CN111719015A - Human immunodeficiency virus HIV-1 detection kit - Google Patents

Abstract

The invention discloses a detection kit for human immunodeficiency virus HIV-1, belonging to the technical field of HIV molecular biological detection. The kit comprises an upstream primer, a downstream primer, a probe matched with the primer for use, a negative control template, a positive control template, a standard template, a RAA isothermal nucleic acid amplification reagent, 10 XNEB buffer2.1, 40U/. mu.L RNase inhibitor, 2M DTT and 2. mu.M EnGen Lba Cpf1 nuclease. The kit is adopted for detection, the reaction speed is high, and the whole detection process is less than 2 hours; only virus DNA is required to be extracted, the operation steps are few and simple, and pollution can be effectively avoided; meanwhile, the detection sensitivity is high, 10 copies of virus DNA can be detected, the working efficiency is greatly improved, and the detection cost is reduced.

Description

Human immunodeficiency virus HIV-1 detection kit

Technical Field

The invention relates to a detection kit for human immunodeficiency virus HIV-1, belonging to the technical field of HIV molecular biology detection.

Background

AIDS (acquired immune deficiency syndrome) is a very harmful viral infectious disease and seriously threatens global public health. Currently, about 3700 million people worldwide are infected with Human Immunodeficiency Virus (HIV), and about 180 million infected people are newly increased each year. Since the virus-absorbing people infected with HIV/AIDS is found in Reli city of Yunnan province for the first time in 1989, the virus-absorbing way is one of the main ways for infecting AIDS in China, and particularly, the virus-absorbing people are more likely to become the affected people of AIDS due to the existence of high-risk behaviors of sharing needles and cotton balls in the virus-absorbing people for injection. The distribution of virus-absorbing people and AIDS infection in China is related to the geographical position distribution. Due to the fact that the medicine is adjacent to a famous drug production base, namely 'golden triangle', the drug absorption phenomenon in Yunnan province is more prevalent.

Highly active antiretroviral therapy (HAART) effectively controls the replication of HIV-1 virus in plasma, inhibits HIV-1 virus to undetectable levels, but ART does not clear the latent viral pool. The latent viral pool is the major source of viral reexplosions following discontinuation of ART therapy and is a major obstacle to the clearance of the latent HIV-1 virus. Establishment of a virus pool within 1 to 3 days after virus infection was confirmed in the SIV (simian immunodeficiency virus) model of AIDS, and thus establishment of persistent infection could not be prevented even if HAART treatment was performed 3 days after HIV-1 virus infection. Therefore, there is a need to develop new HIV virus latent pool detection means, which lays the technical foundation for the 'functional' cure of HIV/AIDS patients.

Compared to protein immunoassays, molecular (nucleic acid) based diagnostic assays have numerous advantages, particularly in terms of detection sensitivity and specificity. However, conventional nucleic acid-based tests (NATs) require the handling of large numbers of samples, trained operators, and specialized equipment. On-site detection of pathogens and other disease markers can improve medical quality and reduce medical costs. The gold standard for HIV diagnosis is DNA PCR, which detects proviral DNA present in peripheral blood mononuclear cells. The HIV DNA assay is reliable even when HIV viral load is suppressed to very low levels. Unfortunately, HIV DNA PCR is not suitable for use in poor locations because PCR requires expensive equipment, power, specialized laboratory space, and trained technicians. Therefore, there is a need for a point-of-care (point-of-care) HIV detection technology based on DNA detection that can provide results quickly, enabling more patients to understand their HIV status and begin treatment more quickly. Compared with other conventional molecular methods, the isothermal amplification technology has the advantages of high speed, simple operation and low cost, and is very suitable for clinical application.

At present, virus infection diagnosis generally comprises virus isolation and identification, direct detection of virus nucleic acid and antigen, and detection of specific antibody, which is not only time-consuming, but also has high requirement on professional level of medical equipment and operators. It would therefore be of great importance to be able to develop an intelligent diagnostic device that does not rely on expensive equipment and medical personnel, especially in developing countries where viral infections are often wanting to be traversed. The conventional HIV infection detection method is to detect whether antiviral antibodies exist in human serum or plasma by enzyme-linked immunosorbent assay (ELISA); because the body takes a certain amount of time to generate a specific immune response, antibodies may not be detected at all in the first 1-3 months ("window period") of viral infection; and the detection of the nucleic acid of the virus can greatly shorten the detection window period.

