CN114480732B - Primer pair, crRNA, detection method and kit for detecting and identifying hepatitis C virus - Google Patents

Primer pair, crRNA, detection method and kit for detecting and identifying hepatitis C virus Download PDF

Info

Publication number
CN114480732B
CN114480732B CN202111601917.3A CN202111601917A CN114480732B CN 114480732 B CN114480732 B CN 114480732B CN 202111601917 A CN202111601917 A CN 202111601917A CN 114480732 B CN114480732 B CN 114480732B
Authority
CN
China
Prior art keywords
crrna
type
hepatitis
virus
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111601917.3A
Other languages
Chinese (zh)
Other versions
CN114480732A (en
Inventor
朱莉
茅光耀
叶军
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Taizhou Peoples Hospital
Original Assignee
Taizhou Peoples Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Taizhou Peoples Hospital filed Critical Taizhou Peoples Hospital
Priority to CN202111601917.3A priority Critical patent/CN114480732B/en
Publication of CN114480732A publication Critical patent/CN114480732A/en
Application granted granted Critical
Publication of CN114480732B publication Critical patent/CN114480732B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/706—Specific hybridization probes for hepatitis
    • C12Q1/707—Specific hybridization probes for hepatitis non-A, non-B Hepatitis, excluding hepatitis D
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Analytical Chemistry (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a primer pair for detecting and identifying hepatitis C virus, a CrRNA, a detection method and a kit, in particular to a primer pair for detecting hepatitis C virus nucleic acid and identifying hepatitis C virus type 3, a CrRNA sequence and a TMA-RAA-CRISPR-Cas13a method, belonging to the technical field of microorganism detection. The method has high specificity of detection results, and can easily judge whether HCV is 3 type or other genotype infection, and whether the HCV is simple infection or mixed infection, thereby providing help for HCV infected persons to select a reasonable DAA treatment scheme.

