CN113913406A - Method for detecting SARS-CoV-269: 70del site - Google Patents
Method for detecting SARS-CoV-269: 70del site Download PDFInfo
- Publication number
- CN113913406A CN113913406A CN202111518202.1A CN202111518202A CN113913406A CN 113913406 A CN113913406 A CN 113913406A CN 202111518202 A CN202111518202 A CN 202111518202A CN 113913406 A CN113913406 A CN 113913406A
- Authority
- CN
- China
- Prior art keywords
- cov
- sars
- 70del
- site
- cas13a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Abstract
The invention discloses a CRISPR-Cas13a system for detecting SARS-CoV-269: 70del locus and a crRNA used by the system. The system includes a Cas13a protein and crRNA; the target sequence of SARS-CoV-269: 70del site is located at 21753-21786 th site of SARS-CoV-2 genome, and lacks tacatg 6 bases; the sequence of the crRNA at the SARS-CoV-269: 70del site is shown in SEQ ID NO. 3. Experiments prove that the crRNA provided by the invention can realize high-sensitivity and high-specificity detection on SARS-CoV-269: 70del site nucleic acid by activating Cas13a, and the sensitivity reaches single copy (1 copy/test). The invention has important application value.
Description
Technical Field
The invention belongs to the technical field of molecular diagnosis, and particularly relates to a CRISPR-Cas13a system for detecting SARS-CoV-269: 70del sites and crRNA used by the system.
Background
COVID-19 is a disease caused by Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Over time, SARS-CoV-2 developed a number of new Variants (VOCs) of interest. The B.1.1.7 lineage (VOC 202012/01, 501 Y.V1) which first appeared in southern England is characterized by 17 mutations, including 14 amino acid substitutions and 3 in-frame deletions located in ORF 1 a/b, ORF8, spike (S) and N gene region 2. While 69:70del located in the S gene region has proven to be of potential biological interest. 69:70del is a histidine (h 69) at position 69 and a valine (v 70) deletion mutation at position 70 in the n-terminal domain (ntd) of SARS-CoV-2 Spike protein (S protein), and 69:70del can cause the S protein S1 subunit to be changed in conformation. Studies have shown that 69:70del occurs mainly with the mutation sites responsible for immune escape, enhancing the cellular infectivity of the virus. Furthermore, based on the current monitoring data 69:70del often occurs simultaneously with the mutations N501Y, N439K and Y453F located in the S protein. Research has proved that the infection power of 69:70del B.1.1.7 virus variant strain to cell is obviously enhanced by simulating amino acid mutation of S protein of B.1.1.7 variant strain with pseudovirus. Studies have shown that the mechanism by which 69:70del enhances viral infectivity is probably achieved by increasing the S protein density on the surface of the virion. At present, there are two main methods for detecting SARS-CoV-2 variant. The first method, which is currently mainly used, is a gene sequencing method, which mainly includes first-generation sequencing and next-generation sequencing. While this technique is important for identifying new variations and enables the tracking of VOCs in real time, it is time consuming and requires extensive data analysis and cannot be performed in all laboratories. Other detection methods are mainly based on RT-qPCR, and although faster than gene sequencing methods, the sample processing is complex and the requirement on the precision of the instrument is high.
In 2017, in4 months, U.S. researchers established a nucleic acid detection technology with Sensitivity reaching the attorney level (single copy) and specificity reaching the single base, namely a nucleic acid detection platform SHEERLOCK (specific High Sensitivity enzyme Reporter UnLOCKing) based on CRISPR-Cas13a, and by utilizing the non-specific cleavage activity of Leptotriia wadei Cas13a protein (LwCas 13 a) and combining a recombinant Polymerase Amplification technology (Recombinase Polymerase Amplification, RPA) capable of efficiently amplifying a target fragment, the rapid, cheap and High-Sensitivity detection of trace nucleic acid is realized. Studies have shown that Cas13a can be used for identification of zika and dengue viruses in biological samples (blood or urine) and further to distinguish gene sequences of african and american strains, and also for identification of specific types of bacteria. After virus or bacterial nucleic acid is identified, the specific crRNA can be directly used for pathogen typing, a large amount of complex upstream experiment work is avoided due to the ultrahigh sensitivity, a biological sample can be directly amplified for detection, and the pretreatment process of the sample is shortened. Therefore, the technology has great application prospect in the fields of basic research, diagnosis and treatment.
Disclosure of Invention
The invention aims to combine the PCR technology with CRISPR based on Cas13a protein, finally provides a section of crRNA which can target SARS-CoV-269: 70del locus and activate CRISPR-Cas13a system through design, construction and screening, and the CRISPR-Cas13a system constructed by the target can specifically detect SARS-CoV-269: 70del locus.
In order to realize the purpose, the invention preferably selects the crRNA with the best activation effect on the CRISPR-Cas13a system to detect the SARS-CoV-269: 70del site according to 4 crRNAs respectively designed at the SARS-CoV-269: 70del site and the corresponding wild type SARS-CoV-269: 70 site on the basis of the principle of the CRISPR-Cas13a system and the selection principle of a target sequence.
The first objective of the invention is to provide a CRISPR-Cas13a system for detecting SARS-CoV-269: 70del site.
The CRISPR-Cas13a system for detecting SARS-CoV-269: 70del site provided by the invention comprises a 1) or a 2):
a1) cas13a protein and crRNA;
a2) a complex formed by the Cas13a protein and the crRNA;
the crRNA comprises an anchor sequence for binding with Cas13a protein and a guide sequence targeting a SARS-CoV-269: 70del site target sequence;
the target sequence of the wild type SARS-CoV-269: 70 locus is located at 21753-21780 of SARS-CoV-2 genome (GenBank ID: NC-0455512.2). The target sequence of SARS-CoV-269: 70del site is located at 21753-21786 of SARS-CoV-2 genome (GenBank ID: NC-0455512.2) and lacks tacatg 6 bases.
In the CRISPR-Cas13a system, the target sequence of the SARS-CoV-269: 70del site is shown as SEQ ID NO: 1. The SARS-CoV-269: 70 site wild type target sequence is shown in SEQ ID NO. 2. .
In the CRISPR-Cas13a system, the sequence of the crRNA of the SARS-CoV-269: 70del site is shown as SEQ ID NO: 3. The SARS-CoV-269: 70 site wild type crRNA sequence is shown in SEQ ID NO. 4. . Wherein, the 1 st to 38 th positions of SEQ ID NO. 3 and SEQ ID NO. 4 are both anchoring sequences for binding with Cas13a protein; the 39 th to 66 th sites are all guide sequences targeting SARS-CoV-269: 70del target sequences.
In the CRISPR-Cas13a system, the Cas13a protein is an LwCas13a protein.
The second objective of the invention is to provide a kit for detecting SARS-CoV-269: 70del site.
The kit for detecting the SARS-CoV-269: 70del locus provided by the invention comprises the CRISPR-Cas13a system for detecting the SARS-CoV-269: 70del locus.
Further, the kit also comprises a primer pair for specific PCR amplification of SARS-CoV-269: 70del site target sequence. The primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO. 7 and a single-stranded DNA molecule shown in SEQ ID NO. 8.