Disclosure of Invention

The invention aims to provide a primer, a probe and a detection kit for qualitative detection of Human Immunodeficiency Virus (HIV) DNA, which can accurately determine the HIV DNA in a sample to be detected by extracting the genomic DNA of the sample to be detected and combining an isothermal nucleic acid amplification technology and a CRISPR (clustered regularly interspaced short palindromic repeats) technology. The primer, the probe and the detection kit provided by the invention can be used for clinical detection of HIV, can also be used for qualitative analysis of HIV DNA in HIV infected patients, and can play an important role in prevention and control of HIV/AIDS in China.

The above object is achieved by the following technical solution,

a detection kit for human immunodeficiency virus HIV-1 comprises isothermal amplification-CRISPR technology detection primers and probes of DNA:

the specific primer of the HIV in-vitro isothermal nucleic acid amplification-CRISPR comprises an upstream primer HIV-RAA _ F and a downstream primer HIV-RAA _ R;

upstream primer HIV-RAA _ F: TACTTCAAGAACTGCTGACATCGAGCTTGCTAC, respectively; (SEQ ID NO. 1).

Downstream primer HIV-RAA _ R: CGCCACTGCTAGAGATTTTCCACACTGACT, respectively; (SEQ ID NO. 2).

The probe nucleotide sequence is as follows: TTTCCACACTGACTAAAAGGGTCT (SEQ ID NO. 3).

The invention also provides a ssDNA-FQ reporter gene probe matched with the primer for use, wherein the nucleotide sequence of the probe is as follows: FAM-TTATT-BHQ1(SEQ ID NO. 4).

Further, preferably, the kit for detecting human immunodeficiency virus HIV-1 of the invention further comprises a negative control template, a positive control template, a RAA isothermal nucleic acid amplification reagent, 10 XNEB buffer2.1, 40U/. mu.L RNase inhibitor, 2M DTT and 2. mu.M EnGen Lba Cpf1 nuclease.

The negative control template is Ribozyme-free water and pUC57-HBV plasmid; the positive control template was pUC57-HIV LTR plasmid. When the in vitro isothermal nucleic acid amplification-CRISPR detection system is used for reacting with a negative control template, the template is Riboz yme-free water and pUC57-HBV plasmid with known concentration; when the in vitro isothermal nucleic acid amplification-CRISPR detection system reacts with a positive control template, the template is pUC57-HIV LTR plasmid; when the in vitro isothermal nucleic acid amplification-CRISPR detection system is used for reacting with a sample template to be detected, the template is virus genome DNA extracted from blood of a suspected HIV infected person. The primers and the probes provided by the invention are used for carrying out in-vitro isothermal nucleic acid amplification-CRISPR detection on the negative control template, the positive control template and the template of the sample to be detected, the excitation wavelength is 535nm, the emission wavelength is 575nm, the fluorescence value is collected on a VICTOR Nivo microplate reader after the termination reaction, the fluorescence value of the template of the sample to be detected is subtracted from the fluorescence value of a blank hole to obtain a final fluorescence value, and when the final fluorescence value of the sample to be detected is less than or equal to 0, the virus is judged to be not detected (the detection result is negative).

Further, preferably, the RAA isothermal nucleic acid amplification reagent of the present invention comprises a basic reaction solution, a basic reaction unit containing lyophilized powder, and a magnesium acetate solution.

Further, preferably, the RAA isothermal nucleic acid amplification system of the kit of the present invention is:

basic buffer, 25.0 μ L;

upstream primer HIV-RAA _ F (10. mu. mol/L), 2.0. mu.L;

downstream primer HIV-RAA _ R (10. mu. mol/L), 2.0. mu.L;

template DNA, 1.0. mu.L;

purified water, 17.5 μ L;

2.5 μ L of magnesium acetate solution;

a total of 50.0. mu.L.