Description

Primer pair, crRNA, detection method and kit for detecting and identifying hepatitis C virus
Technical Field
The invention relates to a primer pair for detecting and identifying hepatitis C virus, a CrRNA, a detection method and a kit, in particular to a primer pair for detecting hepatitis C virus nucleic acid and identifying hepatitis C virus type 3, a CrRNA sequence and a TMA-RAA-CRISPR-Cas13a method, belonging to the technical field of microorganism detection.
Background
Hepatitis C virus (Hepatitis C Virus, HCV) is the causative agent of hepatitis C, and about 7100 thousands of people worldwide are HCV chronic infections, and early and accurate diagnosis of HCV infection and positive treatment are significant for eliminating or relieving liver function damage caused by HCV chronic infection, and preventing hepatitis C cirrhosis and liver cancer related to hepatitis C.
Since the concentration of HCV antigen in the blood circulation is usually low, HCV antigen is rarely detected clinically. Common methods for detecting the HCV specific antibodies comprise enzyme-linked immunosorbent assay, chemiluminescence, colloidal gold method rapid assay and the like, and have the advantages of easy operation and high cost efficiency along with detection, but the method for detecting the HCV antibodies is easily affected by window period, immune state, artificial antigen specificity and the like, and sometimes cannot truly reflect the infection state of a patient and whether HCV exists in the current patient body or not, and needs to be clarified through HCV nucleic acid detection. Common methods for detecting HCV nucleic acid include TMA, branched DNA, fluorescent PCR experiments and the like, related equipment is expensive, maintenance cost is high, a special laboratory is required to be built, the method is suitable for large-scale comprehensive hospitals with good economic conditions and many professionals, and other suitable methods still need to be found in basic medical institutions.
The novel nucleic acid detection method, i.e. isothermal amplification combined regular interval clustered short palindromic repeated sequence and related protein 13a (CRISPR-Cas 13 a), does not need an expensive temperature circulating device, can judge the result through a portable fluorescence detector or a nano gold-labeled test strip, and can be used as an alternative scheme for HCV nucleic acid detection of basic medical units. In brief, the detection method utilizes isothermal amplification technology to amplify target sequence, without the assistance of trans-acting CRISPR RNA (trans-acting CRISPR RNA, tracrRNA), recognizes the target sequence through guide RNA (CRISPR-RNA, crRNA) and activates RNA bypass cleavage activity of Cas13a protein, and Cas13a protein cleaves RNA modified by fluorescent/quenching groups, FITC/digoxin/biotin, etc., to convert sequence information into fluorescent signal or nano gold-labeled test strip visible signal. Founder Zhang Feng et al tested the detection method for specificity and sensitivity with Zika and dengue nucleic acid fragments, with high specificity, more sensitivity reaching the attomole scale, exceeding the high-sensitivity fluorescence PCR method.
The invention designed based on the principle is especially used for detecting a novel coronavirus (Chinese patent application CN202010898296.9, RAA-CRISPR amplification primer group, kit and method for efficiently detecting the novel coronavirus) and the like, the detection lower limit is generally reported to be about 100 copies/ul, the difference between partial invention targets and negative control targets at the concentration of 100 copies/ul is not obvious, the judgment result is difficult, and the sensitivity of the creator Zhang Feng is lower than that of the creator Zhang Feng. The HCV nucleic acid detection method suitable for clinical samples has higher sensitivity requirement, such as a non-high-sensitivity HCV nucleic acid detection fluorescent PCR method, the detection lower limit is less than or equal to 1000IU/ml, the detection fluorescent PCR rule of the hypersensitive HCV nucleic acid detection is lower than or equal to 15IU/ml, and the existing invention needs to improve the sensitivity when being used for HCV nucleic acid detection so as to avoid the problem that the low-viral load sample cannot be detected. At present, there are methods for improving the sensitivity of isothermal amplification-binding CRISPR-Cas13a detection systems, such as nested RAA, adding auxiliary CRISPR-associated enzyme Csm6, etc., but most of the methods require multiple reactions or have the problem that the related reagents are difficult to purchase on the market.
In addition, the existing invention focuses on the detection of pathogenic organisms, rarely further identifies the genotype of the pathogen, and ignores the important clinical significance of the genotype. In fact, the method of introducing artificial mismatch recognition SNP at the 4 th or 5 th base site by using the creator Zhang Feng et al to set a marker base at the 3 rd base site (near the anchor sequence) of the CrRNA spacer sequence can be fully used for the simple genotyping of a part of pathogenic organisms. For HCV infection, HCV genotypic results are of great instructive significance for the selection and treatment of direct antiviral drugs (direct antiviral agent, DAA), where type 3 HCV infection is not recommended for antiviral treatment with sofosbuvir/ledipasvir. Treatment of losers treated with polyethylene glycol interferon alpha in combination with ribavirin or sofosbuvir should be extended by 8 weeks for HCV type 3 infections compared to other genotypes when the losers are treated with ganciclovir/pirenzepine.