Further, the kit also comprises other reagents for specifically amplifying the SARS-CoV-269: 70del site target sequence and other reagents for detecting the amplification product. The method for specific amplification of SARS-
Other reagents for the target sequence at the CoV-269:70 del site include buffers and/or ddH2O; the other reagents for detecting the amplification product include all or part of the following reagents: NTP (e.g., NTP Mix), T7RNA polymerase, RNase inhibitor, reporter RNA (RNAse Alert v2, report)RNA is an RNA molecule having a signal reporting function), and RNase free water.
The kit may further include a carrier in which the following judgment criterion A or judgment criterion B is recorded:
the judgment standard A is as follows: if the fluorescence intensity value of the detection system of the sample to be detected is higher than that of the negative control (ddH) within the same detection time2O) the fluorescence intensity value is more than 3 times higher (including the situation that the fluorescence intensity value of the detection system of the sample to be detected is 3 times higher than that of the negative control fluorescence intensity value), the sample to be detected contains or is candidate to contain SARS-CoV-269: 70del locus, otherwise the sample to be detected does not contain or is candidate to not contain SARS-CoV-269: 70del locus.
The judgment standard B: if the fluorescence intensity value of the sample detection system to be detected is greater than or equal to 600 a.u., the sample to be detected contains or is candidate to contain SARS-CoV-269: 70del locus, otherwise the sample to be detected does not contain or is candidate to not contain SARS-CoV-269: 70del locus.
A third object of the present invention is to provide any one of the following:
A1) the crRNA of any of the above;
A2) any of the Cas13a protein and crRNA described above;
A3) a complex formed by any one of the Cas13a protein and crRNA described above;
A4) any one of the primer pairs described above.
A third object of the invention is to provide any of the following applications:
B1) use of any of the systems described above or any of the kits described above or any of the materials described above for the detection or assisted detection of a SARS-CoV-269: 70del site;
B2) use of any of the above systems or any of the above kits or any of the above materials in the manufacture of a product for detecting or aiding in the detection of the SARS-CoV-269: 70del locus;
B3) use of any of the above systems or any of the above kits or any of the above substances in detecting or aiding detection of whether a sample to be tested contains a SARS-CoV-269: 70del site;
B4) use of any of the above systems or any of the above kits or any of the above substances in the preparation of a product for detecting or aiding in the detection of whether a sample to be tested contains a SARS-CoV-269: 70del site;
B5) use of any one of the above systems or any one of the above kits or any one of the above substances in screening or assisted screening of SARS-CoV-269: 70del site control drugs;
B6) use of any one of the above systems or any one of the above kits or any one of the above substances in the preparation of products for screening or assisted screening of SARS-CoV-269: 70del locus prophylactic and therapeutic drugs;
B7) use of any of the above in the preparation of any of the above kits.
A final object of the present invention is to provide a method for detecting or aiding in the detection of the SARS-CoV-269: 70del site.
The method for detecting or assisting in detecting SARS-CoV-269: 70del locus provided by the invention comprises the following steps:
C1) taking nucleic acid of a sample to be detected as a template, and carrying out PCR amplification by adopting a primer pair consisting of a single-stranded DNA molecule shown in SEQ ID NO. 7 and a single-stranded DNA molecule shown in SEQ ID NO. 8 to obtain a PCR product;
C2) preparing a CRISPR-Cas13a detection system, and then carrying out fluorescence detection; the CRISPR-Cas13a detection system comprises the PCR product, Cas13a protein, crRNA, NTP and T7RNA polymerase; meanwhile, water is used for replacing the PCR product as a negative control;
C3) detecting the fluorescence intensity of the CRISPR-Cas13a detection system, and judging whether the sample to be detected contains SARS-CoV-269: 70del sites according to the intensity of the fluorescence intensity: if the fluorescence intensity value of the sample detection system to be detected is more than 3 times higher than that of the negative control in the same detection time (including the situation that the fluorescence intensity value of the sample detection system to be detected is 3 times higher than that of the negative control), the sample to be detected contains or is candidate to contain SARS-CoV-269: 70del locus, otherwise the sample to be detected does not contain or is candidate to not contain SARS-CoV-269: 70del locus. Or at any time in practical application, the judgment can be carried out according to the following method: if the fluorescence intensity value of the detection system of the sample to be detected is greater than or equal to 600 a.u (3 times of the highest value of the fluorescence intensity of the negative control), the sample to be detected contains or is candidate to contain SARS-CoV-269: 70del locus, otherwise, the sample to be detected does not contain or is candidate to not contain SARS-CoV-269: 70del locus.
Further, in step C2), the CRISPR-Cas13a detection system comprises the PCR product, Cas13a protein described in any above, crRNA described in any above, NTP, T7RNA polymerase, reporter RNA, rnase inhibitor.
Further, in step C1), the reaction conditions for the PCR amplification may be: 5min at 42 ℃, 10min at 85 ℃ (5 s at 95 ℃, 30s at 55 ℃, 30s at 72 ℃) multiplied by 40 cycles.
Further, in the step C3), the reaction conditions are as follows: reading fluorescence intensity value every 1-3min at 35-39 deg.C for more than 20 times.
Further, in step C3), the reaction conditions are as follows: the fluorescence intensity values were read every 2min at 37 ℃ and 20-40 times.
Any of the above samples to be tested can be blood sample, urine, tissue sample of organ (such as liver, spleen, kidney, etc.), cell, etc.
The method for detecting or assisting in detecting SARS-CoV-269: 70del site provided by the invention can be a non-disease diagnosis and treatment method and a disease diagnosis and treatment method. Wherein, the non-disease diagnosis and treatment method can detect whether the SARS-CoV-269: 70del locus is contained in the cell before and after the application of the medicine, for example, when the SARS-CoV-269: 70del locus prevention and treatment medicine is screened at the cell level.
In any of the above systems or kits or materials or uses or methods, the SARS-CoV-269: 70del site can be a 69:70del site of a variant of SARS-CoV-2, such as a 69:70del site of variants B.1.1.7 and B.1.525. In a specific embodiment of the invention, the SARS-CoV-269: 70del site is a 69:70del site gene constructed from a SARS-CoV-2 standard wild strain (GenBank ID: NC-0455512.2).
The invention provides a PCR amplification primer pair for SARS-CoV-269: 70del site detection, a target sequence to be detected and specific crRNA capable of targeting the target sequence based on CRISPR-Cas13a nucleic acid detection technology through design, construction and screening, wherein the crRNA can realize high-sensitivity and high-specificity detection on SARS-CoV-269: 70del site nucleic acid by activating Cas13a, and the sensitivity reaches single copy (1 copy/test). The invention has important application value.
Drawings
FIG. 1 shows the detection of the amplification efficiency of 3 primer pairs by agarose gel electrophoresis.
FIG. 2 shows the result of specific screening of 4 SARS-CoV-269: 70del site crRNA.
FIG. 3 shows the results of sensitivity screening of 4 SARS-CoV-269: 70del site crRNA.
FIG. 4 shows the result of specific screening of 4 SARS-CoV-269: 70 wild-type crRNA.
FIG. 5 shows the sensitivity screening results of 4 SARS-CoV-269: 70 wild-type crRNA.
FIG. 6 shows the sensitivity of CRISPR-Cas13a detection containing SARS-CoV-269: 70del-crRNA-1 (80 min).