Further, it is preferable that the nucleic acid amplification process of the kit of the present invention: reacting at 37 ℃ for 40 minutes; after completion of the reaction, 50. mu.L of phenol/chloroform (1:1) was added to each reaction tube, sufficiently homogenized by vortexing using a vortex shaker, and centrifuged at 12000rpm for 1 minute.

Further, preferably, the CRISPR DNA detection system of the kit of the invention is:

10x NEB Buffer2.1，2.0μL；

EnGen Lba Cpf1 nuclease, 2.0. mu.L;

LTR-crRNA probe (10. mu. mol/L), 1.0. mu.L;

RAA amplification product, 4.0. mu.L;

ssDNA-FQ reporter probe (100. mu. mol/L), 0.2. mu.L;

RNase inhibitor, 0.25. mu.L;

DTT，0.1μL；

ribozyme-free water, 10.45. mu.L;

a total of 20.0. mu.L.

Further, it is preferable that the detection procedure of the kit is: the reaction was terminated by heating at 37 ℃ for 40 minutes and 98 ℃ for 5 minutes.

The invention provides a ssDNA-FQ reporter probe for detecting HIV DNA, which is labeled with a reporter fluorophore at the 5 'end and a quencher fluorophore at the 3' end. Wherein FAM is 6-carboxyfluorescein reporter fluorophore, and BHQ1 is black hole quenching fluorophore.

The specific principle of the invention is that when the CRISPR-Cas12a (Cpf1) system cuts targeted double-stranded DNA, the DNase activity of Cpf1 is activated, and the DNase can nonspecifically cut single-stranded ssDNA in a trans-mode; therefore, when the CRISPR-Cpf1 system targeting the DNA and the non-specific ssDNA fluorescent reporter are delivered into the cell simultaneously, once the target DNA is detected, the CRISPR-Cpf1 system is started, and the fluorescent reporter is degraded to release a fluorescent signal. Amplifying the DNA or RNA sample by an isothermal amplification method (e.g., recombinase polymerase amplification of RAA); then, with the help of a specific guideRNA, the CRISPR-associated protein Cpf1 binds to the amplified target sequence and the resulting result is detected by the alternative nucleic acid cleavage activity of the reporter molecule.

Designing specific primers for isothermal nucleic acid amplification, an LTR-crRNA probe and an ssDNA-FQ reporter gene probe for CRISPR detection aiming at HIV LTR DNA sequences, wherein an FAM group is used as a reporter fluorescent group of the ssDNA-FQ reporter gene, and BHQ1 is used as a quenching fluorescent group of the ssDNA-FQ reporter gene; biologically synthesizing pUC57-HBV plasmid and pUC57-HIV LTR plasmid in Kunming engine family; synthesizing a probe in Shanghai; purchasing an RAA isothermal nucleic acid amplification kit from Qitian gene company of Jiangsu; finally, a detection primer, a probe and a detection kit for isothermal nucleic acid amplification-CRISPR combination are constructed, wherein the detection primer, the probe and the detection kit are suitable for detecting HIV DNA.

Compared with the prior art, the invention has the beneficial effects that:

(1) the invention designs the in-vitro isothermal nucleic acid amplification primer and the CRISPR detection probe with strong specificity, and constructs a detection kit capable of detecting HIV DNA on the basis, wherein the kit has the advantages of specificity, sensitivity, rapidness, high efficiency and the like.

(2) The CRISPR detection technology can detect the highest fluorescence value (shown in figure 1) after reacting for 40 minutes at 37 ℃, and the detection time is faster than that of the detection time by using the traditional RT-qPCR method.

(3) The virus content in blood of a human body is low in the early stage of HIV infection, and the in-vitro nucleic acid isothermal amplification-CRISPR technical detection kit developed by the invention has good detection sensitivity and is suitable for detecting early clinical samples. The sensitivity test result shows that the detection lower limit of the in vitro nucleic acid isothermal amplification-CRISPR technology detection kit developed by the invention is 10 copies of HIV virus DNA (shown in figure 2), while the detection lower limit of RT-qPCR is generally 50 copies, which shows that the detection sensitivity of the invention is 5 times higher than that of the common RT-qPCR.

(4) The in vitro nucleic acid isothermal amplification-CRISPR technology detection kit developed by the invention has strong specificity. As shown in FIG. 3, the primers and probes of the present invention can generate fluorescence values only in HIV DNA samples, but do not cross-react with HBV DNA.

(5) The in vitro nucleic acid isothermal amplification-CRISPR technology detection kit developed by the invention has high reaction speed, the whole detection process can be finished within 2 hours, and the detection of the existence of HIV DNA in a sample to be detected can be directly judged by detecting a fluorescence value without agarose gel electrophoresis.

(6) Because the HIV LTR sequence has high conservative property and is generally used as a target gene for HIV virus specific detection, the invention designs a primer aiming at the HIV LTR sequence, and then uses the in vitro nucleic acid isothermal amplification-CRISPR technology detection kit developed by the invention to detect the blood sample of the HIV/AIDS patient collected in the second national hospital in the big municipality, and the detection result shows that the detection kit developed by the invention can effectively detect the HIV DNA in the blood sample of the HIV/AIDS patient, and the detection coincidence rate is 100%.

Drawings

FIG. 1 time response curves of the present invention; the X-axis is the reaction time for detection of HIV DNA and the Y-axis is the fluorescence value.

FIG. 2 is a sensitivity test of the kit for in vitro nucleic acid isothermal amplification-CRISPR technology developed by the present invention; wherein 1ng of template HIV DNA equals 10⁸aM。

FIG. 3 is the specificity test of the kit for in vitro nucleic acid isothermal amplification-CRISPR technology developed by the present invention.

Detailed Description

It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The materials or equipment used are not indicated by manufacturers, and all are conventional products available by purchase.

(1) Experimental Material

The blood sample of HIV/AIDS patient is obtained from the research project of full nutrition formula food nutrition supplement on the nutrition treatment effect of AIDS patient developed in the second national hospital of Dali City, and the blood sample of drug addict not infected with HIV is collected from the sixth compulsory drug addict, Longchuan of Yunnan province. The blood samples were split into 200. mu.L/tube and stored in a freezer at-80 ℃.

(2) Reagent and apparatus

10 XNEB buffer2.1 and EnGen Lba Cas12a (Cpf1) nucleases were purchased from NEB corporation; the plasmid miniextraction kit, the Escherichia coli DH5 alpha competent cells and the blood genome DNA extraction kit are purchased from Tiangen Biochemical technology limited company; phenol/chloroform (1:1) was purchased from Solebao corporation; the RAA nucleic acid detection kit (cat # B00000) was purchased from Qitianjing Gen, Jiangsu. pUC57-HIV LTR plasmid and pUC57-HBV plasmid were synthesized by Kunming Scienda Biotech and stored in a refrigerator at-20 ℃.

A 384 well plate; a VICTOR Nivo microplate reader; OSE-96 (Tiangen Biochemical technology Co., Ltd.) as a dry constant temperature metal bath; desk top centrifuge 1-14 (Sigma).

(3) Design of primers and probes

Specific primers and LTR-crRNA probes for in vitro isothermal nucleic acid amplification are designed aiming at HIV LTR sequences, and ssDNA-FQ reporter gene probes are designed simultaneously, wherein FAM and BHQ1 are respectively used as a reporter fluorophore and a quenching fluorophore for the reporter gene probes. Primer and probe sequences are shown in table 1.

TABLE 1 sequence information of primers and probes used for PALV qRT-PCR detection

(4) Synthesis of template plasmid

Based on the LTR sequence (806bp) of the HIV HxB2 strain and the synthesized HBV sequence (989bp), pUC57-HIV LTR plasmid and pUC57-HBV plasmid were synthesized in Kunming Scienda, respectively.

The synthesized plasmid was transformed into E.coli DH5 alpha competent cell (Tiangen Biochemical technology Co., Ltd.), and positive clone bacteria were selected for plasmid extraction. The template plasmid was extracted according to the "plasmid Mini kit" (Tiangen Biochemical technology Co., Ltd.).

(5) Optimized CRISPR detection system

(6) Through repeated tests, a reaction system for CRISPR detection is optimized, the total reaction system is determined to be 20 mu L, and the required components, the corresponding concentrations and the corresponding amounts are shown in Table 2. The final concentrations of the pUC57-HIV LTR plasmid of 10ng were used as templates, the concentrations of the LTR crRNA probe (0.25, 0.5, 0.75 and 1.0. mu. mol/L) and the ssDNA-FQ reporter probe (0.2, 0.4, 0.6, 0.8 and 1.0. mu. mol/L) were optimized, respectively, and the HIV DNA detection was performed in a 20. mu.L reaction system, with the best results corresponding to the final concentrations of the LTR crRNA probe and the ssDNA-FQ reporter probe of 0.5. mu. mol/L and 1. mu. mol/L, respectively. If the reaction system is adjusted, the final concentration of LTR crRNA probe and ssDNA-FQ reporter gene probe in the system is ensured to be 0.5 mu mol/L and 1 mu mol/L, and a better detection result can be obtained.

TABLE 2 CRISPR detection of HIV DNA reaction System

Reaction system components	Dosage (mu L)	Final concentration
			10×NEB Buffer2.1	2.0
EnGenLba Cas12a(2μmol/L)	2.0
			DTT(2mol/L)	0.1
RNase inhibitors(40U/μL)	0.25
			LTR-crRNA Probe(10μmol/L)	1.0	0.5μmol/L
ssDNA-FQ reporter gene probe (100. mu. mol/L)	0.2	1μmol/L
			Stencil (100 ng/. mu.L)	0.1
Ribozyme-free water	14.35
			Total of	20.0

(6) Optimizing in vitro nucleic acid isothermal amplification reaction conditions

Performing in-vitro nucleic acid isothermal amplification according to the operation instruction of the RAA in-vitro nucleic acid isothermal amplification kit; in order to obtain the maximum amount of the target amplification product, the optimal reaction conditions for isothermal nucleic acid amplification by RAA were determined as follows: the reaction was carried out at 37 ℃ for 40 minutes.

(7) Optimizing the volume of the RAA amplification product used in the in vitro nucleic acid isothermal amplification-CRISPR technology detection kit reaction system: through repeated tests, a reaction system detected by the in vitro nucleic acid isothermal amplification-CRISPR technical detection kit is optimized, the total reaction system adopted is determined to be 20 mu L, and the required components and the corresponding dosage are shown in Table 3.

The RAA amplification products were used as templates, the volumes (1.0, 2.0, 3.0, 4.0 and 5.0. mu.L) were optimized, and HIV DNA detection was carried out in a 20. mu.L reaction system, and the optimal detection results were obtained with 4.0. mu.L of the RAA amplification products.

TABLE 2 in vitro nucleic acid isothermal amplification-CRISPR technology detection kit reaction system

(8) The time response curve of the invention is established by taking 10ng HIV DNA as a template and detecting fluorescence values when the response time is 10, 20, 30, 40, 50 and 60 minutes respectively. The reaction time for detecting HIV DNA is taken as an X axis, the final fluorescence value is taken as a Y axis, and a time reaction curve is obtained and is shown in figure 1, and the graph shows that the CRISPR-Cpf1, the LTRcrRNA-1 and 10ng of HIV DNA are combined to react for 40 minutes at 37 ℃, so that the highest fluorescence value can be detected.

(9) Sensitivity analysis

The HIV DNA detection primer, the probe and the detection kit are utilized, and the copy number is respectively 10 according to the optimized reaction system and the optimized reaction condition⁶aM、10⁵aM、10⁴aM、10³aM、10²aM、10¹aM and 10⁰after the HIV LTR of aM template is subjected to in vitro nucleic acid isothermal amplification, 4 mu L of amplification products are taken for sensitivity analysis, and the detection lower limit of the detection primer, the probe and the kit related to the invention is 10 copies (see figure 2). It can be seen from the figure that the RAA isothermal nucleic acid amplification technique combined with CRISPR-Cpf can detect 10 copies of HIV virus DNA (1 ng equals 10 for template DNA)⁸aM)。

(10) Specificity analysis

By using the HIV DNA detection primer, the probe and the detection kit, 4 mu L of product subjected to in vitro nucleic acid isothermal amplification is taken for specific analysis according to an optimized reaction system and optimized reaction conditions, the HIV DNA detection primer, the probe and the detection kit can specifically detect HIV DNA without cross reaction with HBV DNA, and as shown in figure 3, the combination of RAA isothermal nucleic acid amplification technology and CRISPR-Cpf is a detection method with good specificity.

Examples of the applications

Detection of HIV/AIDS patients Using the detection kit developed by the present invention

The HIV DNA detection primer, the probe and the detection kit provided by the invention are utilized to detect 30 collected blood samples of HIV/AIDS patients and 30 blood samples of drug addicts who are not infected with HIV according to an optimized reaction system and reaction conditions. And extracting genome DNA from 100 mu L of blood, and simultaneously carrying out in-vitro nucleic acid isothermal amplification and CRISPR detection on the negative control template, the positive control template and the template of the sample to be detected in different reaction holes in the implementation operation process. The primer, the probe and the detection kit can effectively detect all positive samples, and meanwhile, the detection results of drug addicts not infected with HIV are negative, and the coincidence rate is 100%. The HIV DNA detection kit disclosed by the invention is used for detecting pathogenic nucleic acid, so that when a host is infected but does not produce an antibody, the HIV DNA in-vitro nucleic acid isothermal amplification primer, the CRISPR (clustered regularly interspaced short palindromic repeats) related probe and the detection kit disclosed by the invention have good sensitivity and reliability.

Primer sequences derived from the primer pairs of the invention also fall within the scope of the invention; the derivative sequence is a primer sequence obtained by substitution, deletion or addition of one to ten bases on the basis of SEQ ID NO.1 to SEQ ID NO. 4.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Sequence listing

<110> first subsidiary hospital of Kunming medical university

<120> detection kit for human immunodeficiency virus HIV-1

<130>20200521

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>806

<212>DNA

<213> LTR of HIV HxB2 Strain (HIV)

<400>1

tggaagggct aattcactcc caaagaagac aagatatcct tgatctgtgg atctaccaca 60

cacaaggcta cttccctgat tagcagaact acacaccagg gccaggggtc agatatccac 120

tgacctttgg atggtgctac aagctagtac cagttgagcc agataagata gaagaggcca 180

ataaaggaga gaacaccagc ttgttacacc ctgtgagcct gcatgggatg gatgacccgg 240

agagagaagt gttagagtgg aggtttgaca gccgcctagc atttcatcac gtggcccgag 300

agctgcatcc ggagtacttc aagaactgct gacatcgagc ttgctacaag ggactttccg 360

ctggggactt tccagggagg cgtggcctgg gcgggactgg ggagtggcga gccctcagat 420

cctgcatata agcagctgct ttttgcctgt actgggtctc tctggttaga ccagatctga 480

gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 540

tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 600

agaccctttt agtcagtgtg gaaaatctct agcagtggcg cccgaacagg gacctgaaag 660

cgaaagggaa accagaggag ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg 720

caagaggcga ggggcggcga ctggtgagta cgccaaaaat tttgactagc ggaggctaga 780

aggagagaga tgggtgcgag agcgtc 806

<210>1

<211>989

<212>DNA

<213> synthetic HBV (HIV)

<400>1

ggattgggga ccctgcgctg aacatggaga acatcacatc aggattccta ggacccctgc 60

tcgtgttaca ggcggggttt ttcttgttga caagaatcct cacaataccg cagagtctag 120

actcgtggtg gacttctctc aattttctag gggggaccac cgtgtgtctt ggccaaaatt 180

cgcagtcccc aacctccaat cactcaccaa cctcctgtcc tccaacttgt cctggttatc 240

gctggatgtg tctgcggcgt tttatcatct tcctcttcat cctgctgcta tgcctcatct 300

tcttgttggt tcttctggac tatcaaggta tgttgcccgt ttgtcctcta attccaggat 360

cttcgaccac cagcgtggga ccatgcagaa cctgcacgac tactgttcaa ggaacctcta 420

tgtatccctc atgttgctgt accaaacctt cggacggaaa ttgcacctgt attcccatcc 480

catcatcctg ggctttcgga aaattcctat gggagtgggc ctcagcccgt ttctcctggc 540

tcagtttact agtgccattt gttcagtggt tcgtagggct ttcccccact gtttggcttt 600

cagttatatg gatgatgtgg tattgggggc caagtctgca cagcatcttg agtccctttt 660

taccgctgtt accaattttc ttttatcttt gggtatacat ttaaacccta acaaaactaa 720

aagatggggt tactctttaa atttcatggg ctatgtcatt ggatgttatg ggtcattgcc 780

acaagatcac atcagacaga aaatcaaaga atgttttaga aaacttcctg ttaacaggcc 840

tattgattgg aaagtctgtc aacgtattgt gggtcttttg ggttttgctg ccccttttac 900

acaatgtggt tatcctgctt taatgccctt gtatgcctgt attcaatcta agcaggcttt 960

cactttctcg ccaacctaca aggcctttc 989

Claims (8)

1. A detection kit for human immunodeficiency virus HIV-1 is characterized in that: comprises isothermal amplification-CRISPR technology detection primers and probes of DNA;

the specific primer of the HIV in-vitro isothermal nucleic acid amplification-CRISPR comprises an upstream primer HIV-RAA _ F and a downstream primer HIV-RAA _ R;

upstream primer HIV-RAA _ F: TACTTCAAGAACTGCTGACATCGAGCTTGC TAC, respectively;

downstream primer HIV-RAA _ R: CGCCACTGCTAGAGATTTTCCACACTGACT, respectively;

the probe nucleotide sequence is as follows: TTTCCACACTGACTAAAAGGGTCT are provided.

2. The HIV-1 detection kit according to claim 1, wherein:

the nucleotide sequence of the ssDNA-FQ reporter gene probe matched with the primer is as follows: FAM-T TATT-BHQ 1.

3. The HIV-1 detection kit according to claim 1 or 2, wherein: also comprises a negative control template, a positive control template, a RAA isothermal nucleic acid amplification reagent, 10 XNEB buffer2.1, 40U/mu L RNase inhibitor, 2mol/L DTT and 2 mu m ol/L EnGen Lba Cpf1 nuclease;

the negative control template is Ribozyme-free water and pUC57-HBV plasmid;

the positive control template was pUC57-HIV LTR plasmid.

4. The HIV-1 detection kit according to claim 3, wherein: the RAA isothermal nucleic acid amplification reagent comprises basic reaction liquid, a basic reaction unit filled with freeze-dried powder and magnesium acetate solution.

5. The HIV-1 detection kit according to claim 4, wherein: the RAA isothermal nucleic acid amplification system of the kit is as follows:

basic buffer, 25.0 μ L;

upstream primer HIV-RAA _ F10. mu. mol/L, 2.0. mu.L;

downstream primer HIV-RAA _ R10. mu. mol/L, 2.0. mu.L;

template DNA, 1.0. mu.L;

purified water, 17.5 μ L;

2.5 μ L of magnesium acetate solution;

a total of 50.0. mu.L.

6. The HIV-1 detection kit according to claim 3, wherein: nucleic acid amplification procedure of the kit: reacting at 37 ℃ for 40 minutes; after completion of the reaction, 50. mu.L of phenol/chloroform (1:1) was added to each reaction tube, sufficiently homogenized by vortexing using a vortex shaker, and centrifuged at 12000rpm for 1 minute.

7. The HIV-1 detection kit according to claim 3, wherein: the CRISPR DNA detection system of the kit is as follows:

10x NEB Buffer2.1，2.0μL；

EnGen Lba Cpf1 nuclease, 2.0. mu.L;

LTR-crRNA probe 10. mu. mol/L, 1.0. mu.L;

RAA amplification product, 4.0. mu.L;

ssDNA-FQ reporter gene probe 100. mu. mol/L, 0.2. mu.L;

RNase inhibitor, 0.25. mu.L;

DTT，0.1μL；

ribozyme-free water, 10.45. mu.L;

a total of 20.0. mu.L.

8. The HIV-1 detection kit according to claim 1, wherein: the reaction was terminated by heating at 37 ℃ for 40 minutes and 98 ℃ for 5 minutes.

Images