Disclosure of Invention
The object of the present invention is to overcome the above-mentioned drawbacks of the prior art, and to provide a set of primer pairs for hepatitis c virus nucleic acid detection and hepatitis c virus type 3 identification, crRNA sequences, and TMA-RAA-CRISPR-Cas13a methods; the method is used only for viral typing, which is used for non-disease therapeutic and diagnostic purposes.
In a first aspect of the invention, there is provided:
a primer pair for carrying out TMA-RAA amplification on RNA in hepatitis C virus detection has a nucleotide sequence shown in SEQ ID NO. 1-2:
AATTCTAATACGACTCACTATAGGGctgcggaaccggtgagtacaccggaat(SEQ ID.1)
tgcacggtctacgagacctcccg(SEQ ID.2)
the template for amplification is shown as SEQ ID NO. 3:
CTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCA(SEQ ID.3)
in a second aspect of the invention, there is provided:
CrRNA for detecting hepatitis c virus, comprising an anchor sequence and a spacer sequence, said anchor sequence binding to selected Lwacas13 protein; the spacer sequence specifically binds to a fragment of the hepatitis c virus targeting sequence.
The CrRNA comprises general CrRNA, type 3 nonspecific CrRNA and type 3 specific CrRNA.
The nucleotide sequence of the universal CrRNA is shown as SEQ ID NO. 4: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGGCACUCGCAAGCACCCUAUCAGGCAGU (SEQ ID NO. 4);
the nucleotide sequence of the anchoring sequence is shown as SEQ ID 5, and the nucleotide sequence of the interval sequence is shown as SEQ ID 6:
GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC(SEQ ID.5)
GGCACUCGCAAGCACCCUAUCAGGCAGU(SEQ ID.6)。
the nucleotide sequence of the 3-type nonspecific CrRNA is shown as SEQ ID.7, and the nucleotide sequence of the 3-type nonspecific CrRNA is shown as SEQ ID.8:
GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAGUGAUCUCGCGGGGGCACGCCCAAAUC(SEQ ID.7)
GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAGCAGUCUCGCGGGGGCACGCCCAAAUC(SEQ ID.8)；
wherein, the nucleotide sequence of the anchoring sequence is shown as SEQ ID 9 or 10, and the nucleotide sequence of the interval sequence is shown as SEQ ID 11 and 12:
GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC(SEQ ID.9)
GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC(SEQ ID.10)
AGUGAUCUCGCGGGGGCACGCCCAAAUC(SEQ ID.11)
AGCAGUCUCGCGGGGGCACGCCCAAAUC(SEQ ID.12)
the anchoring sequences of the CrRNA sequences of SEQ id 5,9 and 10 bind to lwaca 13a protein, and the spacer sequences of the CrRNA sequences of SEQ id 6, 11 and 13 bind to the hepatitis c virus targeting sequence fragment shown in SEQ id 3.
In a third aspect of the invention, there is provided:
a TMA-RAA-CRISPR-Cas13a method for hepatitis c virus nucleic acid detection and hepatitis c virus type 3 identification, comprising the steps of:
step 1, extracting RNA from a human plasma sample;
step 2, performing cross amplification on the RNA sample extracted in the step 1 by TMA and RAA to obtain an RNA amplification product;
and 3, combining the RNA amplification product obtained in the step 2 with CrRNA to cause the Cas13a protein to cleave the probe, and judging the result.
In the step 2, a primer pair with a nucleotide sequence shown as SEQ ID NO.1-2 is adopted for cross amplification of TMA and RAA.
In the step 3, the steps include:
and (3) combining the universal CrRNA with an RNA amplification product, and obtaining a combined fluorescence intensity signal, wherein if the fluorescence intensity is increased, the sample contains hepatitis C virus.
In the step 3, the steps further include:
respectively adopting 3-type nonspecific CrRNA and 3-type specific CrRNA to combine with RNA amplification products, and obtaining a combined fluorescence intensity signal;
if the fluorescence intensity after the type 3 specific CrRNA reaction is higher than that of the type 3 non-specific CrRNA, the sample is type 3 hepatitis C virus;
if the fluorescence intensity after the type 3 specific CrRNA reaction is lower than that of the type 3 non-specific CrRNA, the sample is non-type 3 hepatitis c virus.
In the step 2, a reaction system contains an RNA template; reaction liquid 1:50mM Tris-HCl (pH 7.9), 75mM KCl,4mM Mgcl2,10mM DTT,0.5mM dNTPs,2mM spermidine,2mM NTPs,DMSO 2.5ul,500nM primer; reaction liquid 2:50mM Tris-HCl (pH 7.9), 100mM NaCl,1mM EDTA,5mM DTT,0.1% (V/V) triston X-100,50% (V/V) glycerol, 100U/ul MMLV enzyme (low RNAse H+), 40U/ul T7 RNA polymerase, 0.3U/ul RNase H; reaction liquid 3: a basic reaction unit in which the basic buffer solution and the reaction solution I are redissolved.
In the step 2, the reaction conditions comprise a non-circulating phase at 65 ℃ for 5min, a circulating phase at 42 ℃ for 5min and a circulating phase at 42 ℃ for 60 min.
In the step 3, the reaction system contains 400mM Tris-HCL PH 7.4, RNase-free water, dilution of Cas13a protein, crRNA, a probe and the product of the last step.
In the step 3, the reaction condition is 37 ℃ for 30min.