FIG. 7 shows the sensitivity result (80 min) of CRISPR-Cas13a detection containing SARS-CoV-269: 70 wild-type crRNA-2.
FIG. 8 shows that CRISPR-Cas13a for SARS-CoV-269: 70del site did not cross-react when detecting other ARS-CoV-2 variant sites.
FIG. 9 shows that CRISPR-Cas13a targeting SARS-CoV-269: 70del site does not cross-react when detecting other pathogens.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The quantitative tests in the following examples, all set up three replicates and the results averaged.
The reagents and sources thereof referred to in the following examples are as follows: SOC liquid medium, NTP Mix (Solarbio), EDTA, 1M Tris pH 8.0, a report RNA kit (RNAse Alert v 2), an agarose gel electrophoresis DNA purification recovery kit (Tiangen Biochemical), an RNA Synthesis kit (T7 Quick High Yield RNA Synthesis kit), an RNase inhibitor (Murine RNase inhibitor), T7RNA polymerase (NEB), RNA purification magnetic beads (Agenour RNAclean XP, Beckman Coulter), ExTaq Mix (TaKaRa), dithiothreitol (DTT, Beijing Jingxin Koch Biotech, Inc.), ampicillin sodium (North Huabei pharmaceutical Co., Ltd.), yeast extract, tryptone (OxOID), Tris equilibrium phenol (TBD 0001-like organism, 0001 HY).
The expression, purification and activity identification of LwCas13a protein involved in the following examples are described in the invention named as "a nucleic acid target effective against dengue virus based on Cas13a and its application", and the method disclosed in the patent document with the publication number of CN 08715849A. The method comprises the following specific steps:
(1) LwCas13a protein induced expression, purification and identification
The LwCas13a expression plasmid Addgene-PC013-Twinstrep-SUMO-huLwCas13a is obtained from an Addgene platform, the LwCas13a expression plasmid is transferred into Rosetta (DE3) competent cells, TB liquid culture medium is cultured at 37 ℃ and 200rpm for more than 14h, and 1:100 is inoculated with new Amp+Resistant TB medium was cultured at 37 ℃ and 300rpm to an OD600=0.6 or so, IPTG was added to a final concentration of 500uM, and the medium was cultured at 18 ℃ and 200rpm for 16 hours. Collecting thallus by centrifugation, collecting protein supernatant after ultrasonication, performing primary purification by using His label carried by LwCas13a protein through Ni column (HisTrac HP column, GE Healthcare Life Science), performing enzyme digestion on the carried label part by using SUMO, performing secondary purification by using isoelectric point characteristic of LwCas13a protein through cation exchange column (Unigel-50 SP, Nano-Micro Tech), and performing experimental processThe protein obtained in each step is identified by SDS-PAGE protein electrophoresis, protein size analysis is carried out, and meanwhile, the initial identification of the protein is carried out by using a His tag antibody, so that the induced protein is determined as the target protein.
(2) LwCas13a protein concentration and activity identification
The protein activity detection kit (Shanghai Biyuntian biotechnology, Inc.) is used for detecting the concentration of LwCas13a protein, and a reporter RNA kit (invittrgen) is used for detecting the fluorescence value of emitted light under 490nm excitation and 520nm wavelength, so as to judge whether the Cas13a protein in the system is activated. That is, in the presence of target RNA and crRNA corresponding to the target, whether Cas13a protein can be activated and cleaves the reporter RNA in the system to make it fluoresce, and at the same time, non-specific target is set for specific detection, and human cell total RNA is used as background RNA to detect whether the system will be interfered by the background RNA. The detection result shows that the LwCas13a protein with high purity is obtained by purification, no RNase is polluted, a complex formed by the protein and crRNA can be activated by a specific target sequence and shears the report RNA in a system to emit a fluorescent signal, and the protein can be used for subsequent detection experiments. Meanwhile, when the final concentration of the protein is 45nM, a significant change in fluorescence signal can be detected.
Example 1 design and preparation of crRNA and PCR primers for use in the invention
1. CrRNA design and preparation for use in the invention
(1) Synthesis of primer sequences
The present invention designs crRNA at SARS-CoV-269: 70del site and wild site separately. The 5 ' end of crRNA has 39nt repetitive sequence, the segment sequence can be combined with LwCas13a protein, 5'-GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3', single-stranded DNA sequence as template is designed as repetitive sequence + target sequence, T7 sequence (5'-TAATACGACTCACTATAGGG-3') + partial repetitive sequence (5'-GATTTAGACTACCCCAA-3') is used as upstream primer, reverse complementary sequence about 20bp downstream of target sequence is used as downstream primer (Table 1). Each sequence in table 1 was synthesized.
(2) PCR amplification
The sequences shown in Table 1 were synthesized by Beijing Tianyihuiyuan, respectively. The corresponding crRNA was synthesized by DNA synthesis, annealing, transcription, and purification according to the methods of study in the literature (J.T. Huang, et al. Clinical chemistry 61, 290-296 (2015)).
The above sequence is substituted with ddH2Diluting the obtained product into 10 mu M. The PCR reaction system was prepared as follows: the upstream primer is T7-crRNA-F, the templates are respectively Wt6970/Mut6970-crRNA1, 2, 3 and 4, and the corresponding downstream primer is respectively Wt6970/Mut6970-crRNA1, 2, 3 and 4-R.
XX-crDNA represents templates of Mut6970-crRNA1, Mut6970-crRNA2, Mut6970-crRNA3, Mut6970-crRNA4, Wt6970-crRNA1, Wt6970-crRNA2, Wt6970-crRNA3 and Wt6970-crRNA 4.
And carrying out PCR amplification on the PCR reaction system to obtain a PCR product.
And (3) PCR reaction conditions: heat denaturation at 95 deg.C for 5 min; 30s at 95 ℃, 30s at 55 ℃ and 15s at 72 ℃ for 38 cycles; automatically extending for 10min at 72 ℃; the PCR product was stored at 4 ℃.
(3) PCR product purification
And (3) purifying the PCR product obtained in the step (2) by using Tris equilibrium phenol (tertiary sample organism) to obtain a purified PCR product. The method comprises the following specific steps: taking 500 mu L of Tris balance phenol, adding chloroform with the same volume, oscillating, uniformly mixing, centrifuging for a short time, and discarding the supernatant; adding 150 mu L of phenol-chloroform mixed solution into the PCR product, and centrifuging at 12,000rpm for 1min after uniformly mixing; taking the supernatant to a new 1.5mL centrifuge tube, adding absolute ethyl alcohol to ensure that the ratio of the supernatant to the ethyl alcohol is 3:7, centrifuging at 12,000rpm for 10min, and discarding the supernatant; 200 μ L of 75% ethanol was added, centrifuged at 12,000rpm for 10min, and the supernatant was discarded (this step was performed three times in total). The resulting precipitate was air dried at room temperature (about 10 min), 50 μ L of RNase-free water was added, and the Nanodrop was used to detect the concentration and stored at-20 ℃.
(4) Transcription
Taking 1 μ g of the purified PCR product obtained in step 3, and transcribing crRNA using T7 transcription kit (NEB).
(4-1) first, a crRNA transcription system is prepared. The crRNA transcription system is shown in Table 3.
(4-2) after uniformly mixing the crRNA transcription system, transcribing overnight at 37 ℃ to obtain a transcription product;
(4-3) adding 20 muL of RNase-free water into the transcription product, adding 2 muL of DNase I (used for removing redundant DNA), uniformly mixing, and incubating at 37 ℃ for 15min to obtain crRNA.
(5) Purification of crRNA
The crRNA obtained by transcription in step (4) was purified according to the Agencour RNA Clean XP (Beckman Coulter) protocol. The method comprises the following specific steps: and (3) vibrating and mixing the magnetic beads uniformly, adding the magnetic beads with the volume being 1.8 times of that of the transcription product, beating for 10 times or whirling for 30s to uniformly mix the magnetic beads and the transcription system, and standing for 5min at room temperature. And (3) placing the reaction system on a magnetic frame, and standing for 5-10 min to separate the magnetic beads. Slightly sucking out liquid in the system to avoid sucking out magnetic beads, adding 200 muL 70% ethanol (prepared without RNase water) into the magnetic beads, incubating at room temperature for 30s, and sucking out the ethanol; the process was repeated to wash the beads 3 times. And (5) airing the system at room temperature, and removing ethanol in the system for about 10 min. Adding 50 mu L of RNase-free water, swirling for 30s or blowing for 10 times by using a pipette, sucking out supernatant, putting the supernatant into a 1.5mL centrifuge tube without RNase, and measuring the concentration of crRNA obtained by purification by using a Nanodrop and subpackaging at-80 ℃ for later use.
A total of 8 crrnas were prepared: mut6970-crRNA1, Mut6970-crRNA2, Mut6970-crRNA3, Mut6970-crRNA4, Wt6970-crRNA1, Wt6970-crRNA2, Wt6970-crRNA3 and Wt6970-crRNA4, which are used for detecting SARS-CoV-269: 70del mutation by the following CRISPR-Cas13 a. Transcribing SARS-CoV-269: 70del locus and wild locus detected target point sequence to obtain corresponding ssRNA, detecting with the said crRNA, comparing the signal strength of different crRNAs, and selecting the crRNA with strongest fluorescence signal as the subsequent crRNA.
2. Design of PCR amplification primers
Primers for PCR amplification of SARS-CoV-269: 70del detection target sequences were designed and synthesized with a T7 transcription sequence at the 5' end of the primers, so that the PCR amplified double-stranded DNA (dsDNA) can be recognized by T7RNA polymerase and transcribed (see Table 4). The DNA sequence was synthesized by Beijing Yihuiyuan. 6970-Primer 1-F and 6970-Primer 1-R constitute Primer pair 1 (F1 & R1). 6970-Primer 2-F and 6970-Primer 2-R constitute Primer pair 2 (F2 & R2). 6970-Primer 3-F and 6970-Primer 3-R constitute Primer pair 3 (F3 & R3).
3. Preparation of template standards
(1) Plasmid sequences
Plasmid-69:70del is the sequence from the SARS-CoV-269: 70del site genome as follows: gtctctagtcagtgtgttaatcttacaaccagaactcaattaccccctgcatacactaattctttcacacgtggtgtttattaccctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttcttttccaatgttacttggttccatgctatctctgggaccaatggtactaagaggtttgataaccctgtcctaccatttaatgatggtgtttattttgcttccactgagaagtctaacataataagaggctggatttttggtactactttagattcgaagacccagtccctacttattgttaataacgcta (SEQ ID NO: 5) was inserted into the pSMART-LC vector (Yihuitao, Beijing). Plasmid-69:70del was supplied by Beijing Tianyihuiyuan.
Plasmid-69:70Wt is the sequence from the SARS-CoV-269: 70 wild site genome as follows: tttgtttttcttgttttattgccactagtctctagtcagtgtgttaatcttacaaccagaactcaattaccccctgcatacactaattctttcacacgtggtgtttattaccctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttcttttccaatgttacttggttccatgctatacatgtctctgggaccaatggtactaagaggtttgataaccctgtcctaccatttaatgatggtgtttattttgcttccactgagaagtctaacataataagaggctggatttttggtactactttagattcgaagacccagtccctacttattgttaataacgctactaatgttgttattaaagtctgtgaatttcaat (SEQ ID NO: 6) into the pSMART-LC vector. Plasmid-69:70Wt from Beijing Tianyihuiyuan).
(2) Plasmid portable bag (Whole type gold)
Adding glycerol bacteria (1: 500) into Kan+ Inoculating 10 μ L of glycerol bacteria and 5ml of LB into LB at 37 deg.C overnight at 200rpm, collecting overnight cultured bacteria solution, centrifuging at 10000g for 1min, and removing supernatant (sucking up as much as possible). If the amount of the bacterial liquid is too large, the bacterial liquid can be collected by centrifugation for many times. Adding 250 mu L of colorless solution RB (containing RNase A), and oscillating to suspend bacterial precipitation without leaving small fungus blocks. Adding 250 mu L of blue solution LB, and mixing for 4-6 times by mild up-and-down overturning, so that the thallus is fully cracked to form a blue transparent solution, wherein the color is changed from semi-transparent to transparent blue, and the complete cracking is indicated (not suitable for more than 5 min). Adding 350 muL of yellow solution NB, mixing gently for 5-6 times (color is changed from blue to yellow completely, indicating uniform mixing and complete neutralization) until a compact yellow aggregate is formed, and standing at room temperature for 2 min. 12000g was centrifuged for 5min, and the supernatant carefully pipetted into the spin column. Centrifuging at 12000g for 1min, and discarding the effluent. If the volume of the supernatant is more than 800 mu L, the supernatant can be added into the column for multiple times, and the supernatant is centrifuged as above to discard effluent. Adding 650 mu L of solution WB, centrifuging at 12000g for 1min, and discarding effluent. Centrifuging at 12000g for 1-2min to completely remove the residual WB. Placing the centrifugal column in a clean centrifugal tube, and adding 30-50 μ L EB or deionized water (PH) into the center of the column>7.0) standing at room temperature for 1 min. Centrifuging at 10000g for 1min, eluting DNA, measuring concentration, and storing at-20 deg.C.
(3) ssRNA template preparation
An RNA template was prepared using the obtained plasmid as a template, and template PCR amplification, PCR product purification, transcription, and template RNA purification were performed according to (2) to (5) in step 1 in example 1.
The concentration of the purified RNA is calculated according to the following formula: copies/μ L =6.02 × 1023X (concentration ng/μ L) × 10-9RNA length × 340.
Taking 10 mu L of RNA obtained by transcription into enzyme-free water with corresponding volume to obtain the concentration of 1 x 1013A copies/mu LRNA template standard.
The template obtained from Plasmid-69:70del was the mutant RNA template.
The template obtained from Plasmid-69:70Wt was the wild-type RNA template.
Example 2 establishment of PCR-CRISPR/Cas13a method for detecting SARS-CoV-269: 70del site
The present study utilized PCR to amplify target nucleic acids, transcribing the SARS-CoV-269: 70del detected target sequence to obtain corresponding ssRNA, using the above crRNA: the detection method comprises the steps of detecting Mut6970-crRNA1, Mut6970-crRNA2, Mut6970-crRNA3, Mut6970-crRNA4, Wt6970-crRNA1, Wt6970-crRNA2, Wt6970-crRNA3 and Wt6970-crRNA4, comparing the signal intensity of different crRNAs, and selecting crRNA with stronger fluorescence signal and high sensitivity as subsequent detection crRNA. The specific principle is as follows: the first step is to amplify the target sequence (through denaturation, annealing and extension processes) by using specific primers, and a T7 transcription sequence is arranged at the 5' end of the primers, so that the double-stranded DNA (dsDNA) obtained by PCR amplification can be recognized by T7RNA polymerase and transcribed. In the second step, part of the amplification product is taken out and added into T7RNA polymerase, LwCas13a protein, crRNA capable of recognizing the target sequence and reporter RNA for detecting the target sequence (at 37 ℃). Fluorescent quantitative PCR instrument, FAM channel detection: 30 cycles of 15s at 37 ℃ and 45s at 1min (fluorescence collected).
The method comprises the following specific steps:
1. PCR amplification for detecting SARS-CoV-269: 70del locus template
After the mutant RNA template and the wild type RNA template are respectively subjected to gradient dilution, 2 mu L of each template is taken for PCR amplification, and a PCR product is obtained. The PCR amplification system is shown in Table 5.
The 3 primer pairs synthesized in step 2 of example 1 were used to perform PCR amplification on the wild-type RNA template and the mutant RNA template, respectively, and PCR amplification primers with higher amplification efficiency were selected. The PCR amplification system is shown in Table 5.
Amplification conditions: 5min at 42 ℃, 10min at 85 ℃ (5 s at 95 ℃, 30s at 55 ℃, 30s at 72 ℃) multiplied by 40 cycles; the PCR product was stored at 4 ℃. Configuring 1.5% agarose gel, voltage U =160V, current I =160mA, time T =30min, carrying out electrophoresis detection, and observing an electrophoresis strip.
The results are shown in FIG. 1: primer pair 1 has a higher amplification efficiency than primer pair 2 and primer pair 3, which is 104The template of copies/mu L has obvious bands, and the primer pair 2 and the primer pair 3 are amplified 105Only when the template is copies/mu L, an obvious strip is formed, so that the primer pair 1 is selected as a PCR amplification primer in the follow-up process.
2. LwCas13a detection of PCR amplification product of SARS-CoV-269: 70del site template RNA:
in order to accurately control the reaction temperature and prevent the pollution of the enzyme label plate caused by the sealing property, a fluorescent quantitative PCR instrument is used for subsequent detection. And (3) taking 5 muL of the PCR product obtained by the last step of amplification for detection, wherein the system is shown in Table 6.
Putting the system into a fluorescence quantitative PCR instrument, detecting the change of a fluorescence signal by an FAM channel, setting the wavelength of channel excitation light to be 490nm, the wavelength of emitted light to be 520nm, reacting at 37 ℃ for 15s, reacting at 37 ℃ for 1min for 45s (collecting fluorescence), carrying out 20-40 cycles, reading for 40 times for 80 minutes totally, and detecting the change of fluorescence intensity in the system.
And (4) judging a result: the fluorescence intensity values of the experimental groups were compared to the negative control (ddH) during the same detection time2O) the fluorescence intensity value is more than 3 times higher, or the fluorescence intensity is more than or equal to 600 a.u.
Example 3 specificity and sensitivity detection of SARS-CoV-269: 70del and wild crRNA
1. Optimal screening of SARS-CoV-269: 70del crRNA
In order to screen crRNA with higher detection sensitivity and shorter detection time, PCR amplification is carried out by using the wild type constructed as described above, the 69:70del mutant ssRNA and the designed primers 6970-Primer 1-F and 6970-Primer 1-R. And 4 kinds of Mut6970-crRNA are used to detect ssRNA of 2 sequences respectively.
(1) Synthesis of crRNA primer sequences
The sequences in table 1 were synthesized, and crRNA was synthesized and prepared as in step 1 of example 1.
(2) The mutant RNA template and the wild type RNA template obtained in step 3 of example 1 were respectively diluted in a gradient manner to obtain RNA solutions containing 69:70del gene fragments with different concentrations and 69:70 wild gene fragments with different concentrations, which were 10 in order5 copies/µL、104copies/µL、103copies/µL、102copies/µL、101copies/µL、100copies/µL、10-1copies/µL。
(3) PCR amplification was carried out according to the method of step 1 in example 2 to obtain a PCR amplification product.
(4) After the step (3) is completed, 5 muL of amplification product is taken, different crRNAs are utilized to detect SARS-CoV-269: 70del locus and wild type nucleic acid according to the method of the step 2 in the example 2, and ddH is set at the same time2The amplification product with O as the template served as a negative control.
The detection result shows that the fluorescence value detected by the Mut6970-crRNA2 is higher than that detected by other 3 crRNAs when the same concentration of 69:70del RNA and wild-type RNA are used as detection templates (see figure 2), but 4 crRNAs, namely the Mut6970-crRNA1, the Mut6970-crRNA2, the Mut6970-crRNA3 and the Mut6970-crRNA4 have higher significant difference when the wild-type RNA template and the 69:70del RNA template (namely the mutant RNA template) are distinguished, so that the optimal crRNA cannot be directly selected.
Then, different concentrations of 68:70delRNA after gradient dilution were used as templates for the detection of different crRNA sensitivities. The detection result shows that (see figure 3), the detection sensitivity of the Mut6970-crRNA1 can reach 100The detection sensitivity of copes/mu L, while the detection sensitivity of Mut6970-crRNA2, Mut6970-crRNA3 and Mut6970-crRNA4 can only reach 101copies/μ L. Because the sensitivity and the detection efficiency of the Mut6970-crRNA1 are high, the Mut6970-crRNA1 is used as the first-choice crRNA for SARS-CoV-269: 70del locus detection.
2. SARS-CoV-269: 70 wild-type optimal crRNA screening
In order to screen crRNA with higher detection sensitivity and shorter detection time, PCR amplification is carried out by using the wild type constructed as described above, the 69:70del mutant ssRNA and the designed primers 6970-Primer 1-F and 6970-Primer 1-R. And 4 kinds of Wt6970-crRNA are used to detect ssRNA of 2 sequences respectively.
(1) Synthesis of crRNA primer sequences
The sequences in table 1 were synthesized, and crRNA was synthesized and prepared as in step 1 of example 1.
(2) The mutant RNA template and the wild type RNA template obtained in step 3 of example 1 were respectively subjected to gradient dilution to obtain RNA solutions containing 69:70del gene fragments with different concentrations and 69:70 wild gene fragments with different concentrations, which were 10 in order5 copies/µL、104copies/µL、103copies/µL、102copies/µL、101copies/µL、100copies/µL。
(3) PCR amplification was carried out according to the method of step 1 in example 2 to obtain a PCR amplification product.
(4) After the step (3) is completed, 5 muL of amplification product is taken, different crRNAs are utilized to detect SARS-CoV-269: 70del locus and wild type nucleic acid according to the method of the step 2 in the example 2, and ddH is set at the same time2The amplification product with O as the template served as a negative control.
The detection result shows (see fig. 4), when 69:70del RNA and wild type RNA with the same concentration are used as detection templates, the fluorescence value detected by Wt6970-crRNA3 is higher than that detected by other 3 crRNAs, but 4 crRNAs, namely Wt6970-crRNA1, Wt6970-crRNA2, Wt6970-crRNA3 and Wt6970-crRNA4, have higher significant difference when the wild type templates and the 69:70del RNA templates are distinguished, so that optimal crRNA cannot be directly selected.
Different crRNA sensitivity assays were then performed using different concentrations of 68:70 wild-type RNA after gradient dilution as template. The detection result shows that the detection sensitivity of Wt6970-crRNA2 can reach 10 (see figure 5)1The sensitivity of detection of copies/mu L, Wt6970-crRNA1, Wt6970-crRNA3 and Wt6970-crRNA4 can only reach 102copies/μ L. Due to the fact thatWt6970-crRNA2 has high sensitivity and specificity, so Wt6970-crRNA2 is used as the first choice crRNA for SARS-CoV-269: 70 wild-type locus detection.
Example 4 sensitivity detection of the method of the invention
The two sets of RNA template standards obtained in step 3 in example 1 were respectively subjected to gradient dilution to obtain RNA solutions containing different concentrations of 69:70del gene fragments and different concentrations of 69:70 wild gene fragments, and Mut6970-crRNA1 and Wt6970-crRNA2 were respectively used for detection, so as to detect the sensitivity of the method of the present invention. The method comprises the following specific steps:
1. the mutant RNA template and the wild type RNA template obtained in step 3 of example 1 were subjected to gradient dilution to obtain template standard solutions containing SARS-CoV-269: 70del site gene fragments of different concentrations and wild type gene fragments of different concentrations 69:70, the concentrations being 10 in order5copies/µL、104copies/µL、103copies/µL、102copies/µL、101copies/µL、100copies/µL。
2. PCR amplification was carried out according to the method of step 1 in example 2 to obtain a PCR amplification product.
3. After the step 2 is completed, taking 5 mu L of amplification product to detect SARS-CoV-269: 70del locus and wild type locus nucleic acid based on PCR-CRISPR/Cas13a system according to the method of the step 2 in the example 2, and setting ddH at the same time2The amplification product with O as the template served as a negative control.
The results of the PCR-CRISPR assay showed (see FIG. 6): the SARS-CoV-269: 70 wild-type template detected by Mut6970-crRNA1 has good specificity, no fluorescence signal is detected, while the SARS-CoV-269: 70 wild-type template detected by Mut6970-crRNA1 has fluorescence signal of 105-100The copies/mu L concentration is continuously reduced, but the copies/mu L concentration is obviously different from the wild template detection, so that SARS-CoV-269: 70del locus can be specifically detected by using Mut6970-crRNA1, and the sensitivity reaches single copy (1 copy/mu L); the PCR-CRISPR detection result shows (see figure 7), the SARS-CoV-269: 70del template is detected by using Wt6970-crRNA2, no fluorescence signal is detected, and SA is detected by using Wt6970-crRNA2RS-CoV-269:70 wild-type template, which is at 105-101 Under the copies/mu L concentration, the specificity difference is provided with the 69:70del template detection, so that the specific detection of SARS-CoV-269: 70 wild type locus by using Wt6970-crRNA2 can be realized, and the sensitivity reaches 101copy/µL。
Example 5 specific detection of the method of the invention
1. Specificity of CRISPR-Cas13a of SARS-CoV-269: 70del site in detecting other SARS-CoV-2 variant sites
Using SARS-CoV-269: 70 site wild strain, SARS-CoV-269: 70del site, SARS-CoV-2144 del site, SARS-CoV-2243 del site, SARS-CoV-23675 del site, SARS-CoV-2L 452R site, SARS-CoV-2N 501Y site, SARS-CoV-2P 681H site, SARS-CoV-2D 614G site nucleic acids as detection templates, different viral nucleic acids were detected by the method of example 2 to verify the specificity of the method of the present invention. The method comprises the following specific steps:
(1) PCR amplification was carried out by the method of step 1 in example 2 using nucleic acids of SARS-CoV-269: 70 site wild type strain, SARS-CoV-269: 70del site, SARS-CoV-2144 del site, SARS-CoV-2243 del site, SARS-CoV-23675 del site, SARS-CoV-2L 452R site, SARS-CoV-2N 501Y site, SARS-CoV-2P 681H site, and SARS-CoV-2D 614G site as detection templates, respectively, to obtain PCR amplification products.
(2) After the step (1) is completed, taking 5 μ L of the amplification product to detect each viral nucleic acid based on the CRISPR-Cas13a system according to the method of the step 2 in the example 2, and setting the amplification product with water as a template as a negative control.
The results of CRISPR-Cas13a detection showed (see FIG. 8, 69:70Del-W for SARS-CoV-269: 70 site wild strain, 69:70Del-M for SARS-CoV-269: 70Del site, 144Del for SARS-CoV-2144 Del site, 243Del for SARS-CoV-2243 Del site, 3675Del for SARS-CoV-23675 Del site, L452R for SARS-CoV-2L 452R site, N501Y for SARS-CoV-2N 501Y site, P681H for P681 HSARS-CoV-2P 681H site, D614G for SARS-CoV-2D 614G site, NC for negative control), that the fluorescence signal of the experimental group containing SARS-CoV-269: 70Del site gene began to rise after the reaction started, and the negative controlSexual control group (ddH)2O) and the fluorescence intensity in the experimental group containing other SARS-CoV-2 mutation site nucleic acid does not increase with the time, and the fluorescence intensity of the experimental group containing SARS-CoV-269: 70del gene is obviously higher than that of the negative control and the experimental group containing other SARS-CoV-2 mutation site nucleic acid. The method for detecting SARS-CoV-269: 70del locus based on CRISPR-Cas13a system of the invention has high specificity and no cross reaction exists in the detection process.
2. Specificity of CRISPR-Cas13a of SARS-CoV-269: 70del site in detecting other pathogens
Using SARS-CoV-269: 70del site, H1N1 influenza A virus (H1N 1), SARS virus (SARS), MERS virus (MERS), Coxiella burnet (Cb), Ebola virus (EBOV), HBV virus (HBV), H2N9 influenza virus (H2N9), H4N9 influenza virus (H4N9), H5N9 avian influenza virus (H5N9) and H11N9 influenza virus (H11N9) pathogenic nucleic acids as templates, different viral nucleic acids were detected according to the method of example 2 to verify the specificity of the method of the present invention. The method comprises the following specific steps:
(1) PCR amplification was carried out by the method of step 1 in example 2 using nucleic acids of SARS-CoV-269: 70del site, H1N1 influenza A virus (H1N 1), SARS virus (SARS), MERS virus (MERS), Coxiella burnet (Cb), Ebola virus (EBOV), HBV virus (HBV), H2N9 influenza virus, H4N9 influenza virus, H5N9 avian influenza virus and H11N9 influenza virus pathogens, respectively, as detection templates to obtain PCR amplification products.
(2) After the step (1) is completed, taking 5 μ L of the amplification product to detect each viral nucleic acid based on the CRISPR-Cas13a system according to the method of the step 2 in the example 2, and setting the amplification product with water as a template as a negative control.
The results of the CRISPR-Cas13a assay (see FIG. 9, 69:70Del-M for SARS-CoV-269: 70Del site, NC for negative control), showed that the fluorescence signal of the experimental group containing SARS-CoV-269: 70Del site began to increase after the reaction started, while the fluorescence intensity in the negative control group (ddH 2O) and the experimental group containing other viral nucleic acids did not increase with time, and the fluorescence intensity of the experimental group containing SARS-CoV-269: 70Del site was significantly higher than that of the negative control and other viral groups. The method for detecting SARS-CoV-269: 70del locus based on CRISPR-Cas13a system of the invention has high specificity and no cross reaction exists in the detection process.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
<110> military medical research institute of military science institute of people's liberation force of China
<120> A method for detecting SARS-CoV-269: 70del site
<160>8
<170> PatentIn version 3.5
<210>1
<211>28
<212>DNA
<213>Artificial sequence
<400>1
ggttccatgc tatctctggg accaatgg 28
<210>2
<211>28
<212>DNA
<213>Artificial sequence
<400>2
ttccatgcta tacatgtctc tgggacca 28
<210>3
<211>66
<212>DNA
<213>Artificial sequence
<400>3
gggatttaga ctaccccaaa aacgaagggg actaaaaccc attggtccca gagatagcat 60
ggaacc 66
<210>4
<211>66
<212>DNA
<213>Artificial sequence
<400>4
gggatttaga ctaccccaaa aacgaagggg actaaaactg gtcccagaga catgtatagc 60
atggaa 66
<210>5
<211>334
<212>DNA
<213>Artificial sequence
<400>5
gtctctagtc agtgtgttaa tcttacaacc agaactcaat taccccctgc atacactaat 60
tctttcacac gtggtgttta ttaccctgac aaagttttca gatcctcagt tttacattca 120
actcaggact tgttcttacc tttcttttcc aatgttactt ggttccatgc tatctctggg 180
accaatggta ctaagaggtt tgataaccct gtcctaccat ttaatgatgg tgtttatttt 240
gcttccactg agaagtctaa cataataaga ggctggattt ttggtactac tttagattcg 300
aagacccagt ccctacttat tgttaataac gcta 334
<210>6
<211>400
<212>DNA
<213>Artificial sequence
<400>6
tttgtttttc ttgttttatt gccactagtc tctagtcagt gtgttaatct tacaaccaga 60
actcaattac cccctgcata cactaattct ttcacacgtg gtgtttatta ccctgacaaa 120
gttttcagat cctcagtttt acattcaact caggacttgt tcttaccttt cttttccaat 180
gttacttggt tccatgctat acatgtctct gggaccaatg gtactaagag gtttgataac 240
cctgtcctac catttaatga tggtgtttat tttgcttcca ctgagaagtc taacataata 300
agaggctgga tttttggtac tactttagat tcgaagaccc agtccctact tattgttaat 360
aacgctacta atgttgttat taaagtctgt gaatttcaat 400
<210>7
<211>45
<212>DNA
<213>Artificial sequence
<400>7
aattctaata cgactcacta tagggagaac tcaattaccc cctgc 45
<210>8
<211>20
<212>DNA
<213>Artificial sequence
<400>8
Claims (10)
1. A CRISPR-Cas13a system for detecting a SARS-CoV-269: 70del site comprising a 1) or a 2):
a1) cas13a protein and crRNA;
a2) a complex formed by the Cas13a protein and the crRNA;
the crRNA comprises an anchor sequence for binding with Cas13a protein and a guide sequence targeting a SARS-CoV-269: 70del site target sequence;
the SARS-CoV-269: 70 site wild type target sequence is located at 21753-21780 site of SARS-CoV-2 genome; the target sequence of SARS-CoV-269: 70del site is located at 21753-21786 th site of SARS-CoV-2 genome, and the tacatg 6 bases are deleted.
2. The CRISPR-Cas13a system according to claim 1, characterized in that: the target sequence of the SARS-CoV-269: 70del site is shown as SEQ ID NO. 1; the SARS-CoV-269: 70 site wild type target sequence is shown in SEQ ID NO. 2.
3. The CRISPR-Cas13a system according to claim 1, characterized in that: the sequence of the crRNA of the SARS-CoV-269: 70del site is shown as SEQ ID NO. 3; the SARS-CoV-269: 70 site wild type crRNA sequence is shown in SEQ ID NO. 4.
4. The CRISPR-Cas13a system according to claim 1, characterized in that: the Cas13a protein is an LwCas13a protein.
5. A kit for detecting a SARS-CoV-269: 70del site, comprising the CRISPR-Cas13a system for detecting a SARS-CoV-269: 70del site according to any one of claims 1 to 4.
6. The kit of claim 5, wherein: the kit also comprises a primer pair for specifically amplifying a target sequence of the SARS-CoV-269: 70del site; the primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO. 7 and a single-stranded DNA molecule shown in SEQ ID NO. 8.
7. Any one of the following:
A1) the crRNA of any one of claims 1 to 3;
A2) a Cas13a protein and crRNA as set forth in any one of claims 1-4;
A3) a complex of Cas13a protein and crRNA as set forth in any one of claims 1-4;
A4) the primer set according to claim 6.
8. Any of the following applications:
B1) use of the system of any one of claims 1 to 4, the kit of claim 5 or 6 or the substance of claim 7 for detecting or aiding the detection of a SARS-CoV-269: 70del site;
B2) use of the system of any one of claims 1 to 4, the kit of claim 5 or 6 or the substance of claim 7 in the manufacture of a product for detecting or aiding in the detection of the SARS-CoV-269: 70del site;
B3) use of the system according to any one of claims 1 to 4, the kit according to claim 5 or 6 or the substance according to claim 7 for detecting or aiding in detecting whether a sample to be tested contains a SARS-CoV-269: 70del site;
B4) use of the system according to any one of claims 1 to 4, the kit according to claim 5 or 6 or the substance according to claim 7 for the preparation of a product for detecting or aiding the detection of the presence of a SARS-CoV-269: 70del site in a sample to be tested;
B5) use of the system according to any one of claims 1 to 4, the kit according to claim 5 or 6 or the substance according to claim 7 for screening or assisted screening of drugs for prevention and treatment of SARS-CoV-269: 70del locus;
B6) use of the system according to any one of claims 1 to 4, the kit according to claim 5 or 6 or the substance according to claim 7 for the preparation of a product for screening or auxiliary screening of SARS-CoV-269: 70del site controlling drugs;
B7) use of the substance of claim 7 in the manufacture of a kit according to claim 5 or 6.
9. A method for detecting or assisting in detecting SARS-CoV-269: 70del locus comprises the following steps:
C1) taking nucleic acid of a sample to be detected as a template, and carrying out PCR amplification by adopting a primer pair consisting of a single-stranded DNA molecule shown in SEQ ID NO. 7 and a single-stranded DNA molecule shown in SEQ ID NO. 8 to obtain a PCR product;
C2) preparing a CRISPR-Cas13a detection system, and then carrying out fluorescence detection; the CRISPR-Cas13a detection system comprises the PCR product, Cas13a protein of any one of claims 1-4, crRNA of any one of claims 1-4, NTP, T7RNA polymerase; meanwhile, water is used for replacing the PCR product as a negative control;
C3) detecting the fluorescence intensity of the CRISPR-Cas13a detection system, and judging whether the sample to be detected contains SARS-CoV-269: 70del sites according to the intensity of the fluorescence intensity: if the fluorescence intensity value of the detection system of the sample to be detected is more than 3 times higher than that of the negative control in the same detection time, the sample to be detected contains or is candidate to contain SARS-CoV-269: 70del locus, otherwise the sample to be detected does not contain or is candidate to not contain SARS-CoV-269: 70del locus.
10. The method of claim 9, wherein: in the step C3), the reaction conditions are as follows: reading fluorescence intensity value every 1-3min at 35-39 deg.C for more than 20 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111518202.1A CN113913406B (en) | 2021-12-14 | 2021-12-14 | Method for detecting SARS-CoV-269:70 del site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111518202.1A CN113913406B (en) | 2021-12-14 | 2021-12-14 | Method for detecting SARS-CoV-269:70 del site |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113913406A true CN113913406A (en) | 2022-01-11 |
| CN113913406B CN113913406B (en) | 2022-04-08 |
Family
ID=79248703
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111518202.1A Active CN113913406B (en) | 2021-12-14 | 2021-12-14 | Method for detecting SARS-CoV-269:70 del site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113913406B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114350854A (en) * | 2022-01-10 | 2022-04-15 | 中国人民解放军军事科学院军事医学研究院 | Method for detecting SARS-CoV-269-70del locus based on RAA-CRISPR |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108715849A (en) * | 2018-04-28 | 2018-10-30 | 中国人民解放军军事科学院军事医学研究院 | A kind of nucleic acid target spot of anti-dengue virus effectively based on Cas13a and its application |
| CN110184389A (en) * | 2019-06-04 | 2019-08-30 | 中国人民解放军疾病预防控制中心 | Application of the PCR-CRISPR system of crRNA targeting in detection HBV DNA |
| CN111270012A (en) * | 2020-03-10 | 2020-06-12 | 中国人民解放军军事科学院军事医学研究院 | CRISPR nucleic acid detection kit for detecting novel coronavirus (2019-nCoV) |
| CN111850174A (en) * | 2020-08-07 | 2020-10-30 | 宜明(苏州)细胞生物科技有限公司 | CRISPR reagent for detecting 2019-nCov and application thereof |
| US20210348243A1 (en) * | 2020-03-19 | 2021-11-11 | The J. David Gladstone Institutes, a testamentary trust established under the Will of J. David Glads | RAPID FIELD-DEPLOYABLE DETECTION OF SARS-CoV-2 VIRUS |
| CN113637798A (en) * | 2021-08-09 | 2021-11-12 | 南昌大学 | Primer and probe for detecting delta 69/70HV deletion mutation site of S gene of new coronavirus Alpha strain and application of primer and probe |
-
2021
- 2021-12-14 CN CN202111518202.1A patent/CN113913406B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108715849A (en) * | 2018-04-28 | 2018-10-30 | 中国人民解放军军事科学院军事医学研究院 | A kind of nucleic acid target spot of anti-dengue virus effectively based on Cas13a and its application |
| CN110184389A (en) * | 2019-06-04 | 2019-08-30 | 中国人民解放军疾病预防控制中心 | Application of the PCR-CRISPR system of crRNA targeting in detection HBV DNA |
| CN111270012A (en) * | 2020-03-10 | 2020-06-12 | 中国人民解放军军事科学院军事医学研究院 | CRISPR nucleic acid detection kit for detecting novel coronavirus (2019-nCoV) |
| US20210348243A1 (en) * | 2020-03-19 | 2021-11-11 | The J. David Gladstone Institutes, a testamentary trust established under the Will of J. David Glads | RAPID FIELD-DEPLOYABLE DETECTION OF SARS-CoV-2 VIRUS |
| CN111850174A (en) * | 2020-08-07 | 2020-10-30 | 宜明(苏州)细胞生物科技有限公司 | CRISPR reagent for detecting 2019-nCov and application thereof |
| CN113637798A (en) * | 2021-08-09 | 2021-11-12 | 南昌大学 | Primer and probe for detecting delta 69/70HV deletion mutation site of S gene of new coronavirus Alpha strain and application of primer and probe |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114350854A (en) * | 2022-01-10 | 2022-04-15 | 中国人民解放军军事科学院军事医学研究院 | Method for detecting SARS-CoV-269-70del locus based on RAA-CRISPR |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113913406B (en) | 2022-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110628955B (en) | CrRNA target and CRISPR-Cas13a system for detecting Ebola virus | |
| CN111270012B (en) | CRISPR nucleic acid detection kit for detecting novel coronavirus (2019-nCoV) | |
| CN110184389B (en) | Application of crRNA-targeted PCR-CRISPR system in detection of HBV DNA | |
| WO2020259210A1 (en) | Method and kit for detecting african swine fever virus | |
| CZ308201B6 (en) | Diagnostic tests for parvovirus B19 | |
| CN113913552B (en) | Primer, probe, kit and detection method for real-time fluorescent RT-RPA detection of mouse hepatitis virus | |
| CN113046475B (en) | Primer composition and kit for rapidly detecting mutant novel coronavirus | |
| CN111850174A (en) | CRISPR reagent for detecting 2019-nCov and application thereof | |
| CN113913406B (en) | Method for detecting SARS-CoV-269:70 del site | |
| CN110343785A (en) | Based on PCR-CRISPR-cas13a detects the kit of hepatitis b virus covalence closed cyclic DNA | |
| CN106947834B (en) | Multiplex PCR method for detecting six duck susceptibility viruses | |
| CN113604612A (en) | Alongshan virus loop-mediated isothermal amplification detection primer group, kit containing primer group and application of kit | |
| CN116676429A (en) | LAMP primer group and method for detecting pangolin respiratory syncytial virus A and B | |
| Bald-Blume et al. | Development of a molecular assay for the detection of Cucumber mosaic virus and the discrimination of its subgroups I and II | |
| CN114350854B (en) | Method for detecting SARS-CoV-269-70del locus based on RAA-CRISPR | |
| CN113718045A (en) | DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application | |
| CN111719015A (en) | Human immunodeficiency virus HIV-1 detection kit | |
| CN113046476A (en) | Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus | |
| CN110195129B (en) | PCR-CRISPR (polymerase chain reaction-clustered regularly interspaced short palindromic repeats) detection method for targeted HBV (hepatitis B virus) drug-resistant mutant gene | |
| CN110819629A (en) | Primer combination and detection method for detecting blue tongue 8 type and/or blue tongue 16 type viruses | |
| KR101034805B1 (en) | Norovirus standardized positive control and norovirus detecting kits being provided with rna transcripts thereof | |
| CN114703328A (en) | Pfago protein mediated B19 virus nucleic acid detection kit and detection method | |
| CN113151585A (en) | Primer composition and kit for rapidly detecting mutation of novel coronavirus D614G | |
| CN108315487B (en) | Primer group and kit for detecting eel herpesvirus and application of primer group and kit | |
| CN106939356B (en) | Detection primer group, detection kit and detection method for rapidly detecting bee filovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |