CN115927468A

CN115927468A - Influenza virus report plasmid containing U6 promoter and construction method and application thereof

Info

Publication number: CN115927468A
Application number: CN202210990472.0A
Authority: CN
Inventors: 户义; 姜涛; 李靖; 杨文广; 冯烨; 张森; 陈月红; 康晓平; 李裕昌; 李威
Original assignee: Academy of Military Medical Sciences AMMS of PLA
Current assignee: Academy of Military Medical Sciences AMMS of PLA
Priority date: 2022-08-18
Filing date: 2022-08-18
Publication date: 2023-04-07

Abstract

The invention relates to an influenza virus report plasmid containing a U6 promoter, and a construction method and application thereof, and belongs to the field of report plasmid construction. The reporter plasmid comprises a U6 promoter sequence and a functional fragment of interest, wherein the functional fragment of interest comprises a 3'NCR sequence of the IAV gene, a forward inserted reporter gene sequence and a 5' NCR sequence of the IAV gene; there is also a terminator sequence consisting of 6 thymines. The nucleotide sequence of the functional target fragment is shown as SEQ ID NO.1 or SEQ ID NO. 2. The reporter plasmid utilizes the U6 promoter for transcription, overcomes the difference between species, and can be expressed in a wide range of hosts. The invention uses the report plasmid as a molecular model for detecting virus replication, and can quickly detect virus replication and the activity of influenza virus polymerase. Meanwhile, the report plasmid can also be used for screening anti-influenza virus drugs and subsequently evaluating the curative effect of influenza vaccines.

Description

Influenza virus report plasmid containing U6 promoter and construction method and application thereof

Technical Field

The invention relates to an influenza virus report plasmid containing a U6 promoter, and a construction method and application thereof, belonging to the field of report plasmid construction.

Background

GFP, green fluorescent protein. eGFP (Enhanced Green Fluorescent Protein) is a GFP mutant line, and is a mutant of GFP (phenylalanine → leucine variation) that is used more frequently, and emits fluorescence intensity more than 6 times greater than that of GFP.

NanoLuc luciferase (Nluc), a small molecule enzyme (19.1 kDa) that has been genetically engineered, is one of the best bioluminescent reporter genes currently in use. This enzyme is 100 times brighter than firefly (Photinus pyralis) or Renilla (Renilla reniformis) luciferases, which use a novel substrate, furimazine, to produce high intensity luminescence. The bioluminescent reaction is independent of ATP while suppressing background luminescence for maximum detection sensitivity.

Vector plasmid MLM3636 is a plasmid vector that can be officially downloaded and purchased through Addgene.

At present, plaque tests, TCID50 tests and the like are used as means for conventionally detecting and separating viruses and influenza virus replication, however, the methods have high requirements on experimental operation, take long time (the conventional method needs 3-4 days), and the interpretation result has certain subjectivity.

Currently, cell imaging or living animal imaging is mainly realized by adopting a report virus (tracer virus) to realize efficient real-time evaluation of a virus proliferation process. The reporter virus utilizes caspase recognition sites or 2A peptide of the porcine teschovirus to insert reporter genes into gene segments of NA, NS1 or PB2 of the influenza virus, constructs recombinant viruses capable of expressing the reporter proteins, and realizes imaging after infecting host cells or host animals. However, due to the limitation of a light-emitting mechanism, the requirement on the virus titer is generally higher, and the difference with the natural virus infection process exists; meanwhile, the quantum efficiency of the biological light source is low, and the living body continuous imaging observation cannot be realized; in addition, the recombinant virus genome structure is unstable, has biological characteristic difference with wild phenotype, the replication capacity and pathogenicity are changed, and the reporter gene is easy to lose; in particular, the reporter virus strategy implies the need to construct a new tracer virus for each subtype of influenza virus.

Besides the recombinant fluorescent tracing virus strategy, a tracing method for marking a fluorescent group or a quantum dot on the surface of the virus is also provided. However, the traditional direct labeling method lacks specificity and interferes with the binding of the virus to host cells, which affects the virus infection efficiency. The envelope labeling of enveloped viruses is realized by host cell membrane phospholipid exchange, the biotinylation or the alkynylation of the viral envelope is further realized by phospholipid derivatives, and the labeling of live viruses by quantum dots or fluorescent probes is realized by the interaction with streptavidin or azido, but the modification efficiency of azido and other groups is greatly influenced by the metabolic pathway and metabolic efficiency of phospholipid derivatives, the number of labeled groups is limited, and the requirement on experimental technology is high. In summary, the current influenza virus imaging technology mainly focuses on obtaining a visual tracer virus capable of emitting a stable photochemical signal, is essentially limited to the virus modification category, and has a plurality of defects in virus use compatibility, high sensitivity and usability.

Disclosure of Invention

The invention aims to solve the technical problem of providing a report plasmid aiming at influenza virus, a construction method and application thereof so as to overcome the problems.

The technical scheme for solving the technical problems is as follows: an influenza virus reporter plasmid containing a U6 promoter comprising a U6 promoter sequence and a functional fragment of interest including the 3'ncr sequence of the IAV gene, a forward inserted reporter sequence, the 5' ncr sequence of the IAV gene and a terminator sequence consisting of 6 thymines (T).

On the basis of the technical scheme, the invention can be further improved as follows.

Further, the U6 promoter sequence is a human type U6 promoter sequence, the reporter gene is eGFP or Nluc, the 3'NCR sequence of the IAV gene is a 3' NCR sequence of an NP gene of A/WSN/1933 (type A H1N 1), the 5'NCR sequence of the IAV gene is a 5' NCR sequence of an NP gene of A/WSN/1933 (type A H1N 1), and the nucleotide sequence of the functional target fragment is shown as SEQ ID NO.1 or SEQ ID NO. 2.

Besides eGFP or Nluc, the reporter gene can be replaced by other reporter genes, such as: the fluorescent protein can be green fluorescent protein, mCherry, RFP and other red fluorescent proteins; the luciferase may be firefly luciferase (Fluc), renilla luciferase (Rluc), gauss luciferase (Gluc), etc., as well as other alkaline phosphatases (SEAP), chloramphenicol Acetyltransferase (CAT), glucuronidase (GUS). NCR sequences flanking the reporter Gene in addition to the 5 'and 3' NCR gene sequences from the NP fragment of A/WSN/1933 (type H1N 1), they can also be derived from the NCR sequences of different segment genes of different subtypes of IAV viruses, such as: NCR of M gene of A/PR8/1934 (H1N 1A).

Further, the nucleotide sequence of the influenza virus reporter plasmid containing the U6 promoter is shown as SEQ ID NO.3 or SEQ ID NO. 4.

The invention has the beneficial effects that: the reporter plasmid is used as a molecular model for detecting virus replication, so that virus replication and influenza virus polymerase activity can be rapidly detected (viruses can be detected in 8-10 hours of virus infection at the fastest speed, the viruses can be detected at the lowest speed of MOI =0.001, and the results can be read in 24 hours conventionally), and the reporter gene expression and the virus replication level are in a certain linear relation; meanwhile, the report plasmid can also be used for screening anti-influenza virus medicines and subsequently evaluating the curative effect of influenza vaccines. In addition, the promoter of the reporter plasmid is U6, and the U6 promoter is used for transcription, so that the species difference can be overcome, and the reporter plasmid can be expressed in a wide host body.

Meanwhile, the invention can induce the expression of specific fluorescent protein or luciferase after the virus infects cells without modifying the virus, thereby avoiding the defect that the biological characteristics are changed unpredictably after the virus is recombined and modified into the report virus; meanwhile, the invention is suitable for the induction of infection of various subtype influenza viruses and has broad spectrum. The invention can be used for constructing in vivo and in vitro tracing of influenza virus infection in the future, and can also be used for screening antiviral drugs and rapid evaluation research.

The invention also relates to a construction method of the influenza virus report plasmid containing the U6 promoter, which comprises the steps of using a plasmid containing a corresponding report gene as a template for the functional target segment, designing a corresponding primer, adding a corresponding base and a corresponding enzyme cutting site, carrying out PCR reaction, and inserting the PCR reaction into a vector plasmid MLM3636 in a molecular cloning mode such as enzyme cutting and connection to form the influenza virus report plasmid containing the U6 promoter.

Further, the construction method comprises the following steps:

(1) Designing functional target fragments with two-end NCR and middle open reading frame eGFP or Nluc of NP fragment containing A/WSN/1933 (type A H1N 1), and adding NCR sequence of influenza fragment and corresponding restriction enzyme cutting site BsmBI; adding a restriction enzyme site BsmBI into a template which is pCAG-eGFP or pNL1.1 as the template, and carrying out PCR amplification;

when pCAG-eGFP was used as a template, the primer sequences were as follows:

eGFP-F-BsmBI:ATACGTCTCGACACCGAGTAGAAACAGGGTAGATAATCACTC；

eGFP-R-BsmBI:ATACGTCTCGAGCTTAAAAAAGTAGAAACAAGGGTATTTTTCTTTACTTGTA；

when pNL1.1 is taken as a template, the primer sequences are as follows:

Nluc-F-BsmBI:ATACGTCTCGTACCATGGTCTTCACACTCGAAGATTTCG；

Nluc-R-BsmBI:ATACGTCTCGTTCTTTACGCCAGAATGCGTTCGCACAG；

(2) Recovering and purifying PCR products by glue;

(3) Performing single enzyme digestion on the PCR product obtained by glue recovery and purification and the vector plasmid MLM3636 for 3h by using restriction enzyme BsmBI to obtain a target fragment enzyme digestion product and a vector plasmid MLM3636 enzyme digestion product;

(4) Using T4 ligase to cut the target fragment enzyme and the vector plasmid MLM3636 enzyme;

(5) Adding the ligation product into DH5 alpha competent cells for transformation;

(6) And (3) selecting monoclonal bacterial plaque, carrying out shake culture on a shaking table, carrying out bacterial liquid PCR identification, carrying out amplification culture on positive bacterial liquid, carrying out plasmid extraction, and carrying out sequencing identification, wherein the influenza virus reporter plasmid containing the U6 promoter is obtained after the sequencing is correct.

Further, in the step (1), the PCR reaction system is as follows: 1 mu L of template, 2 mu L of P1038-U6-F-BsmBI primer, 2 mu L of P1038-U6-R-BsmBI primer, 25 mu L of PCR Mix, and adding deionized water to 50 mu L; the PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 1min; denaturation at 95 ℃ 30sec, annealing at 55 ℃ 30sec, extension at 72 ℃ for 1min,35 cycles; extending for 10min at 72 ℃; the temperature is reduced to 12 ℃ to end the reaction.

Further, between the step (1) and the step (2), the method also comprises the following steps: taking 50 mu L of PCR amplification product, adding 10 mu L of loading buffer solution, mixing uniformly, then spotting on 1.5% agarose gel, and carrying out 15V/cm electrophoresis.

Further, in the step (2), the PCR product is cut and recovered by using a gel recovery kit, and the specific operation steps are carried out according to the kit instruction. Wherein, the Gel recovery kit can specifically select a PureLink Quick Gel Extraction and PCR Purification Combo kit Gel recovery kit.

Further, in the step (3), the enzyme digestion system for recovering the purified PCR product is 1 μ g of DNA, 2 μ L of BsmBI, 5 μ L of enzyme digestion buffer solution, and adding deionized water to 50 μ L; the enzyme cutting system of the vector plasmid MLM3636 is DNA500ng, bsmBI2 muL, enzyme cutting buffer solution 5 muL, and deionized water is added to 50 muL; digesting the reaction system at 55 ℃ for 3h and 80 ℃ for 20min, then separating the digested reaction system by 1.5% agarose gel electrophoresis, and cutting and recovering the functional target fragment by using a gel recovery kit. Wherein, the Gel recovery kit can specifically select a PureLink Quick Gel Extraction and PCR Purification Combo kit Gel recovery kit.

Further, in the step (4), the linker system is 10 XT 4 ligase buffer 2. Mu.L, the vector plasmid MLM3636 enzyme digestion product is 4. Mu.L, the target fragment enzyme digestion product is 13. Mu.L, and T4 ligase is 1. Mu.L.

Further, the step (5) is specifically as follows: adding 10 mu L of the connecting product into 50 mu L of DH5 alpha competent cells, uniformly mixing, standing for 30min in an ice bath, thermally shocking for 60sec at 42 ℃, immediately placing on ice for 2-3min, adding 950 mu L of non-resistant LB culture medium, incubating for 1h at 37 ℃, sucking 100 mu L of bacterial liquid coated plates to ampicillin-resistant LB culture medium, and incubating for 12h at 37 ℃; after the bacteria grow out, selecting a single bacterial colony to 1000 mu L of ampicillin-resistant LB culture medium for culturing for 6-8h, carrying out PCR identification on the bacterial liquid by using Taq PCR premixed liquid and upstream and downstream primers consistent with the step (1) to obtain a strip with the consistent target strip size, namely positive bacterial liquid; positive bacteria liquid PCR reaction system: 12.5 mu L of Taq PCR Master Mix, 1 mu L of each upstream primer and downstream primer, 2 mu L of bacterial liquid, and adding nuclease-free water to 25 mu L; the PCR reaction conditions were as follows: preheating at 94 ℃ for 4min,1 cycle, denaturation at 94 ℃ for 30sec, annealing at 58 ℃ for 30sec, and extension at 72 ℃ for 60sec;35 cycles, extension 72 ℃ 10min,1 cycle 1kb/min.

Further, the step (6) specifically comprises: and (3) carrying out PCR identification on bacterial liquid, adding 10ul of positive bacterial liquid into a 10mL bacterial tube containing 8mL of liquid culture medium (containing 100mg/L Amp) with ampicillin resistance, carrying out shake cultivation at the constant temperature of 37 ℃ for 12-16h, carrying out plasmid extraction and sequencing, wherein the influenza virus reporter plasmid containing the U6 promoter is obtained after the sequencing is correct.

Further, the PCR identification of the bacterial liquid specifically comprises the following steps: taking 2 mu L of bacterial liquid as a template, carrying out PCR amplification by using upstream and downstream primers consistent with the step (1), and detecting the PCR amplification product by using agarose gel electrophoresis with the concentration of 1.5%.

The invention also relates to application of the influenza virus report plasmid containing the U6 promoter, which is used for detecting influenza virus samples, screening drugs or evaluating influenza antibody titer.

Further, the method for detecting the influenza virus sample comprises the following steps: cells of the influenza virus reporter plasmid containing the U6 promoter are transfected 24 hours in advance by using clinically isolated virus stock solution, the expression of fluorescent protein or luciferase is induced by virus replication, and after 1-2 days, the expression of the fluorescent protein is observed under a fluoroscope or the expression of the luciferase is observed under the detection of a bioluminescence detector after cell lysate is combined with a luciferase substrate, so that objective judgment is provided for virus infection.

Further, the method for screening the drugs comprises the following steps: infecting the cells of the influenza virus reporter plasmid containing the U6 promoter 24 hours ahead of the infection of the virus stock solution, replacing cell culture media containing different drug concentrations after infection and adsorption for 1-2 hours, and observing the expression condition of fluorescent protein or luciferase detected by a bioluminescence detector after 1-2 days to evaluate the action effect of the drug.

Further, the method for evaluating the influenza antibody titer comprises the following steps: cells transfected with the influenza virus reporter plasmid containing the U6 promoter are infected by a mixture of virus stock solution and influenza antibodies with different concentrations for 24 hours in advance, and the titer of the influenza antibodies is evaluated by observing the expression of fluorescent protein or luciferase detected by a bioluminescence detector 1-2 days later.

Drawings

FIG. 1 is a schematic diagram of the reaction of a reporter plasmid of the present invention into a host cell;

FIG. 2 is a graph showing the results of 24-hour inverted fluorescence microscopy on the expression of a reporter gene in 293T cells transfected by different subtypes of influenza virus ribonucleoprotein complex (vRNP) and reporter plasmid U6-eGFP for 24 hours with respect to the reporter plasmid U6-eGFP;

fig. 3 is a graph showing the results of fluorescent protein expression under a fluorescent microscope after influenza a/CA/07/2009 (H1N 1 a) viruses infected with different PFUs for 24 hours on cells previously transfected with a reporter plasmid (cell number = 10000/well) in a 96-well plate against a reporter plasmid U6-eGFP;

FIG. 4 is a graph showing the results of the expression of a reporter gene in 293T cells transfected by different subtypes of influenza virus ribonucleoprotein complex (vRNP) and reporter plasmids U6-Nluc for 24 hours for the reporter plasmids U6-Nluc;

FIG. 5 is a graph showing the results of fluorescent protein expression 24 hours after influenza A virus A/CA/07/2009 (H1N 1A) infected cells previously transfected with a reporter plasmid (cell number = 10000/well) in a 96-well plate with different PFUs against the reporter plasmid U6-Nluc;

FIG. 6 is a fluorescence microscopic result chart of fluorescence expression detected 24 hours after drug addition for reporter plasmid U6-eGFP, which can be used as a reference for drug action effect;

FIG. 7 is a graph showing the results of 72-hour luciferase expression inhibition by adding different concentrations of the drug method Pilatavir after 24-hour transfection of a reporter plasmid into MDCK cells, followed by infection of the cells with influenza A virus A/PR8/1934 (type A H1N 1) with MOI =0.1, for the reporter plasmid U6-Nluc;

fig. 8 shows the results of adding different concentrations of the drug method plavavir inhibition, 72-hour luciferase expression inhibition curves, and calculating the drug EC50 after transfecting the reporter plasmid into MDCK cells 24 hours in advance, infecting the cells with influenza virus a/PR8/1934 (H1N 1 a) with MOI =0.1, for the reporter plasmid U6-Nluc.

Detailed Description

The principles and features of this invention are described below in conjunction with examples which are set forth to illustrate, but are not to be construed to limit the scope of the invention.

The invention provides an influenza virus reporter plasmid containing a U6 promoter, which comprises a U6 promoter sequence and a functional target fragment, wherein the functional target fragment comprises a 3'NCR sequence of an IAV gene, a forward inserted reporter gene, a 5' NCR sequence of the IAV gene and a terminator sequence consisting of 6 thymines (T).

Wherein the U6 promoter sequence is a human type U6 promoter sequence, the reporter gene is eGFP or Nluc, the 3'NCR sequence of the IAV gene is a 3' NCR sequence of an NP gene of A/WSN/1933 (type A H1N 1), the 5'NCR sequence of the IAV gene is a 5' NCR sequence of an NP gene of A/WSN/1933 (type A H1N 1), and the nucleotide sequence of the functional target fragment is shown as SEQ ID NO.1 or SEQ ID NO. 2.

<xnotran> SEQ ID NO.1 , 3'NCR (AGTAGAAACAGGGTAGATAATCACTCACTGAGTGACATCGGTACC), eGFP (ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA) 5'NCR (AGAAAAATACCCTTGTTTCTAC). </xnotran>

Further, the nucleotide sequence of the influenza virus reporter plasmid containing the U6 promoter based on the functional target segment of SEQ ID NO.1 is shown as SEQ ID NO. 3.

<xnotran> , Aat II (1) (GACGTC), bamHI (1) (GGATCC), U6 promoter (GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC), 3'NCR (AGTAGAAACAGGGTAGATAATCACTCACTGAGTGACATCGGTACC), eGFP (ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA), 5'NCR (AGAAAAATACCCTTGTTTCTAC), hindIII (1) (AAGCTT), pci I (ACATGT), pBR322-R sequencing primer (complement) (GACAGGACTATAAAGATACCAG), bsaI (complement) (GAGACC), from pUC19 (PciI- -AatII) (ACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCT </xnotran> ).

<xnotran> SEQ ID NO.2 , 3'NCR (AGTAGAAACAGGGTAGATAATCACTCACTGAGTGACATCGGTACC), nanoluc (Nluc) (ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCG) 5'NCR (AGAAAAATACCCTTGTTTCTAC). </xnotran>

Further, the nucleotide sequence of the influenza virus reporter plasmid containing the U6 promoter based on the functional target segment of SEQ ID NO.2 is shown as SEQ ID NO. 4.

<xnotran> , Aat II (1) (GACGTC), U6 promoter (GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC), 3'NCR (AGTAGAAACAGGGTAGATAATCACTCACTGAGTGACATCGGTACC), nanoluc (Nluc) (ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCG) 5'NCR (AGAAAAATACCCTTGTTTCTAC), hindIII (1) (AAGCTT), pci I (ACATGT), pBR322-R sequencing primer (complement) (GACAGGACTATAAAGATACCAG), from pUC19 (PciI- -AatII) (ACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCT </xnotran> ).

The invention also relates to a construction method of the influenza virus report plasmid containing the U6 promoter, which comprises the steps of using a plasmid containing a corresponding report gene as a template for the functional target segment, designing a corresponding primer, adding a corresponding base and a corresponding enzyme cutting site, carrying out PCR reaction, and inserting the PCR reaction into a vector plasmid MLM3636 through molecular cloning technologies such as enzyme cutting, connection and the like to form the influenza virus report plasmid containing the U6 promoter.

Further, the construction method comprises the following steps:

(1) Designing functional target fragments with two-end NCR and middle open reading frame eGFP or Nluc of NP fragment containing A/WSN/1933 (type A H1N 1), and adding NCR sequence of influenza fragment and corresponding restriction enzyme cutting site BsmBI; adding a restriction enzyme site BsmBI and a corresponding base sequence into a template by taking pCAG-eGFP (eGFP refers to a DNA sequence for coding and enhancing green fluorescent protein, and is a known common gene) or pNL1.1 as the template, and carrying out PCR amplification;

when pCAG-eGFP was used as a template, the primer sequences were as follows:

eGFP-U6-F-BsmBI: ATACGTCTCGACACCGAGTAAAACAGGGTGAATCATCACTC (shown in SEQ ID NO. 5);

eGFP-U6-R-BsmBI of ATACGTCTCGAGCTTAAAAGTAGAAACAAGGGTATTTTTCTTTACTTGTA (SEQ ID NO. 6);

when pNL1.1 is used as a template, the primer sequences are as follows:

Nluc-F-BsmBI ATACGTCTCGTACCATGGTCTCACCATGGTCTTCACACTCGAAGATTTCG (shown in SEQ ID NO. 7);

Nluc-R-BsmBI: ATACGTCTCGTTCTTTACGCCAGAATGCGTTCGCACAG (shown in SEQ ID NO. 8);

wherein the restriction enzyme sites are GCTAGC and GCGGCC respectively, the base (ATA) in front of the restriction enzyme sites is a protective base, and both the forward direction and the reverse direction are BsmBI;

(2) Recovering and purifying PCR products by glue;

(3) Performing single enzyme digestion on the PCR product recovered and purified from the gel and the vector plasmid MLM3636 for 3h by using restriction enzyme BsmBI to obtain a target fragment enzyme digestion product and a vector plasmid MLM3636 enzyme digestion product;

(4) Connecting the target fragment enzyme digestion product with a vector plasmid MLM3636 enzyme digestion product by using T4 ligase;

Further, between the step (1) and the step (2), the method also comprises the following steps: mu.L of the PCR amplification product was taken, 10. Mu.L of the loading buffer was added thereto, mixed well, and spotted on 1.5% agarose gel (weight fraction, hereinafter referred to the same agarose gel as used in the above description), followed by electrophoresis at 15V/cm using 50. Mu.L of DNA standard molecular weight DL 2000Marker as a reference.

Further, in the step (2), the PCR product gel recovery kit is cut and recovered, and the specific operation steps are carried out according to the kit instruction. Wherein the Gel recovery kit can be a Gel recovery kit produced by PureLink Quick Gel Extraction and PCR Purification Combo kit.

Further, in the step (3), the enzyme digestion system for recovering the purified PCR product is 1 μ g of DNA, 2 μ L of BsmBI, 5 μ L of enzyme digestion buffer solution, and adding deionized water to 50 μ L; the enzyme cutting system of the vector plasmid MLM3636 is DNA500ng, bsmBI2 muL, enzyme cutting buffer solution 5 muL, and deionized water is added to 50 muL; digesting the reaction system at 55 ℃ for 3h and 80 ℃ for 20min, then separating the digested reaction system by 1.5% agarose gel electrophoresis, and cutting and recovering the functional target fragment by using a gel recovery kit. Wherein the Gel recovery kit can be a Gel recovery kit produced by PureLink Quick Gel Extraction and PCR Purification Combo kit. All endonucleases used were purchased from NEB.

Further, the step (5) is specifically as follows: adding 10 mu L of the connecting product into 50 mu L of DH5 alpha competent cells, uniformly mixing, standing for 30min in an ice bath, thermally shocking for 60sec at 42 ℃, immediately placing on ice for 2-3min, adding 950 mu L of non-resistant LB culture medium, incubating for 1h at 37 ℃, sucking 100 mu L of bacterial liquid coated plates to ampicillin-resistant LB culture medium, and incubating for 12h at 37 ℃; after the bacteria grow out, selecting a single bacterial colony to 1000 mu L of ampicillin-resistant LB culture medium for culturing for 6-8h, carrying out PCR identification on the bacterial liquid by using Taq PCR premixed liquid and upstream and downstream primers consistent with the step (1) to obtain a strip with the consistent target strip size, namely positive bacterial liquid; positive bacteria liquid PCR reaction system: 12.5 mu L of Taq PCR Master Mix, 1 mu L of each of the upstream primer and the downstream primer, 2 mu L of bacterial liquid, and adding nuclease-free water to 25 mu L; the PCR reaction conditions were as follows: preheating at 94 ℃ for 4min,1 cycle, denaturation at 94 ℃ for 30sec, annealing at 58 ℃ for 30sec, and extension at 72 ℃ for 60sec;35 cycles, extension 72 ℃ 10min,1 cycle 1kb/min.

Further, the step (6) is specifically as follows: and carrying out PCR identification on the bacterial liquid, adding 10ul of positive bacterial liquid into a 10mL bacterial tube containing 8mL liquid culture medium containing ampicillin resistance (containing 100mg/L Amp +), carrying out shake cultivation at the constant temperature of 37 ℃ for 12-16h, carrying out plasmid extraction and sequencing, wherein the influenza virus reporter plasmid containing the U6 promoter is obtained after the sequencing is correct.

The reaction principle of the report plasmid of the invention entering the host cell is as follows: as shown in FIG. 1, when the recombinant reporter plasmid enters the host cell, the polymerase of the host cell binds to the U6 promoter, which initiates the transcription of the recombinant reporter plasmid to obtain a transcript completely complementary to the vRNA of the similar virus, wherein the transcript contains the two-terminal NCR sequences of the influenza A/WSN/1933 (H1N 1A) strain and the middle enhanced green fluorescent protein/Nluc luciferase, and when the influenza virus enters the cell, the influenza polymerase (consisting of the influenza proteins PB1, PB2, PA) recognizes the two-terminal NCR of the transcript gene, which promotes the replication and transcription of the completely complementary gene of the vRNA of the similar virus, and finally the eGFP/Nluc is translated and expressed by the complementary strand of the negative strand.

The functional verification experiment of the report plasmid containing the U6 promoter disclosed by the invention is as follows:

example 1: reporter plasmid U6-eGFP

(I) cotransfection of reporter plasmid U6-eGFP and influenza virus vRNP composition plasmid:

(1) 293T cells were prepared one day in advance, and the prepared 293T cells were plated in a 96-well plate at 100. Mu.L/well in complete medium dilution, and the cell count per well was about 1.0X 10 ⁴ And 5% CO at 37% ₂ (volume fraction, hereinafter, referring to CO) ₂ Same as shown in the figure) was cultured overnight in a cell culture chamber.

(2) After the 96-well plate cells have grown to 80% -90%, the supernatant medium is discarded by aspiration, replaced with fresh serum-free complete medium, incubated at 37 ℃ with 5% CO ₂ And (5) the cell culture box is used for standby.

(3) Each transfection plasmid was diluted to 100ng/uL in advance, and the infectious clone plasmid of NP/PA/PB1/PB2 of the corresponding influenza virus and the reporter plasmid were transfected into 293T cells using a Lipofectamine 3000 transfection kit. The transfection system was as follows:

liposome:

Lipofectamine 3000	0.3μl
		Opti-MEM	4.7μl
total of	5μl

DNA:

Plasmids	100ng(0.2×5)
		P3000	0.2μl
Opti-MEM	3.8μl
		In total	5μl

Standing the above systems for 5min, mixing, standing for 15min, adding 10 μ L of DNA-liposome complex/well into 293T cell, and 5% CO ₂ And incubated in an incubator at 37 ℃. The experimental procedure set up a negative cell control.

The observation under the 24-hour inverted fluorescence microscope showed the result shown in FIG. 2 (the white dots in the figure are green fluorescence).

FIG. 2 shows the expression of reporter gene 24 hours after the influenza virus ribonucleoprotein complex (vRNP) and reporter plasmid co-transfect 293T cells; can respectively detect different subtypes of influenza A viruses, negative control is that the report plasmid and the empty vector are transfected together, and no obvious fluorescence is seen in the result. The infectious clone plasmids of the influenza virus vRNP complex are constructed by taking pHW2000 as a vector, so that the influenza virus ribonucleoprotein complex (composed of influenza virus NP/PA/PB1/PB2 and influenza virus vRNA) is a basic functional unit for replication and transcription of the influenza virus.

(II) different multiplicity of infection of influenza virus separation supernatant infection in advance 24 hours transfected reporter plasmid cells. The experimental procedure was as follows:

1) 293T cells were prepared one day in advance, and the prepared 293T cells were plated in a 96-well plate at 500. Mu.L/well in complete medium dilution, and the cell count per well was about 1X 10 ⁴ And 5% CO at 37% ₂ The cells were cultured in a cell incubator overnight.

(2) After the 96-well plate cells reached 80% -90% full growth, the supernatant medium was discarded by aspiration, replaced with fresh serum-free complete medium, incubated at 37 ℃ and 5% CO ₂ And (5) the cell culture box is used for standby.

(3) Influenza infectious clone plasmids were transfected into 293T cells using the Lipofectamine 3000 transfection kit. The transfection system was as follows:

liposome:

Lipofectamine 3000	0.3μl
		Opti-MEM	4.7μl
total of	5μl

DNA：

Plasmids	100ng
		P3000	0.2μl
Opti-MEM	3.8μl
		Total of	5μl

Standing the above systems for 5min, mixing, standing for 15min, adding 10 μ L of DNA-liposome complex/well into 293T cell, and 5% CO ₂ And incubated at 37 ℃ for 24 hours in an incubator.

(4) Prepare Opti-MEM low serum medium containing 0.5ug/mL TPCK pancreatin.

(5) Diluting the virus infection concentration: mixing 60uL of virus stock solution with 540uL of virus serum-free maintenance medium, and diluting the virus stock solution by 10 times; and diluted as such until pfu =100;

(6) Discard old medium from 96-well plate, pfu =1 × 10 ⁵ 、1.0×10 ⁴ 、1.0×10 ³ 、1.0×10 ² Viral fluid/ml (MOI = 1/0.1/0.01/0.001) infected cells (cell number 10000/well) and maintained the diseaseAdsorbing the cells for 1 hour, and slightly shaking the cells for 1 time every 15 minutes;

(7) After 1 hour, the virus fluid in the cell well was aspirated, and the cells were washed 2 times with PBS buffer, after which the Opti-MEM low serum medium containing 0.5ug/mL of TPCK pancreatin was replaced; luciferase expression was observed after 24 hours, and the results are shown in FIG. 3 (green fluorescence in the white dots).

Fig. 3 shows fluorescent protein expression 48 hours after influenza a/CA/07/2009 (H1N 1 a) infection with different PFUs on cells previously transfected with reporter plasmids (cell number = 10000/well) in 96-well plates; mock is uninfected influenza virus. The test effect of different infection titer (representing the strength of virulence) is proved, and the infection of different virus titer and the expression of the fluorescent protein have a certain linear relation, namely, the higher the virus titer is, the more the expression amount of the fluorescent protein is.

Example 2: reporter plasmid U6-Nluc

(one) the reporter plasmid U6-Nluc is cotransfected with influenza virus vRNP constitutive plasmid:

(3) Each transfection plasmid was diluted to 100ng/uL in advance, and the infectious clone plasmid of NP/PA/PB1/PB2 of the corresponding influenza virus and the reporter plasmid were transfected into 293T cells using the Lipofectamine 3000 transfection kit. The transfection system was as follows:

liposome:

Lipofectamine 3000	0.3μl
		Opti-MEM	4.7μl
total of	5μl

DNA:

Plasmids	Total 100ng
		P3000	0.2μl
Opti-MEM	3.8μl
		In total	5μl

Standing the above systems for 5min, mixing, standing for 15min, adding 10 μ L of DNA-liposome complex/well to 293T cells, 5% CO ₂ And cultured in an incubator at 37 ℃. Negative cell controls were established during the experiment.

After 24 hours, luciferase substrate was mixed with cell supernatant, and cell lysates were taken after 3 minutes of incubation to measure luciferase signals, as shown in FIG. 4.

FIG. 4 is a diagram showing the results of the expression of reporter gene in 293T cells transfected by different subtypes of influenza virus ribonucleoprotein complex expression plasmids and their empty vector plasmids and reporter plasmids together for 24 hours (three multiple wells are provided in influenza virus infected cells of the same subtype). Different subtypes of influenza virus all induce luciferase expression.

FIG. 5 is a graph showing the results of reporter gene expression after MDCK cells transfected with reporter plasmids U6-Nluc 24 hours in advance are infected with the same subtype influenza virus at different MOIs (three multiple wells are set for the same subtype influenza virus infected cells). Viruses of different viral titers induced luciferase expression, with some linear relationship between the two.

Further, influenza virus samples to be detected, which are clinically collected by a nasal swab and a pharyngeal swab at present, are stored at low temperature and sent back to a laboratory, clinical samples are inoculated to canine kidney epithelial cells (sensitive to influenza virus infection) or chick embryos for amplification culture through conventional virus separation operation, and whether the samples are infected by the virus or not is judged by observing cytopathic effect or further extracting viral nucleic acid to perform real-time fluorescence quantitative PCR through 3-4 days or even one week of culture, so certain subjective judgment and relatively more manpower are undoubtedly needed.

The method for detecting the influenza virus sample comprises the following steps: cells (such as canine kidney epithelial cells sensitive to influenza virus infection and 293T cells with high transfection efficiency) of the influenza virus reporter plasmid containing the U6 promoter are transfected by clinically isolated virus stock solution 24 hours in advance, expression of fluorescent protein or luciferase is induced by virus replication, and after 1-2 days, expression of the fluorescent protein is observed under a fluoroscope or luciferase expression is observed under detection of a bioluminescence detector after cell lysate is combined with a luciferase substrate, so that objective judgment is provided for virus infection and certain operation labor is reduced.

Further, the method for screening the drug comprises the following steps: infecting the virus stock solution 24 hours ahead of time to transfect the cell of the influenza virus report plasmid containing the U6 promoter, after infecting and adsorbing for 1-2 hours, replacing the cell culture medium containing different drug (the effect target point of the drug is influenza virus polymerase), after 1-2 days, observing the expression condition of the fluorescent protein or the expression condition of the luciferase detected by a bioluminescence detector to evaluate the effect of the drug, mainly evaluating the effect of the drug by comparing with a control group which is not added with the drug and observing whether the expression of the fluorescent protein is changed, wherein the smaller the expression amount of the general fluorescent protein is, thereby proving that the effect of the drug is better. For example, as shown in fig. 6, based on the reporter plasmid U6-eGFP, when the drug is detected 24 hours after dosing, the fluorescence expression can be seen to be obviously reduced along with the increase of the concentration of the drug-induced viravir, and can be used as a reference for the drug effect. For another example, as shown in fig. 7, after the reporter plasmid is transfected to MDCK cells 24 hours in advance based on the reporter plasmid U6-Nluc, after the cells are infected with influenza virus a/PR8/1934 (H1N 1 a) with MOI =0.1, the drug effect is evaluated by luciferase expression conditions by adding different concentrations of the drug plavavir, and the lower the expression is, the better the drug inhibition effect is; FIG. 8 is a luciferase Inhibition curve plotted against Inhibition of luciferase expression, and the corresponding drug EC50 was calculated based on Inhibition rate = (RLUinfested cells-RLUtested compound)/(RLUinfested cells-RLUmock induced cells). Times.100%.

Further, the method for evaluating the influenza antibody titer comprises the following steps: cells transfected with the influenza virus reporter plasmid containing the U6 promoter are infected by a mixture of virus stock solution and influenza antibodies with different concentrations for 24 hours in advance, and after 1-2 days, the titer of the influenza antibodies is evaluated by observing the expression condition of fluorescent protein or luciferase detected by a bioluminescence detector, wherein the smaller the amount of the fluorescent protein/luciferase expressed is, so that the better the neutralization titer of the antibodies is proved.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

Claims

1. An influenza virus reporter plasmid comprising a U6 promoter, comprising a U6 promoter sequence and a functional target fragment, wherein the functional target fragment comprises a 3'NCR sequence of an IAV gene, a forward inserted reporter gene sequence, and a 5' NCR sequence of an IAV gene. There is also a terminator sequence consisting of 6 thymines.

2. The influenza virus reporter plasmid containing the U6 promoter according to claim 1, wherein the U6 promoter sequence is human U6 promoter sequence, the reporter gene is eGFP or Nluc, the 3'NCR sequence of the IAV gene is 3' NCR sequence of NP gene of A/WSN/1933 (H1N 1A), the 5'NCR sequence of the IAV gene is 5' NCR sequence of NP gene of A/WSN/1933 (H1N 1A), and the nucleotide sequence of the functional target fragment is represented by SEQ ID No.1 or SEQ ID No. 2.

3. The influenza virus reporter plasmid containing the U6 promoter according to claim 2, wherein the nucleotide sequence of the influenza virus reporter plasmid containing the U6 promoter is shown as SEQ ID No.3 or SEQ ID No. 4.

4. The method for constructing the influenza virus reporter plasmid containing the U6 promoter according to any one of claims 1 to 3, wherein the influenza virus reporter plasmid containing the U6 promoter is constructed by using a plasmid containing a corresponding reporter gene as a template, designing a corresponding primer, adding a corresponding base and an enzyme cleavage site, performing PCR reaction, and inserting the PCR reaction into a vector plasmid MLM 3636.

5. The building method according to claim 4, characterized by comprising the steps of:

(1) Designing functional target fragments with the open reading frames at two ends NCR and the middle part of NP fragment containing A/WSN/1933 (A type H1N 1) as eGFP or Nluc, and adding corresponding restriction enzyme cutting sites BsmBI; adding a restriction enzyme site BsmBI into a template which is pCAG-eGFP or pNL1.1 as the template, and carrying out PCR amplification;

when pCAG-eGFP was used as a template, the primer sequences were as follows:

eGFP-F-BsmBI:ATACGTCTCGACACCGAGTAGAAACAGGGTAGATAATCACTC；

eGFP-R-BsmBI:ATACGTCTCGAGCTTAAAAAAGTAGAAACAAGGGTATTTTTCTTTACTTGTA；

when pNL1.1 is used as a template, the primer sequences are as follows:

Nluc-F-BsmBI:ATACGTCTCGTACCATGGTCTTCACACTCGAAGATTTCG；

Nluc-R-BsmBI:ATACGTCTCGTTCTTTACGCCAGAATGCGTTCGCACAG；

(2) Recovering and purifying PCR products by glue;

6. The method according to claim 5, wherein in step (1), the PCR reaction system is as follows: 1 mu L of template, 2 mu L of P1038-U6-F-BsmBI primer, 2 mu L of P1038-U6-R-BsmBI primer, 25 mu L of PCR Mix, and adding deionized water to 50 mu L; the PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 1min; denaturation at 95 ℃ 30sec, annealing at 55 ℃ 30sec, extension at 72 ℃ for 1min,35 cycles; extending for 10min at 72 ℃; cooling to 12 ℃ to finish the reaction;

between the step (1) and the step (2), the method also comprises the following steps: taking 50 mu of LPCR amplification product, adding 10 mu of loading buffer solution, mixing uniformly, then spotting on 1.5% agarose gel, and carrying out 15V/cm electrophoresis;

in the step (2), the PCR product is cut and recovered by adopting a gel recovery kit, and the specific operation steps are carried out according to the kit instruction;

in the step (3), the enzyme digestion system for recovering the purified PCR product is 1 mu g of DNA, 2 mu L of BsmBI and 5 mu L of enzyme digestion buffer solution, and deionized water is added to 50 mu L; the enzyme cutting system of the vector plasmid MLM3636 is DNA500ng, bsmBI2 muL, enzyme cutting buffer solution 5 muL, and deionized water is added to 50 muL; digesting the reaction system at 55 ℃ for 3h and 80 ℃ for 20min, then separating the digested reaction system by 1.5% agarose gel electrophoresis, and cutting and recovering the functional target fragment by using a gel recovery kit;

in the step (4), the connector system is 10 XT 4 ligase buffer 2 uL, the vector plasmid MLM3636 enzyme digestion product is 4 uL, the target fragment enzyme digestion product is 13 uL, and T4 ligase is 1 uL.

7. The construction method according to claim 6, wherein the step (5) is specifically: adding 10 mu L of the connecting product into 50 mu L of DH5 alpha competent cells, uniformly mixing, standing for 30min in an ice bath, thermally shocking for 60sec at 42 ℃, immediately placing on ice for 2-3min, adding 950 mu L of non-resistant LB culture medium, incubating for 1h at 37 ℃, sucking 100 mu L of bacterial liquid coated plates to ampicillin-resistant LB culture medium, and incubating for 12h at 37 ℃; after bacteria grow out, selecting a single bacterial colony to 1000 mu L of ampicillin resistant LB culture medium for culturing for 6-8h, carrying out PCR identification on the bacterial liquid by using Taq PCR premixed liquid and upstream and downstream primers consistent with the step (1) to obtain a strip with the consistent target strip size, namely positive bacterial liquid; positive bacteria liquid PCR reaction system: 12.5 mu L of Taq PCR Master Mix, 1 mu L of each upstream primer and downstream primer, 2 mu L of bacterial liquid, and adding nuclease-free water to 25 mu L; the PCR reaction conditions were as follows: preheating at 94 ℃ for 4min,1 cycle, denaturation at 94 ℃ for 30sec, annealing at 58 ℃ for 30sec, and extension at 72 ℃ for 60sec;35 cycles, extension 72 ℃ for 10min,1 cycle for 1kb/min;

the step (6) is specifically as follows: carrying out PCR identification on bacteria liquid, adding 10ul of positive bacteria liquid into a 10mL bacteria tube containing 8mL liquid culture medium containing ampicillin resistance, carrying out shake culture at the constant temperature of 37 ℃ for 12-16h, carrying out plasmid extraction and sequencing, wherein the influenza virus report plasmid containing the U6 promoter is obtained when the sequencing is correct;

the PCR identification of the bacterial liquid is specifically as follows: taking 2 mu L of bacterial liquid as a template, carrying out PCR amplification by using upstream and downstream primers consistent with the step (1), and detecting the PCR amplification product by using agarose gel electrophoresis with the concentration of 1.5%.

8. The use of the influenza virus reporter plasmid containing the U6 promoter according to claim 1 or 2 for influenza virus sample detection, drug screening or evaluation of influenza antibody titer.

9. The use of claim 8, wherein the influenza virus sample is detected by: infecting cells of the influenza virus reporter plasmid containing the U6 promoter by using clinically isolated virus stock solution 24 hours in advance, inducing expression of fluorescent protein or luciferase by virus replication, and observing the expression of the fluorescent protein under a fluoroscope after 1-2 days or observing the expression of the luciferase under the detection of a bioluminescence detector after cell lysate is combined with a luciferase substrate, thereby providing objective judgment for virus infection; the method for screening the drugs comprises the following steps: infecting the virus stock solution 24 hours ahead of time to transfect the cells of the influenza virus reporter plasmid containing the U6 promoter, replacing cell culture media containing different drug concentrations after infection and adsorption for 1-2 hours, and observing the expression condition of fluorescent protein or luciferase detected by a bioluminescence detector after 1-2 days to evaluate the action effect of the drug; the method for evaluating the titer of the influenza antibody comprises the following steps: cells transfected with the influenza virus reporter plasmid containing the U6 promoter are infected by a mixture of virus stock solution and influenza antibodies with different concentrations for 24 hours in advance, and the titer of the influenza antibodies is evaluated by observing the expression condition of fluorescent protein or luciferase detected by a bioluminescence detector 1-2 days later.