In the step 3, the nucleotide sequence of the probe is shown as SEQ ID 13; when the FAM (495/520) channel fluorescence signal judgment result is acquired, 6-FAM and BHQ1 are modified at the 5 'end and the 3' end; when the test paper strip judges the result, 6-FAM and Botin are modified at the 5 'end and the 3' end;
GAAUUCCACCACGUUCCCGUGG(SEQ ID 13)。
the beneficial effects of the invention are as follows: 1. a TMA-RAA-CRISPR-Cas13a HCV nucleic acid detection method is established, the detection time is short, the specificity is high, the sensitivity is good, the detection time can reach 10 copies/ul, and the result is judged to use a portable fluorescent detector or a test strip which is a cheap instant detection (pact) device, so that the detection method is suitable for basic medical units. 2. A TMA-RAA-CRISPR-Cas13a HCV type 3 identification method is established, the specificity of the detection result of the method is high, whether HCV is type 3 or other genotype infection or simple infection or mixed infection can be easily judged, and therefore, the method provides help for HCV infected persons to select a reasonable DAA treatment scheme.
Drawings
FIG. 1 is a schematic representation of the sequence alignment and design of primers, universal CrRNA, and specific CrRNA positions for each genotype 5' UTR of HCV.
FIG. 2 is a schematic representation of TMA-RAA-CRISPR-Cas13a HCV nucleic acid detection and HCV genotype 3 analysis.
FIG. 3 is a diagram showing the results of a specific experiment of TMA-RAA-CRISPR-Cas13a HCV nucleic acid detection method, wherein the A region is a typical fluorescence value change curve of a positive sample and a negative sample, and the fluorescence value change amount of the B region refers to the difference between the fluorescence value at 30min and the fluorescence value at 0min, namely RFU (30 min) -RFU (0 min). Wherein 1. In vitro transcribed RNA (HCV type 1 b) standard; 2. in vitro transcribed RNA (HCV type 3 a) standard; 3. healthy human plasma RNA;4. serum DNA from hepatitis b patient; l02 cellular RNA; EB virus patient serum DNA;7. novel coronavirus ribonucleic acid genome standard (GBW (E) 091099); 8. staphylococcus aureus nucleic acid; 9. candida albicans nucleic acid; 10. no rnase water.
FIG. 4 is a graph of experimental results of TMA-RAA-CRISPR-Cas13 HCV genotype 3 assay. Wherein, hcv3a rna standard; hcv1brna standard; an equal volume of hcv3a,1b rna standard mixture; 4. no rnase water.
FIG. 5 is a graph of clinical sample validation results of TMA-RAA-CRISPR-Cas13a HCV nucleic acid detection method.
FIG. 6 shows the detection result of TMA-RAA-CRISPR-Cas13a HCV nucleic acid detection method using lateral flow test strips, wherein the A region is the detection principle of the lateral flow test strip by the vanishing line method, the B region is a positive sample, and the HCV1B standard 10 5 -10 3 Copy/ul, negative samples, no RNase water detection results.
Detailed Description
Example 1 primers, crRNA, reporter RNA of the invention
The specificity of the invention is realized by combining primers and different CrRNAs, the primers designed in the 5' UTR region of the hepatitis C virus gene are highly conserved, the universal CrRNA is completely matched with the hepatitis C virus gene or has only one base mismatch outside 3-5 bases of a spacing region (near an anchor sequence), and 3-5 bases of the spacing region (near the anchor sequence) of the specific CrRNA are mismatched with the non-targeted genotype hepatitis C virus.
The reference sequences used for genotyping in the Los Alamos HCV database were downloaded, and the 5' utr region was compared, and forward primers, reverse primers, universal CrRNA and specific CrRNA were designed in the 124-315 position (accession number: EF 032892.1) range. The synthesis of primer and CrRNA was performed by the biotechnology limited company, shanghai, and the synthesis of reporter RNA was performed by the biotechnology limited company, nanjing gold. RAA primer, crRNA, reporter RNA1 (6-FAM/BHQ 1 modification) and reporter RNA2 (6-FAM/Botin modification) were diluted with RNase-free water to 10uM,10ng/ul,2uM and 20uM, respectively, and stored at-20deg.C. The sequences are shown in Table 1, and the HCV genotypes are aligned as shown in FIG. 1.
TABLE 1
Example 2 preparation of standards and extraction of HCV RNA from clinical specimens
And (3) preparation of a standard substance: pUC57-Simple-HCV 1b and 3a plasmids containing fragments of bases 124 to 315 (accession number: EF 032892.1) of the HCV-1b 5'UTR region, and bases 105 to 296 (Genebank ID: X76918.1) of the HCV-3a 5' UTR region were synthesized by Nanjin gold Biotechnology Co., ltd. PCR was performed using the HCV-F and R primers of example 1, T7 RNA polymerase in vitro transcription, DNAaseI enzyme digestion, column type RNA rapid concentration purification kit purification, RNA concentration measurement by ultraviolet spectrophotometer, dilution to 10 with RNase-free water 8 Copy/ml and diluted at 10-fold gradient to give 5 concentration standards: 10 7 -10 3 The copies/ml were stored at-20℃until use.
Extraction of HCV RNA from clinical specimens: EDTA anticoagulation specimen 1600g centrifugal 10min, sucking 140ul plasma, using virus RNA extraction kit extraction, preserving at-20 deg.C for standby.
The purchase sources and types of the reagents in this experiment were as follows:
t7 RNA polymerase, 9014-24-8, shanghai Yuan Yeast Biotechnology Co., ltd
TAKARA LA Taq with GC Buffer kit, RR02AG, beijing Bao Ri doctor materials technology Co., ltd
DNAaseI enzyme, B618252-0001, shanghai Biotechnology Co., ltd
Column type RNA rapid concentration and purification kit, B518688-0050, shanghai Biotechnology Co., ltd
PCR instrument, T100TMthermal Cycler, bio-Rad Co., U.S.A
Ultraviolet spectrophotometry, nanoDrop 2000C, sammer feishi technologies, inc
Virus RNA extraction kit, DP315-R, beijing Tiangen Biochemical technology Co., ltd
Example 3
The detection principle of the invention is shown in figure 2.
The sensitivity of the invention is achieved by a combination of sequence amplification by transcription mediated amplification technology (transcription mediated amplification, TMA) and recombinase mediated amplification (Recom binase aided amplification, RAA) cross-reaction, and enzymatic cascade reaction by Cas13a protein. The purpose of the T MA and RAA cross-uses is to produce more target sequence product in a shorter time. MMLV reverse transcriptase (low RNaseH+) and RNaseH enzymes can be used instead of wild type MMLV reverse transcriptase (RNaseH+) or other reverse transcriptases with RNaseH+.
Preparing a reaction solution I: the composition was 50mM Tris-HCl (pH 7.9), 75mM KCl,4mM Mgcl2,10mM DTT,0.5mM dNTPs,2mM spermidine,2mM NTPs,DMSO 2.5ul,500nM HCV-F and R primers as in example 1.
Preparing a reaction solution II: the components were 50mM Tris-HCl (pH 7.9), 100mM NaCl,1mM EDTA,5mM DTT,0.1% (V/V) trisstonX-100, 50% (V/V) glycerol, 100U/UL MMLV enzyme, 40U/UL T7 RNA polymerase, 0.3U/UL RNase H enzyme.
Preparing a reaction solution III:25ul of base buffer redissolved one portion of the base reaction unit and an equal volume of reaction solution I was added. Preparing Cas13a protein: cas13a protein stock was diluted to 63.24ng/uL with a buffer of composition 50mM Tris Hcl Ph 7.5, 600mM NaCL,5% glycerol, 2mM DTT. The specific operation is as follows:
the first step: the reaction system was prepared as follows:
65℃for 5min and 42℃for 5min, and immediately after the completion, the mixture was placed on ice.
And a second step of: the reaction system was prepared as follows:
1ul of magnesium acetate was added and incubation was continued for 60min at 42℃and immediately after completion on ice.
And a third step of: the reaction system was prepared as follows:
fourth step: and (3) result judgment:
when the method is used for detecting the hepatitis C virus nucleic acid, the judgment result is as follows: 1) The FAM (495/520) channel fluorescence signal is collected, the positive sample fluorescence value changes obviously, the positive sample fluorescence value rises exponentially, and the negative sample fluorescence value does not change or changes very little. 2) The line-eliminating lateral flow test strip has the positive sample T line disappeared or almost disappeared, the C line appears, the negative sample T line is obvious, and the C line appears.
Report RNA1: FAM (495/520) channel fluorescence signals were collected every 5min at 37℃for 30min. The HCV RNA detection is a qualitative method, the fluorescence value of a positive sample is obviously changed and is increased exponentially, and the fluorescence value of a negative sample is not changed or is changed very little. HCV type 3 detection is a method for obtaining a result by comparison, wherein the fluorescence value change of type 3 specific CrRNA is obvious compared with that of non-type 3 specific CrRNA, and the non-type 3 HCV is opposite.
Report RNA2: after 30min of reaction, the mixture is dripped on a lateral flow test strip sample pad, and the result is a vanishing line method, wherein the T line of a positive sample is vanished or almost vanished, the C line is normal, the T line of a negative sample is clear, and the C line is normal.
The purchase sources and types of the reagents in this experiment were as follows:
tris HCl Ph 7.4, B548138-0500, shanghai Biotechnology Co., ltd
MgCl 2 B60193-0015, shanghai Biotechnology Co., ltd
DTT, A300862-0005 Shanghai Biotechnology Co., ltd
dNTPs, B500055-0250, shanghai Biotechnology Co., ltd
rNTPs, B600059-0001, shanghai Biotechnology Co., ltd
DMSO, A610163-0250, shanghai Biotechnology Co., ltd
Glycerol, A100854-0100, shanghai Biotechnology Co., ltd
MMLV enzyme, ER107, beijing Tiangen Biochemical Co., ltd
RNase H enzyme, B110070, shanghai Biotechnology Co., ltd
RAA kit, B00000, jiangsu Qiyan Gene Biotechnology Co., ltd
Cas13a protein, cas13a, shanghai Hui Cheng Biotechnology Co., ltd
Fluorescent microplate reader, synergy HT, bioTek Co., U.S.A.)
Secondary nucleic acid test strip, LFD, beijing Junnuode Biotechnology Co., ltd
Example 4 specificity and minimum detection limit analysis
The in vitro transcribed RNA 1b and 3a standard (107 copies/ml), healthy human plasma RNA, hepatitis B patient serum DNA, L02 cell RNA, EB virus patient serum DNA, novel coronavirus ribonuclease genome standard (GBW (E) 091099), staphylococcus aureus nucleic acid, candida albicans nucleic acid, RNase-free water (negative control) of example 2 were tested according to the method using the universal crRNA of example 1 to verify specificity. The result is shown as a region B in FIG. 3, and the fluorescence value of the in vitro transcribed RNA standard substance changes significantly and is positive; the fluorescence values of the other groups of samples hardly change, and the samples are negative. The invention has high specificity, and no cross reaction exists in the detection process.
10 obtained by gradient dilution in example 2 was detected by the method of example 3 using the universal crRNA in example 1 7 -10 3 Copies/ml of in vitro transcribed HCV1b RNA standard and RNase-free water (negative control) were tested 20 times with a concentration level of 95% positive detection rate as the lowest limit of detection. Experimental results show that the minimum detection limit of the invention is 10 4 Copy/ml.
Example 5HCV Gene type 3 and non-type 3 analysis
The judging method for the type 3 identification of the hepatitis C virus comprises the following steps: collecting FAM (495/520) channel fluorescence signals, wherein the fluorescence value change of the 3-type sample using 3-type specific CrRNA is obvious compared with that of the non-3-type specific CrRNA, and the fluorescence value change of the non-3-type sample using non-3-type specific CrRNA is obvious compared with that of the 3-type specific CrRNA
HCV1b RNA standard (107 copies/ml), 3a standard (107 copies/ml), RNase-free water (negative control) and 1b,3a standard (10 7 Copy/ml) of an equal volume of the mixture. As shown in FIG. 5, in vitro transcribed RNA 3a showed a large change in fluorescence value using type 3 specific CrRNA and a small change in fluorescence value using non-type 3 specific CrRNA; the invention can be specifically detected no matter HCV type 3 or other genotypes, whether the infection is simple or mixed.
Example 6 clinical sample detection Effect
30 cases of EDTA anticoagulation residual specimens for quantitative examination of HCVRNA were collected in the clinical laboratory of the civil hospital in Tazhou, 6-7 months in 2020, and HCV RNA from clinical specimens was extracted by the method of example 2, using the general crRNA detection in example 1 as a template, and the results obtained by the clinical laboratory were compared (Cobas ampliprep/Cobas taqman kit, fluorescent PCR method) according to the method of example 3. The results are shown in Table 2,
30 clinical samples are detected by using the method, and the positive consistency rate is 14/15=93.3%; : negative agreement was 15/15=100%, overall agreement: 29/30=96.6%, which shows that the invention has good clinical application value.
TABLE 2
Example 7 detection with lateral flow dipsticks
In vitro transcribed HCV1b standard 10 from example 2 was detected using the universal crRNA from example 1 using a test strip according to the method of example 3 5 -10 3 Copy/ul, RNase-free water, positive samples, negative samples in example 6. The detection principle of the lateral flow test strip by the line elimination method is shown in a region A of fig. 6, the result is shown in a region B of fig. 6, and when a detected sample is positive, R is reportedNA is totally or mostly cut off, streptavidin (T-line) cannot intercept 5' end of reporter RNA2 bound to nano gold label 6-FAM, T-line disappears or almost disappears, anti-rabbit antibody line (C-line) is normal. When the sample is negative, most of the report RNA is complete, and the streptavidin (T line) can intercept the 5' end of the report RNA combined with the nano gold label 6-FAM, the T line is obvious, but the C line is still visible because the interception is incomplete. In the experiment, the negative sample and RNase-free water have obvious T line, C line exists, HCV1b standard and positive sample are transcribed in vitro, the T line disappears, and the C line exists.
Sequence listing
<110> Taizhou City people Hospital
<120> primer pair for detecting and identifying hepatitis C virus, crRNA, detection method and kit
<130> none of
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 52
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
aattctaata cgactcacta tagggctgcg gaaccggtga gtacaccgga at 52
<210> 2
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
tgcacggtct acgagacctc ccg 23
<210> 3
<211> 192
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ctgcggaacc ggtgagtaca ccggaattgc caggacgacc gggtcctttc ttggatcaac 60
ccgctcaatg cctggagatt tgggcgtgcc cccgcgagac tgctagccga gtagtgttgg 120
gtcgcgaaag gccttgtggt actgcctgat agggtgcttg cgagtgcccc gggaggtctc 180
gtagaccgtg ca 192
<210> 4
<211> 64
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gauuuagacu accccaaaaa cgaaggggac uaaaacggca cucgcaagca cccuaucagg 60
cagu 64
<210> 5
<211> 36
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
gauuuagacu accccaaaaa cgaaggggac uaaaac 36
<210> 6
<211> 28
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
ggcacucgca agcacccuau caggcagu 28
<210> 7
<211> 64
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
gauuuagacu accccaaaaa cgaaggggac uaaaacagug aucucgcggg ggcacgccca 60
aauc 64
<210> 8
<211> 64
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gauuuagacu accccaaaaa cgaaggggac uaaaacagca gucucgcggg ggcacgccca 60
aauc 64
<210> 9
<211> 36
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
gauuuagacu accccaaaaa cgaaggggac uaaaac 36
<210> 10
<211> 36
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
gauuuagacu accccaaaaa cgaaggggac uaaaac 36
<210> 11
<211> 28
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
agugaucucg cgggggcacg cccaaauc 28
<210> 12
<211> 28
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
agcagucucg cgggggcacg cccaaauc 28
<210> 13
<211> 22
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
gaauuccacc acguucccgu gg 22

Claims (3)

1. A TMA-RAA-CRISPR-Cas13a method for hepatitis c virus nucleic acid detection and hepatitis c virus type 3 identification for non-diagnostic purposes comprising the steps of:
step 1, extracting RNA from a human plasma sample;
step 2, performing cross amplification on the RNA sample extracted in the step 1 by TMA and RAA to obtain an RNA amplification product;
step 3, combining the RNA amplification product obtained in the step 2 with CrRNA to cause the Cas13a protein to cleave the probe, and judging the result; in the step 2, a primer pair with a nucleotide sequence shown as SEQ ID NO.1-2 is adopted for cross amplification of TMA and RAA;
in the step 3, the steps include:
combining the universal CrRNA with an RNA amplification product, and obtaining a combined fluorescence intensity signal, wherein if the fluorescence intensity is increased, the sample contains hepatitis C virus;
in the step 3, the steps further include:
respectively adopting 3-type nonspecific CrRNA and 3-type specific CrRNA to combine with RNA amplification products, and obtaining a combined fluorescence intensity signal;
if the fluorescence intensity after the type 3 specific CrRNA reaction is higher than that of the type 3 non-specific CrRNA, the sample is type 3 hepatitis C virus;
if the fluorescence intensity after the type 3 specific CrRNA reaction is lower than that of the type 3 non-specific CrRNA, the sample is non-type 3 hepatitis C virus;
the nucleotide sequence of the universal CrRNA is shown as SEQ ID.4; the nucleotide sequence of the 3-type specific CrRNA is shown as SEQ ID.7, and the nucleotide sequence of the 3-type non-specific CrRNA is shown as SEQ ID.8.
2. The method according to claim 1 for detecting hepatitis C virus nucleic acid and hepatitis C virus type 3The identified TMA-RAA-CRISPR-Cas13a method is characterized in that in the step 2, a reaction system contains an RNA template; reaction liquid 1:50mM Tris-HCL,75mM KCl,4mM MgCl 2 10mM DTT,0.5mM dNTPs,2mM spermidine,2mM NTPs,DMSO 2.5ul,500nM primer; reaction liquid 2:50mM Tris-HCL,100mM NaCl,1mM EDTA,5mM DTT,0.1%tritonX-100,50% glycerol, 100U/ul MMLV enzyme, 40U/ul T7 RNA polymerase, 0.3U/ul RNase H; reaction liquid 3: a basic reaction unit in which the basic buffer solution and the reaction solution I are redissolved;
in the step 2, the reaction conditions comprise a non-circulating phase at 65 ℃ for 5min, a circulating phase at 42 ℃ for 5min and a circulating phase at 42 ℃ for 60 min.
3. The method of TMA-RAA-CRISPR-Cas13a for hepatitis C virus nucleic acid detection and hepatitis C virus type 3 identification according to claim 2, wherein in step 3, the reaction system contains 400mM Tris-HCl pH 7.4, RNase-free water, dilution of Cas13a protein, crRNA, probe and the product of the previous step;
in the step 3, the reaction condition is 37 ℃ for 30min;
in the step 3, the nucleotide sequence of the probe is shown as SEQ ID 13; when FAM channel fluorescence signal judgment results are collected, 6-FAM and BHQ1 are modified at the 5 'end and the 3' end; when the test strip judges the result, 6-FAM and Biotin are modified at the 5 'end and the 3' end.
CN202111601917.3A 2021-12-24 2021-12-24 Primer pair, crRNA, detection method and kit for detecting and identifying hepatitis C virus Active CN114480732B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111601917.3A CN114480732B (en) 2021-12-24 2021-12-24 Primer pair, crRNA, detection method and kit for detecting and identifying hepatitis C virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111601917.3A CN114480732B (en) 2021-12-24 2021-12-24 Primer pair, crRNA, detection method and kit for detecting and identifying hepatitis C virus

Publications (2)

Publication Number Publication Date
CN114480732A CN114480732A (en) 2022-05-13
CN114480732B true CN114480732B (en) 2024-03-12

Family

ID=81496177

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111601917.3A Active CN114480732B (en) 2021-12-24 2021-12-24 Primer pair, crRNA, detection method and kit for detecting and identifying hepatitis C virus

Country Status (1)

Country Link
CN (1) CN114480732B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104694662A (en) * 2015-04-03 2015-06-10 杜文红 Nucleic acid isothermal amplification reaction detecting method and detection kit based on nucleic acid isothermal amplification reaction detecting method
CN111363847A (en) * 2020-02-12 2020-07-03 广州微远基因科技有限公司 2019-nCoV rapid detection primer group based on CRISPR technology and application thereof
CN111926117A (en) * 2020-08-18 2020-11-13 上海交通大学 SARS-CoV-2 virus nucleic acid isothermal rapid detection kit and detection method
CN112080587A (en) * 2020-08-31 2020-12-15 上海海关动植物与食品检验检疫技术中心 RAA-CRISPR amplification primer group, kit and method for efficiently detecting novel coronavirus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104694662A (en) * 2015-04-03 2015-06-10 杜文红 Nucleic acid isothermal amplification reaction detecting method and detection kit based on nucleic acid isothermal amplification reaction detecting method
CN111363847A (en) * 2020-02-12 2020-07-03 广州微远基因科技有限公司 2019-nCoV rapid detection primer group based on CRISPR technology and application thereof
CN111926117A (en) * 2020-08-18 2020-11-13 上海交通大学 SARS-CoV-2 virus nucleic acid isothermal rapid detection kit and detection method
CN112080587A (en) * 2020-08-31 2020-12-15 上海海关动植物与食品检验检疫技术中心 RAA-CRISPR amplification primer group, kit and method for efficiently detecting novel coronavirus

Also Published As

Publication number Publication date
CN114480732A (en) 2022-05-13

Similar Documents

Publication Publication Date Title
CN111593145B (en) CRISPR/Cas12 one-step nucleic acid detection method and novel coronavirus detection kit
EP4202064A1 (en) Kit and method for isothermal rapid detection of sars-cov-2 virus nucleic acid
CN111560482B (en) Detection method based on CRISPR/Cas and nucleic acid test paper and human papilloma virus detection kit
CN111500771B (en) Primer group and kit for detecting novel coronavirus SARS-CoV-2
Romano et al. NASBA technology: isothermal RNA amplification in qualitative and quantitative diagnostics
CN108060269B (en) DPO primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus and application thereof
CN112375847B (en) Hepatitis B virus genotyping detection method based on CRISPR/Cas13a system
EP1761645A1 (en) Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1
Varmus et al. Use of DNA-DNA annealing to detect new virus-specific DNA sequences in chicken embryo fibroblasts after infection by avian sarcoma virus
CN110343785B (en) Kit for detecting hepatitis B virus covalent closed circular DNA based on PCR-CRISPR-cas13a
CN111733293A (en) Double-stranded primer probe, kit and multiplex PCR method for detecting SARS-COV-2
CN111394431B (en) Method for detecting nucleic acid by using double real-time fluorescent isothermal amplification technology
CN109196124A (en) The kit and method of the multiple Taqman probe qPCR of detection and four kinds of haematogenous virus of quantitative analysis simultaneously
US20070281295A1 (en) Detection of human papillomavirus E6 mRNA
CN102367488B (en) Enterovirus triple real-time fluorescent quantitative RT-PCR detection kit
EP2597162A1 (en) Nucleic acid detection
CN114480732B (en) Primer pair, crRNA, detection method and kit for detecting and identifying hepatitis C virus
CN115323075B (en) RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit
WO2006132601A1 (en) Diagnostic primers and method for detecting avian influenza virus subtype h5 and h5n1
CN114214455B (en) Quick quantitative primer probe for hepatitis B virus DNA and CRISPR/Cas12b detection system thereof
CN105803079B (en) Specific primer and probe and method for fluorescence quantitative PCR detection circular rna-ZAP
CN115029345A (en) Nucleic acid detection kit based on CRISPR and application thereof
CN107988429B (en) Reagent for detecting rabies virus and application thereof
CN106868177B (en) Novel nucleic acid fluorescence quantitative detection method
CN113801966B (en) Fluorescent quantitative PCR method and kit for detecting novel coronavirus subgenomic

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant