application of new loci of beautiful buttocks gene in sheep breeding

Technical Field

The present invention belongs to the field of biotechnology, and relates to the application of a new site of a beautiful buttocks gene in sheep breeding, and specifically to the application of a differentially methylated site of a beautiful buttocks gene in breeding for meat traits.

Background technique

In recent years, the world's mutton industry has begun to develop towards lamb, mainly producing high-quality lamb with less fat and a high proportion of lean meat. For example, France, the United Kingdom and the United States, as well as Australia and New Zealand, which used to be mainly wool-producing sheep, have lamb production accounting for more than 90%, which shows that the world has shifted the focus of sheep farming to lamb production. my country has excellent meat lamb breeds. Take Tan sheep as an example. Its mutton has fine muscle fibers, thin sarcolemma, light mutton smell, and high lean meat rate (Tan sheep meat has a lean meat rate of more than 57%, while ordinary mutton is 52%), which is very popular in the market. However, for many years, due to the pursuit of fur quality, Tan sheep have become smaller and their growth and development are slower. Therefore, solving the contradiction between lamb meat, fur and skin output is crucial to improving the economic benefits of fur-meat or wool-meat dual-purpose breeds such as Tan sheep. The beautiful butt gene is located in the telomere of chromosome 18 of sheep, involving paternal and maternal imprinted genes in the Dlk1-Mirg region. The beautiful butt phenotype of sheep is believed to be caused by a base mutation from A to G in this region, which leads to excessive hypertrophy of the buttocks muscles. This trait is currently considered to be inherited from the father. The breeding application of the maternal beautiful butt gene has not yet been involved. Advanced breeding methods and means for the beautiful butt trait of the maternal will effectively supplement the traditional breeding methods for beautiful butt.

Invention Disclosure

In order to improve on the existing breeding methods of beautiful buttocks genes and perfect the breeding system of meat sheep, the present invention discovered the application of differentially methylated regions (DMRs) in body weight and size while exploring the molecular mechanism by which DMRs regulate the differential expression of maternal imprinted genes and thus affect body weight changes.

In a first aspect, the present invention claims a differentially methylated region (DMR).

The differentially methylated region (DMR) claimed to be protected by the present invention comes from the sheep buttocks imprint region Dlk1-Mirg, and its nucleotide sequence is shown in SEQ ID No.1.

The DMR claimed in the present invention includes both its nucleotide sequence and its methylation modification status (level).

In a second aspect, the present invention claims the use of the differentially methylated region (DMR) described in the first aspect as a methylation marker in any of the following:

(A1) Regulating sheep body weight;

(A2) Identify or assist in identifying body weight traits in sheep.

In a third aspect, the present invention claims the use of the sheep Gtl2 gene as a marker in any of the following:

(A1) Regulating sheep body weight;

(A2) Identify or assist in identifying body weight traits in sheep.

Among them, the sheep Gtl2 gene is the gene associated with the DMR described in the first aspect above, the DMR is located at 66216001-66217000 of sheep chromosome 18, and the genome version is rambouillet_v1.0_genomic (the DMR is located in the promoter region of the sheep Gtl2 gene). The sheep Gtl2 gene is specifically located at 66220214-66253349 of sheep chromosome 18, and the genome version is rambouillet_v1.0_genomic.

In a fourth aspect, the present invention claims the use of a substance for detecting the methylation level of the differentially methylated region described in the first aspect above in identifying or assisting in identifying the body weight trait of sheep.

In a fifth aspect, the present invention claims protection for the use of a substance for detecting the expression level of the sheep Gtl2 gene in identifying or assisting in identifying the body weight trait of sheep.

In the second to fifth aspects above, the sheep weight may be the sheep's early body weight, such as the body weight at 1 month of age or younger.

Furthermore, the early body weight of the sheep may specifically be the body weight of the sheep at one month of age.

In a sixth aspect, the present invention claims protection for the use of the differentially methylated regions described in the first aspect as methylation markers in the breeding of sheep for meat traits.

In a seventh aspect, the present invention claims protection for the use of the sheep Gtl2 gene as a marker in breeding sheep for meat traits.

In an eighth aspect, the present invention claims the use of a substance for detecting the methylation level of the differentially methylated region described in the first aspect above in breeding for sheep meat traits.

In a ninth aspect, the present invention claims protection for the use of a substance for detecting the expression level of the sheep Gtl2 gene in breeding for sheep meat traits.

In the sixth to ninth aspects above, the breeding of sheep for meat traits may be breeding of sheep for meat traits at an early stage (eg, 1 month old).

In the above aspects, the substance used to detect the methylation level of the differentially methylated region of sheep described in the first aspect above can specifically be a reagent and/or instrument used for methylation sequencing of the DNA fragment shown in SEQ ID No. 1 in the sheep genome.

In the above aspects, the substance used to detect the expression level of sheep Gtl2 gene can specifically be a primer pair consisting of two single-stranded DNAs shown in SEQ ID No.3 and SEQ ID No.4.

In a tenth aspect, the present invention claims a method for identifying or assisting in identifying a body weight trait in sheep.

The method for identifying or assisting in identifying the weight trait of sheep claimed in the present invention may include the following steps (B1) or (B2):

(B1) detecting the methylation level of the differentially methylated region in the first aspect of the above-mentioned sheep to be tested, wherein the weight of the sheep to be tested having a relatively low methylation level in the differentially methylated region is higher or is a candidate to be higher than the weight of the sheep to be tested having a relatively high methylation level in the differentially methylated region;

(B2) detecting the expression level of the Gtl2 gene in the sheep to be tested, wherein the body weight of the sheep to be tested with a relatively high expression level of the Gtl2 gene is higher or is higher than that of the sheep to be tested with a relatively low expression level of the Gtl2 gene.

The sheep weight may be the early weight of the sheep, such as the weight at 1 month of age or younger.

Furthermore, the early body weight of the sheep may be the body weight of the sheep at one month of age.

In an eleventh aspect, the present invention claims protection for the use of the method described in the tenth aspect above in breeding sheep for meat traits.

Wherein, the breeding of sheep for meat traits may be breeding of sheep for early-stage (1 month old) meat traits.

In a twelfth aspect, the present invention claims a method for breeding a meat-type sheep breed.

The method for breeding a meat-type sheep breed claimed in the present invention may include the following steps (D1) or (D2):

(D1) using the sheep to be tested whose methylation level of the differentially methylated region identified by the method described in the tenth aspect above is relatively low as a parent for breeding;

(D2) using the sheep to be tested with a relatively high expression level of the Gtl2 gene identified by the method described in the tenth aspect as parents for breeding.

In a thirteenth aspect, the present invention claims the use of a differentially methylated region (DMR) of the mouse Dlk1-Mirg region as a methylation marker in regulating the body weight of mice;

The nucleotide sequence of the differentially methylated region (DMR) of the mouse Dlk1-Mirg region is shown in SEQ ID No.2.

In a fourteenth aspect, the present invention claims protection for the use of mouse Meg3 gene as a marker in regulating mouse body weight.

Among them, the mouse Meg3 gene is a gene associated with the differential methylation region (DMR) of the mouse Dlk1-Mirg region mentioned above, and the genebank accession number of the DMR is: AC107681.15. The mouse Meg3 gene is specifically located on mouse chromosome 12: 109506879-109538163, and the reference genome version is: GRCm39. The mouse MDR is located upstream of the Meg3 gene, far from the meg3 promoter, and belongs to the regulatory region (Dlk1-Mirg region) that regulates the expression of the meg3 gene.

In a fifteenth aspect, the present invention claims a method for constructing a mouse model of reduced body weight.

The method for constructing a mouse model with reduced body weight claimed in the present invention may include the following steps: reducing the expression level of the mouse Meg3 gene to obtain a mouse model with reduced body weight.

In a specific embodiment of the present invention, the expression of mouse Meg3 gene is reduced by knocking out the differentially methylated region (DMR) regulating the expression of mouse Meg3 gene. Specifically, it is carried out using CRISPR/Cas9 technology, wherein the gRNA sequence (targeting the differentially methylated region of the mouse Dlk1-Mirg region described above) is shown in Figure 5.

In a specific embodiment of the present invention, the body weight refers to the body weight of young mice (such as 2 days after birth).

In a sixteenth aspect, the present invention claims the use of a differentially methylated region (DMR) of a mammalian Dlk1-Mirg region or a gene thereof in any of the following:

(A1) regulating the body weight of the mammal;

(A2) identifying or assisting in the identification of the body weight trait of the mammal.

In a specific embodiment of the present invention, the sheep is Aohan fine-wool sheep.

In the above aspects, the sample to be tested when detecting the methylation level of the differentially methylated region described in the first aspect and detecting the expression of the sheep Gtl2 gene can be a tissue sample, such as a skin tissue sample. In a specific embodiment of the present invention, the sample to be tested is specifically sheep shoulder skin tissue.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the identification of DMRs in the sheep Gtl2 region.

Figure 2 shows the specific location information of DMR in the sheep Gtl2 region (genome version: Oar_rambouillet_v1.0).

Figure 3 shows the comparison and analysis of the body weight of lambs in the high and low methylation level groups. * indicates P < 0.05

FIG. 4 is a comparative analysis of the expression of the Gtl2 gene in the high body weight (low methylation level) group and the low body weight (high methylation level) group (** indicates extremely significant difference, P<0.001).

Figure 5 shows the Guide RNA sequence.

FIG6 shows the PCR positive identification results of Gtl2 (called Meg3 gene in mice) related DMR knockout mice, where the symbol “+/-” indicates the characteristics of positive individual bands, and the symbol “+/+” indicates the characteristics of negative control individual bands.

Figure 7 is a schematic diagram of the selection of Gtl2 (called Meg3 gene in mice) related DMR knockout mice

Figure 8 shows the expression of maternal imprinted genes (Meg3, Mirg and Rian) such as Gtl2 (called Meg3 gene in mice) in knockout mice and wild type mice. *** indicates extremely significant difference (P<0.0001).

Figure 9 shows the body weight analysis of young (2 days after birth) mice with Gtl2 (called Meg3 gene in mice) related DMR knockout mice. *** indicates extremely significant difference (P<0.0001).

Best Mode for Carrying Out the Invention

The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

Example 1: Application of the expression of the maternal imprinted gene cluster Gtl2-Mirgs in the breeding of meat-type sheep

This embodiment involves a newly discovered DMR (SEQ ID No. 1) located in the sheep maternal imprinted gene cluster Gtl2-Mirgs, and the Gtl2 gene associated with the DMR.

1. Six Aohan fine-wool lambs aged one month were selected, their body weights were weighed, and their shoulder skin tissues were collected.

2. Extract the DNA of the above skin tissues and detect the methylation level of the promoter region of the Gtl2 gene among lamb individuals. Specific methods: DNA was extracted from 6 Aohan fine-wool lambs and samples were tested. The genomic DNA was extracted using the standard phenol-chloroform method. The degree of DNA degradation was analyzed by agarose gel electrophoresis. The purity of DNA (OD260nm/OD280nm ratio) was detected by Nanodrop (Life Technologies, USA). The DNA concentration was detected by Qubit 2.0 (Life Technologies, USA). Library construction: After the genomic DNA test was qualified, the genomic DNA was randomly sheared to 200-300bp using Covaris S220 (Covaris, USA). The sheared DNA fragments were end-repaired, A-tailed, and connected to sequencing adapters in which all cytosines were methylated. Bisulfite treatment was then performed (EZ DNA Methylation Gold Kit, Zymo Research). The unmethylated C was converted to U (to T after PCR amplification), while the methylated C remained unchanged. Finally, PCR amplification was performed to obtain the final DNA library. The length of the insert fragment of the library was detected using Agilent 2100 (Agilent, USA). After the library inspection was qualified, different libraries were pooled according to the effective concentration and the target data volume requirements and then sequenced by Hiseq. The sequencing method was double-end sequencing. The swDMR software (http://122.228.158.106/swDMR/) was used to identify differentially methylated regions (DMR). Based on the methylation information of each site (set reads coverage ≥ 5), the software used a sliding window method to scan the genome and identified the methylation degree of the promoter region of the Gtl2 gene in 6 individuals. The methylation levels were sorted from high to low, with the first three being the high methylation group and the last three being the low methylation group. Based on the important biological significance of DMR, the genomic location of DMR and the genomic structural annotation information were used to perform structural annotation on it.

3. Extract the RNA from the skin tissues, reverse transcribe it into cDNA, and then use fluorescence quantitative PCR to detect the expression of Gtl2 gene. The details are as follows:

The reaction system for reverse transcription into cDNA is 20μL, including: primer, 3.0μL; dNTP, 0.15μL; Mautiscribe RT enzyme, 1.0μL; 10×RT Buffer, 1.5μL; RNase inhibitor, 0.19μL; RNA sample, 2.0μL (1-10ng); DEPC water, 12.16μL. Reaction conditions: 16℃, 15min; 42℃, 30min; 95℃, 5min; finally kept at 4℃.

Fluorescence quantitative PCR was used to detect the expression of Gtl2 gene. Instrument: Brand: Bio-RAD, Model: CFX96, Sample loading system (20μL) included: 0.5μL of upstream and downstream primers (upstream primer: TCGTTTATTCTCCCACAGCG (SEQ ID No.3), downstream primer: AAACGGAAGGTGAGGAAGGA (SEQ ID No.4)), 10μL of SYBGreen Mix, 9μL of DEPC water. Reaction conditions were as follows: Step 1, 95℃, 30s; Step 2, 95℃, 5s; 60℃, 30s; Repeat 42 times.

4. Results and Analysis

The lambs were sorted according to the methylation level of the Gtl2 promoter region, and the methylation region shared by the Gtl2 promoter region of the six lambs was selected for further grouping. Specifically, for each methylation region in the region, the methylation level was sorted, and the first three lamb groups with high methylation and the last three lamb groups with low methylation levels formed differential methylation regions. The significance of the difference was calculated to obtain the regions shown in Figures 1 and 2. According to the methylation level of the region, they were divided into two groups (sorted from high to low according to the methylation level, the first three were high methylation groups, and the last three were low methylation groups). As shown in Figure 3, there was a very significant difference in weight between the two groups, P<0.05, and real-time PCR was performed to detect the expression of the Gtl2 gene. The results showed that the group with high weight (low methylation level) also had high Gtl2 expression (Figure 4), and the difference was very significant, P<0.001.

The DMR in this application was obtained through whole genome methylation sequencing of skin tissues of 6 Aohan fine wool sheep. Figure 1 shows the identification of DMR in the sheep Gtl2 region. Figure 2 shows the specific location information of DMR in the sheep Gtl2 region (genomic version: Oar_rambouillet_v 1.0). The DMR is located at 66216001-66217000 of chromosome 18 of sheep, and the genome version is rambouillet_v1.0_genomic (the DMR is located in the promoter region of the sheep Gtl2 gene).

Through whole genome methylation detection, it was found that lambs with low DMR methylation levels in the Gtl2 region (lambs with relatively high body weight) had high Gtl2 expression, lambs with high DMR methylation levels in the Gtl2 region (lambs with relatively low body weight) had low Gtl2 expression, and the expression of the Gtl2 gene in the skin tissue of lambs with large body weight was significantly higher than that of individuals with small body weight (P<0.01). Figure 3 is a comparison and analysis of the body weight of lambs with high/low methylation levels. Figure 4 is a comparative analysis of the expression of the Gtl2 gene in the high body weight (low methylation level) group and the low body weight (high methylation level) group.

By analyzing the correlation between methylation level, body weight, and Gtl2 expression, it was found that there was a strong correlation among the three. The correlation coefficient between methylation level and body weight was -0.90, the correlation coefficient between methylation level and Gtl2 was -0.97, and the correlation coefficient between body weight and Gtl2 expression was 0.83.

Example 2. Preparation of C57/BL MEG3 (Gtl2) DMR knockout mice and identification of body weight traits

In this example, CRISPR/Cas9 technology was used to perform gene editing on the Gtl2 (called Meg3 gene in mice) DMR sequence (SEQ ID No. 2), delete the sequence, construct C57/BL mouse MEG3 (Gtl2) DMR knockout mice, and identify their body weight traits.

1. Design, construct and in vitro transcribe the Guide RNA vector, and verify that the vector sequence is correct by gene sequencing. The DNA sequence corresponding to the Guide RNA is shown in Figure 5.

2. Microinject the Cas9 mRNA and Guide RNA prepared by in vitro transcription into several prepared fertilized eggs of inbred mice with C57BL/6J genetic background.

3. Transplant the fertilized eggs/embryos of mice that survive microinjection into the pseudo-pregnant ICR recipient female mice prepared in advance so that the fertilized eggs/embryos can successfully implant and become pregnant. After waiting for 19-20 days, the pseudo-pregnant ICR recipient female mice will become pregnant and give birth to pups or give birth by caesarean section.

4. About 10-15 days after the pseudo-pregnant recipient female mice gave birth to the F0 generation mice, their tails and toes were cut and numbered. The genomic DNA of each mouse was extracted for initial and re-test PCR and sequencing identification.

Among them, the primer names and sequences are: Meg3_WT-F1: GGATTCAAGGAATGGAGTTTGGG; Meg3_WT-R1: GCCACTTGCATCAGAATGAAAGC; Meg3(DMR)_KO-F2: CTCTGCCATACATAGTGTTC TAGGCC; Meg3(DMR)_KO-R2: TGAGGAAACAGGCTGTTGAGTGG; Meg3(DMR)_KO-Seq: CTCTGCCATACATA GTG TTCTAGGCC.

Reaction system: 0.5 μL of each primer F1/R1, F2/R2, (DMR)KO-seq, 10 μL of dNTP Mix, add DEPC water to make up to 20 μL system.

Reaction conditions: first step, 95°C, 5 min; second step, 95°C, 30 s, 57°C, 30 s, 72°C, 30 s, 35 cycles; third step, 72°C, 5 min; fourth step, storage at 4°C.

Genotype determination criteria: 1. WT/WT, Wild Type Wild-type genome: WT genome Meg3WT-F1/R1 primer pair PCR product obtained a single WT band of 435bp, WT genome Meg3(DMR)KO-F2/R2 primer pair PCR band (5167bp) exceeded the conventional PCR reaction capacity and no PCR product was obtained; 2. (DMR)KO/(DMR)KO, Homozygous homozygous genome: (DMR)KO genome Meg3WT-F1/R1 primer pair had no PCR product because the upstream and downstream primers could not anneal, (DMR)KO genome Meg3(DMR)(DMR)KO-F2/R2 primer pair PCR product A single (DMR) KO band of 492 bp was obtained from the WT/(DMR) KO, Heterozygous heterozygous genome: The WT genome Meg3WT-F1/R1 primer pair PCR product obtained a single WT band of 435 bp, the WT genome Meg3(DMR) KO-F2/R2 primer pair PCR band (5167 bp) exceeded the conventional PCR reaction capacity and no PCR product was obtained, the (DMR) KO genome Meg3WT-F1/R1 primer pair had no PCR product because the upstream and downstream primers could not anneal, and the (DMR) KO genome Meg3(DMR) KO-F2/R2 primer pair PCR product obtained a single (DMR) KO band of 492 bp. If two pairs of primers are selected for combined PCR, double bands will be obtained. Among them, WT represents wild type, (DMR) KO represents knockout, F represents upstream primer, and R represents downstream primer. As shown in Figure 6, positive heterozygous chimeric genotype F0 mice were screened.

5. When the positive heterozygous chimeric genotype F0 generation mice reach sexual maturity (about 2 months old), each positive female mouse is mated with a wild-type C57BL/6J inbred male mouse for natural implantation and pregnancy, or male mice are taken for in vitro fertilization (IVF) and embryo implantation for pregnancy expansion, pregnancy and birth.

6. Similarly, the tails and toes of F1 mice were cut and numbered around 10-15 days after birth. The genomic DNA of each mouse was extracted for initial and retest PCR and sequencing identification (same as step 4), and the F1 mice with systemic positive heterozygous genotype were screened.

7. Detect the expression of maternal imprinted gene cluster Gtl2 (Meg3)-Mirgs gene in knockout mice and wild-type mice. The details are as follows: extract the RNA of the above skin tissue, reverse transcribe it into cDNA, add sample (20μL), including: primer, 3.0μL; dNTP, 0.15μL; Mautiscribe RT enzyme, 1.0μL; 10×RT Buffer 1.5μL; RNase inhibitor, 0.19μL; RNA sample, 2.0μL (1-10ng); DEPC water, 12.16μL. Reaction conditions: 16℃, 15min; 42℃, 30min; 95℃, 5min; finally keep at 4℃. Meg3 fluorescence quantitative PCR, the sample loading system (20 μL) included: 0.5 μL each of upstream and downstream primers (Meg3 upstream primer: TCTTCCTGTGCCATTTGCTGT; Meg3 downstream primer: TCTTCCTGTGCCATTTGCTGT. Mirg upstream primer: TTAGGAGCATTTCCAGGAGG; Mirg downstream primer: AAGCGAACTCATCACAGACAAC. Rian upstream primer: TGGAGGCCCTAATGTGAATG; Rian downstream primer: AAGCATCCACAGGACGCAAT), 10 μL of SYBGreen Mix, and 9 μL of DEPC water. The reaction conditions were as follows: the first step, 95°C, 30 s; the second step, 95°C, 5 s; annealing (Meg3 gene annealing temperature was 58°C, Mirg gene annealing temperature was 57°C, and Rian annealing temperature was 60°C), 20 s; repeated 42 times.

8. Results and Analysis

The positive heterozygous chimeric genotype F0 mice obtained in step 4 were used as the mother to mate with the wild-type father to obtain offspring heterozygous knockout mice (corresponding to the above steps 5 and 6). The mating pattern is shown in FIG. 7 .

Real-time fluorescence quantitative PCR was used to detect the expression of maternal imprinted genes such as Gtl2 (called Meg3 gene in mice) in knockout mice and wild-type mice. The expression of maternal imprinted genes in knockout mice was significantly lower than that in wild-type mice (P<0.01). The results are shown in Figure 8.

In addition, the body weight of young (2 days old) Gtl2 (called Meg3 gene in mice) related DMR knockout mice was analyzed, as shown in Figure 9. It can be seen from the figure that the body weight of Gtl2 (called Meg3 gene in mice) related DMR knockout mice was significantly lower than that of wild-type mice (P<0.01).

The sequences involved in the above are as follows:

Industrial Applications

The present invention reveals the mechanism of action of a differential methylation site (DMR) in the imprinted region (Dlk1-Mirg) where the beautiful buttocks gene is located in regulating individual development, and discloses for the first time the application of a new DMR (SEQ ID No.1) in early breeding of sheep for meat traits. The present invention provides a new molecular breeding method for selecting meat lambs. At the same time, it is disclosed for the first time that knocking out the DMR (SEQ ID No.2) reported in mice can induce mice to lose weight and become smaller in size. The present invention is of great significance for breeding young mammals for meat traits based on DMR in the Dlk1-Mirg region.

Claims

The differentially methylated region is characterized in that the nucleotide sequence of the differentially methylated region is as shown in SEQ ID No.1.
Use of the differentially methylated region according to claim 1 as a methylation marker in any of the following:

(A1) Regulating sheep body weight;

(A2) Identify or assist in identifying body weight traits in sheep.
Use of sheep Gtl2 gene as a marker in any of the following:

(A1) Regulating sheep body weight;

(A2) Identify or assist in identifying body weight traits in sheep.
Use of a substance for detecting the methylation level of the differentially methylated region according to claim 1 in identifying or assisting in identifying the weight trait of sheep.
Application of a substance for detecting the expression amount of sheep Gtl2 gene in identifying or assisting in identifying the body weight trait of sheep.
The use according to any one of claims 2 to 5, characterized in that the sheep weight is the early body weight of the sheep.
The use according to claim 6, characterized in that the early body weight of the sheep is the body weight of the sheep at one month of age.
Use of the differentially methylated region described in claim 1 as a methylation marker in breeding for sheep meat traits.
Application of the sheep Gtl2 gene as a marker in breeding sheep for meat traits.
Use of a substance for detecting the methylation level of the differentially methylated region described in claim 1 in breeding for sheep meat traits.
Application of substances for detecting the expression level of sheep Gtl2 gene in sheep meat trait breeding.
The use according to any one of claims 8 to 11 is characterized in that the sheep meat trait breeding is early sheep meat trait breeding.
The use according to claim 4 or 10 is characterized in that: the substance used to detect the methylation level of the differentially methylated region of sheep according to claim 1 is a reagent and/or instrument used for methylation sequencing of the DNA fragment shown in SEQ ID No. 1 in the sheep genome.
The use according to claim 5 or 11 is characterized in that the substance used to detect the expression level of sheep Gtl2 gene is a primer pair composed of two single-stranded DNAs shown in SEQ ID No. 3 and SEQ ID No. 4.
A method for identifying or assisting in identifying a sheep weight trait comprises the following steps (B1) or (B2):

(B1) detecting the methylation level of the differentially methylated region of claim 1 in the sheep to be tested, wherein the weight of the sheep to be tested having a relatively low methylation level in the differentially methylated region is higher or is a candidate to be higher than the weight of the sheep to be tested having a relatively high methylation level in the differentially methylated region;

(B2) detecting the expression level of the Gtl2 gene in the sheep to be tested, wherein the body weight of the sheep to be tested with a relatively high expression level of the Gtl2 gene is higher or is higher than that of the sheep to be tested with a relatively low expression level of the Gtl2 gene.
The method according to claim 15, characterized in that the sheep weight is the sheep's early body weight.
The method according to claim 16, characterized in that the early body weight of the sheep is the body weight of the sheep at one month of age.
Use of the method according to any one of claims 15 to 17 in breeding sheep for meat traits.
A method for breeding a meat-type sheep breed comprises the following steps (D1) or (D2):

(D1) using the sheep to be tested whose methylation level of the differentially methylated region identified by the method of claim 15 is relatively low as a parent for breeding;

(D2) using the sheep to be tested with relatively high expression level of the Gtl2 gene identified by the method of claim 15 as parents for breeding.
The application of the differentially methylated regions of the mouse Dlk1-Mirg region as methylation markers in regulating mouse body weight;

The nucleotide sequence of the differentially methylated region of the mouse Dlk1-Mirg region is shown in SEQ ID No.2.
Application of mouse Meg3 gene as a marker in regulating mouse body weight.
A method for constructing a mouse model with reduced body weight comprises the following steps: reducing the expression level of the mouse Meg3 gene to obtain the mouse model with reduced body weight.
Use of the differentially methylated region of the mammalian Dlk1-Mirg region or the gene in which it is located in any of the following:

(A1) regulating the body weight of the mammal;

(A2) identifying or assisting in the identification of the body weight trait of the mammal.