CN115927455A

CN115927455A - Construction method and application of animal model of Bag5 knockout mouse

Info

Publication number: CN115927455A
Application number: CN202210715706.0A
Authority: CN
Inventors: 袁水桥; 甘世明; 熊孟能; 周淑敏; 熊欣欣; 范旭; 刘款; 杨诗语; 江楠
Original assignee: Huazhong University of Science and Technology
Current assignee: Huazhong University of Science and Technology
Priority date: 2022-06-22
Filing date: 2022-06-22
Publication date: 2023-04-07

Abstract

The invention discloses a construction method and application of a Bag5 gene knockout mouse animal model for the first time, and belongs to the technical field of biology. The construction method comprises the following steps: determining two specific targets gRNA1 and gRNA2 of a gene to be knocked out of a Bag5 mouse according to a Bag5 gene sequence by using an efficient CRISPR/Cas9 gene editing technology, transcribing the two specific targets gRNA1 and gRNA2 with Cas9 nuclease in vitro to form mRNA, injecting the mRNA into a mouse fertilized egg in a microinjection manner, transplanting the mouse fertilized egg into an egg duct of a surrogate mother mouse, subculturing after the mouse is produced, and obtaining a stably-inherited Bag5 gene knockout mouse animal model through genotype identification. The invention identifies the non-fertile phenotype of the headless spermatozoon in a Bag5 knockout mouse model for the first time, injects the spermatozoon into a well-developed egg cell through ICSI technology, successfully enables the sterile mouse to generate offspring again, provides a Bag5 gene knockout mouse animal model for researching clinical headless spermatozoon patients, provides basis for the action mechanism and treatment of headless spermatozoon diseases, and verifies the application of mutation screening of the Bag5 gene in the prevention of the headless spermatozoon diseases.

Description

Construction method and application of animal model of Bag5 knockout mouse

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a construction method and application of a Bag5 gene knockout mouse animal model.

Background

BCL 2-associated athanogene 5 predicts adenylate-nucleotide exchange factor activity; a partner binding activity; and enzyme binding activity. Are expected to be involved in a number of processes, including the negative regulation of cellular protein metabolic processes; negative regulation of protein refolding; and protein stabilization. Expected to be located in inclusion bodies; a mitochondrion; and the perinuclear region of the cytoplasm. Activity in the cytosol, membrane and nucleus is expected. Is directly homologous to human Bag5 (Bag cocadone 5).

It is estimated that infertile couples caused by male factors are increasing year by year. Infertile men are usually treated clinically In reproduction by Assisted Reproductive Technologies (ARTs), such as In Vitro Fertilization (IVF), intracytoplasmic Sperm Injection (ICSI), and Intrauterine Insemination (IUI). With the increase of male sterility probability caused by environment and physiological environment, the main reasons of male sterility are the low sperm count, high sperm malformation rate or poor motility, and ejaculatory dysfunction or semen output duct obstruction, etc., wherein the headless sperm disease phenotype caused by gene mutation can cause severe sterility.

At present, researches on the Bag5 gene are few, particularly in the field of reproductive health, no related report exists at present, and the Bag5 gene has any special function in the process of male spermatogenesis, so that the establishment of a C57 mouse model for knocking out the Bag5 gene and the establishment of a model for anemic spermatozoa on the basis of the model have important significance for researching the function, related mechanism and possibly involved molecular pathway of Bag5 in anemic spermatozoa, and simultaneously provide a new theoretical basis for guiding the prevention, treatment and screening of diseases of anemic spermatozoa patients.

Disclosure of Invention

The first purpose of the invention is to provide a construction method of a Bag5 gene knockout mouse animal model.

The second purpose of the invention is to provide the application of the Bag5 gene in screening the clinical headless spermatozoa disease.

A third object of the present invention is to provide a treatment regimen for patients with clinical headless spermatozoa.

The fourth purpose of the invention is to provide preventive measures for patients with clinical headless spermatozoon disease.

In order to realize the purpose, the invention adopts the following technical scheme:

the construction method of the Bag5 gene knockout mouse animal model is constructed on the basis of CRISPR/Cas9 gene knockout technology, and comprises the following steps:

(1) Determining two specific targets gRNA1 and gRNA2 of a gene to be knocked out of a Bag5 mouse according to a Bag5 gene sequence, and transcribing the two specific targets gRNA1 and gRNA2 with Cas9 nuclease in vitro into mRNA;

(2) Microinjecting mRNA of two specific target spots gRNA1, gRNA2 and Cas9 into mouse fertilized eggs, and transplanting the fertilized eggs after microinjection into an egg conveying pipe of a surrogate mother mouse;

(3) After the mouse is produced, subculturing is continued, and a stable genetic animal model of the Bag5 knockout mouse is obtained through genotype identification;

wherein, the target sequence of the gRNA1 is shown as SEQ ID NO. 1, and the target sequence of the gRNA2 is shown as SEQ ID NO. 2.

Preferably, in the step (3), the fertilized eggs after microinjection are transplanted into an egg conveying tube of a surrogate mother mouse, and the produced mouse is an F0 generation mouse; extracting tail DNA of the F0 generation mouse, carrying out PCR amplification and sequencing a product, mating a positive mouse and a wild type heterozygote mouse to obtain an F1 generation heterozygote mouse, and hybridizing the F1 generation heterozygote mouse to obtain an F2 generation homozygote mouse until a stable genetic Bag5 gene knockout mouse animal model is obtained;

wherein, if the DNA is a 271bp strip, the DNA is a positive homozygote; if the two bands are 271bp and 663bp, the hybrid is a positive hybrid; if the gene is a 663bp band, the gene is a wild type control.

The invention also provides application of the Bag5 gene knockout mouse animal model in research of headless spermatozoon diseases. The method comprises the following steps:

(1) And (3) inducing superovulation of the female egg-supplying mice: selecting 4-week-old, healthy and well-conditioned wild female mice, injecting 8U of pregnant mare serum gonadotropin into the abdominal cavity on the first day, and injecting 8U of human chorionic gonadotropin into the abdominal cavity after 46-48 h.

(2) Collecting the egg cells: after injecting human chorionic gonadotropin for 10h to 13h, the egg-donor female mouse is sacrificed by cervical dislocation, the egg cells are collected by operation, and the collected egg cells are placed in a culture drop prepared in advance.

(3) Collecting sperm heads: the epididymal tail is taken out after the operation of anesthetizing the male mouse, and the epididymal tail is cut into pieces after removing the peripheral adhesive tissues, fat and blood vessels. The minced epididymal tail is placed in a prepared sperm releasing drop to release the sperm head from the epididymal tail of a mouse with headless sperm disease.

(4) Intracytoplasmic sperm injection: sperm heads are injected into cytoplasm of the oocytes by using a micromanipulation system, and then the oocytes which are completely injected are transferred to a KSOM culture drop which is prepared in advance for culture.

(5) After the zygotes grow and develop, fertilized eggs with good shapes and states are selected, and a proper amount of fertilized eggs are transplanted into a prepared pseudopregnant female mouse.

(6) And after the transplantation is finished, breeding the surrogate mother mouse in an environment with proper temperature and humidity, waiting for the birth of cubs, and calculating the number of the cubs.

Preferably, in the step (4), after fertilization is finished, the fertilized eggs are observed to develop, including a two-cell embryo, a blastula and whether offspring can be generated, wherein if the fertilized eggs successfully develop into the two-cell embryo, the blastula and the generated offspring, the headless spermatozoon sterile phenotype caused by the deletion of the Bag5 gene is successfully rescued.

The invention also provides application of the Bag5 gene in screening headless spermatozoon, and if the Bag5 gene is found to have mutation clinically through a gene sequencing technology, the phenotype of headless spermatozoon sterility is judged.

The invention also provides application of the Bag5 gene in treating headless spermatozoon diseases, if clinical application shows that the mutation of the Bag5 gene causes the headless spermatozoon sterility phenotype through a gene sequencing technology, sterility can be successfully treated through an egg cell intracytoplasmic sperm injection technology, and offspring is generated.

The invention also provides the application of the Bag5 gene in preventing headless spermatozoon diseases, if a patient with Bag5 gene mutation is found clinically, the selection of the partner is preferably healthy person without mutation identified by gene sequencing, so as to prevent the headless spermatozoon diseases of offspring.

The invention has the beneficial effects that:

(1) The invention designs specific targets gRNA1 and gRNA2 of genes to be knocked out of a Bag5 mouse based on CRISPR/Cas9 gene editing and knocking-out technology, successfully constructs a Bag5 gene knocking-out mouse animal model, and provides a main animal experimental material for researching headless sperm disease by identifying that exon2 of a Bag5 gene is partially knocked out.

(2) The invention constructs a mouse model with the Bag5 gene defect through a gene editing technology for the first time, discovers the phenotype of the headless spermatozoa disease caused by the Bag5 defect for the first time, researches the relationship among the clinical expression, pathological characteristics, disease states, pathogenesis and possible molecular pathways of the Bag5 gene in the headless spermatozoa disease by means of molecular biology, immunohistochemical staining, single cell sequencing and the like, and provides a theoretical basis for researching the action mechanism and related treatment research of a Bag5 family in the clinical headless spermatozoa disease of human.

(3) The invention treats the mouse model with the Bag5 gene defect by the oocyte intracytoplasmic single sperm injection technology for the first time, provides a scheme for the treatment of clinical barren sperm disease sterile phenotype, is beneficial to screening the barren sperm disease patients caused by gene mutation, and provides guiding significance for the prevention of offspring, if the patients with the Bag5 gene mutation are found, the selection of the partner is preferably healthy people without mutation identified by gene sequencing.

Drawings

FIG. 1 is a flowchart of a method for constructing and analyzing a Bag5 knockout mouse animal model in examples.

FIG. 2 is a graph of the reaction of CHOPCHOP (http://chopchop.cbu.uib.no/) And designing a website, and designing two screening graphs of the high-efficiency target gRNA.

FIG. 3 is a flow chart of a method for constructing a model of headless spermatozoa disease of a Bag5 knockout mouse by gene editing technology.

FIG. 4 is a diagram showing the conserved sequence analysis of the Bag5 gene in nine different species.

FIG. 5 is the percent homology of the Bag5 gene among nine different species.

FIG. 6 is a phylogenetic tree of the Bag5 gene among nine different species.

FIG. 7 is a testis comparison of Bag5 knockout mice with wild type mice, and no significant difference was found.

FIG. 8 is a graph showing the testis body weight ratio between a Bag5 knockout mouse and a wild type mouse, and no significant difference was found.

FIG. 9 is a graph showing the ratio of epididymis body weight of a Bag5 knockout mouse to that of a wild type mouse, and no significant difference was observed.

FIG. 10 is a graph showing epididymis sperm count in a Bag5 knockout mouse and a wild-type mouse, and no significant difference was observed.

FIG. 11 is a fertility test of a Bag5 knockout mouse and a wild-type mouse, and it was found that the Bag5 knockout mouse had no offspring and could not be born.

Fig. 12 is a graph showing the percentage of headless sperm in the Bag5 knockout mouse and the wild-type mouse, and it was found that the percentage of headless sperm in the Bag5 knockout mouse was significantly increased to 90% or more, whereas the percentage of headless sperm in the control group was only about 10%.

Fig. 13 is a graph showing the percentage of abnormal sperm head directions of a Bag5 knockout mouse and a wild-type mouse, and it is found that the percentage of abnormal sperm head directions of the Bag5 knockout mouse in a sperm producing lumen is significantly increased to be more than 12%, while the percentage of abnormal sperm head directions of the Bag5 knockout mouse in the sperm producing lumen is only about 2%.

FIG. 14 is a microscopic image of sperm from a Bag5 knockout mouse, showing that sperm are not in the forward direction of movement of the screw, but are rotated in situ, and have no sperm head, but are incapable of entering the egg.

FIG. 15 is a genotype identification runner map of a Bag5 knockout mouse, a heterozygote, and a wild-type mouse.

FIG. 16 is a graph showing the expression level of Bag5 protein in a Bag5 knockout mouse and a wild-type mouse, and it was found that the Bag5 protein in the knockout mouse is not expressed.

FIG. 17 is a graph showing HE staining and PAS staining of a Bag5 knockout mouse and a wild-type mouse, and it was found that sperm were headless and sperm heads were abnormally oriented in the lumen.

FIG. 18 is a schematic stage diagram of PAS staining tube lumens of testis tissues of a Bag5 knockout mouse and a wild type mouse, and it was found that sperm heads are directed abnormally.

FIG. 19 is a detailed stage chart of PAS staining lumens of testis tissues of a Bag5 knockout mouse and a wild type mouse, and it was found that sperm heads are abnormally oriented.

FIG. 20 is a PAS staining pattern of epididymal tail tissue of Bag5 knockout mouse, in which there are few sperm heads, and wild type mouse.

FIG. 21 is a diagram showing the development of acrosome in a mouse with a Bag5 knockout gene and a wild type mouse, and no abnormalities in the development of the acrosome were found.

Fig. 22 is a graph of the count of sperm acrosomal dysplasia in Bag5 knockout mice versus wild-type mice, with no statistical difference significance found.

FIG. 23 shows immunofluorescence mapping of Bag5 knockout mice and wild type mice in testis tissue sections, and it was found that Bag5 protein is expressed in the neck of the 15-stage sperm, which is in the shape of a ring.

FIG. 24 is a diagram of sperm smear from wild type mouse testis with the Bag5 gene, and co-localization of sperm and USP protein at the fifteenth stage.

FIG. 25 is a microscopic image of the intracytoplasmic sperm injection technique of a Bag5 knockout mouse and a wild-type mouse.

FIG. 26 is a comparison of two cell developmental profiles of Bag5 knockout mice before and after treatment with the technique of intracytoplasmic sperm injection into oocytes.

FIG. 27 is a birth diagram of the offspring of Bag5 knockout mice treated with the technique of intracytoplasmic sperm injection in ovo with wild type mice.

Detailed Description

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

The technical solution of the present patent will be further described in detail with reference to the following embodiments.

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the drawings of the embodiments of the present invention. It is to be understood that the embodiments described are only a few embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the described embodiments of the invention without any inventive step, are within the scope of protection of the invention.

Basic information for knocking out the Bag5 gene in the following examples is: knock-out gene name (Ensembl): ENSMUSG00000049792, knock-out gene GenBank coding: NM _001324480.1;

number of exon of knockout gene:

knock-out for exon: exon2;

2, number of grnas constructed: 2, cutting;

and (3) micro co-injection: cas9 mRNA and gRNA mRNA generated by in vitro transcription were microinjected into mouse zygotes.

Example 1:

as shown in fig. 1, 2 and 3, a Bag5 knockout mouse animal model is constructed based on CRISPR/Cas9 knockout technology, and the steps are as follows:

(1) Two pairs of specific targets of the gene to be knocked out of the Bag5 mouse are determined according to the sequence of the Bag5 gene (GenBank code: NM-001324480.1):

Pair1：

gRNA1：TCCATTAGTAGGCTTCAGGA(SEQ ID NO:1)；

gRNA2：TGACGCACGTGAAGACCGGA(SEQ ID NO:2)；

the amplification primer sequences are designed according to two pairs of specific targets as follows:

Bag5-pair1-F：TAGGTCCTGAAGCCTACTAATGGA(SEQ ID NO:3)

Bag5-pair1-R：AAACTCCATTAGTAGGCTTCAGGA(SEQ ID NO:4)；

performing PCR amplification according to a PCR reaction system and reaction conditions shown in the table 1, and transcribing the amplified product with Cas9 nuclease in vitro to obtain mRNA;

(2) mRNAs of two specific target spots gRNA1 and gRNA2 and mRNA of Cas9 are microinjected into mouse fertilized eggs together by an embryo microinjection technology, and the fertilized eggs after microinjection are transplanted into an oviduct of a surrogate mother mouse by an embryo transplantation technology;

(3) Transplanting the fertilized eggs after microinjection into an egg conveying pipe of a surrogate mother mouse to produce a mouse, namely an F0-generation mouse; extracting tail DNA of an F0 generation mouse, carrying out PCR amplification and sequencing a product, mating a positive mouse and a wild type heteromouse to obtain an F1 generation heterozygote mouse, and hybridizing the F1 generation heterozygote mouse to obtain an F2 generation homozygote mouse until a stable genetic Bag5 gene knockout mouse animal model is obtained, wherein genotype identification is carried out according to the following gene identification primers:

Mouse Bag5-F：AGTGTTTAGAGTGGGTTCTTG(SEQ ID NO:5)；

Mouse Bag5-R：TCGCACATGACAGAGTTGAT(SEQ ID NO:6)；

if the DNA is a 271bp strip, the DNA is a positive homozygote; if the two bands are 663bp and 271bp, the hybrid is a positive hybrid; if the band is 663bp band, the band is a wild type control, and the statistical results are shown in Table 2.

TABLE 1

Ear tag number	Genotype(s)	Sex	Date of birth
				1	Homozygous knockout (271 bp)	Male sex	2022.4.1
2	Heterozygosity (271bp, 663bp)	Male sex	2022.4.1
				3	Homozygous wild type (663 bp)	Male sex	2022.4.1

TABLE 2

The relationship between the Bag5 gene and headless spermatozoon diseases is researched by means of molecular biology, immunohistochemical staining, single cell sequencing and the like. Selecting a gene-typed Bag5 knockout mouse, and feeding the mouse in an SPF-level environment for 8 weeks. According to FIG. 4, the conserved sequence analysis of genes was performed by the Bag5 knockout mouse animal model constructed in example 1.

As shown in fig. 5, the percent homology of the Bag5 gene among different species was analyzed by the Bag5 knockout mouse animal model constructed in example 1.

Phylogenetic tree analysis of genes was performed by the Bag5 knockout mouse animal model constructed in example 1 as shown in fig. 6.

Taking the mouse testis tissue to take a picture, and finding that the testis tissue has no obvious difference in size, as shown in figure 7; the testis and epididymis tissues of the mouse are weighed, the number of the testis, the epididymis and the number of sperms are not obviously different as shown in 8,9 and 10, a fertility test shows that a knockout mouse cannot breed to generate offspring as shown in fig. 11, and headless sperms and sperms with abnormal direction heads are obviously increased in the knockout mouse as shown in fig. 12 and 13.

Taking a picture of the epididymis sperm of the mouse, and finding that the epididymis sperm is headless and does not move forwards but moves in a circle, as shown in figure 14; the mice were genotyped, and it was found that the knockout mice had only one band (271 bp), while the heterozygotes had two bands, as shown in FIG. 15.

Taking the protein extracted from the mouse testicular tissue to perform an immunoblotting experiment, and finding that the expression of the Bag5 protein in the testicular tissue of the knockout mouse is obviously reduced, as shown in figure 16; taking the paraffin sections of the mouse testis and epididymis tissues to perform HE and PAS staining, finding that the sperm heads are abnormally arranged in the tube cavity, most of the sperm heads fall into the tube cavity of the testis as shown in figures 17, 18 and 19, and the number of the sperm heads is obviously reduced in the epididymis tail of the knockout mouse as shown in figure 20, but the acrosome of the sperm is normally developed in the whole process of the spermatogenic period as shown in figures 21 and 22.

Frozen sections and sperm smears of the mouse testis tissue and sperm were taken and immunofluorescent staining was performed, and it was found that the Bag5 protein was expressed in the neck of 15-long sperm cells and co-localized with USP14 protein, as shown in FIGS. 23 and 24.

The mouse epididymal sperm was taken and subjected to the egg cell intracytoplasmic sperm injection technique as shown in fig. 25, and the treated fertilized egg secondary cells, blastocysts and offspring were found to be normally produced as shown in fig. 26, 27 and table 3.

Intracytoplasmic sperm injection of egg cells	Bag5 wild type mice	Bag5 knockout mice
			Number of ova injected	18	17
Number of two-cell embryos	16	15
			Number of blastocysts	14	12

TABLE 3

(1) The invention designs specific targets gRNA1 and gRNA2 of a gene to be knocked out of a Bag5 mouse based on a CRISPR/Cas9 gene editing and knocking out technology, successfully constructs an animal model of the Bag5 gene knocked out mouse, and provides a main animal experimental material for researching headless sperm disease by identifying that exon2 of the Bag5 gene is partially knocked out.

The above embodiments are only for illustrating the present invention and not for limiting the present invention, and those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention, therefore all equivalent technical solutions also belong to the scope of the present invention, and the protection scope of the present invention should be defined by the claims.

/>

Claims

A method for constructing a Bag5 knockout mouse animal model, which is characterized in that: the method comprises the following steps:

(1) Determining two specific targets gRNA1 and gRNA2 of a gene to be knocked out of a Bag5 mouse according to a Bag5 gene sequence, and transcribing the two specific targets gRNA1 and gRNA2 with Cas9 nuclease in vitro into mRNA;

(2) Microinjecting mRNA of two specific target spots gRNA1 and gRNA2 and mRNA of Cas9 into mouse fertilized eggs, and transplanting the fertilized eggs after microinjection into an egg conveying pipe of a surrogate mother mouse;

(3) After the mouse is produced, subculturing is continued, and a stable genetic animal model of the Bag5 knockout mouse is obtained through genotype identification; wherein, the target sequence of the gRNA1 is shown as SEQ ID NO. 1, and the target sequence of the gRNA2 is shown as SEQ ID NO. 2.
2. The method for constructing a Bag5 knockout mouse animal model according to claim 1, characterized in that: in said step (3), said genotype is identified as:

if the gene is a 271bp band, the gene is a positive homozygote;

if the two bands are 663bp and 271bp, the hybrid is a positive hybrid;

if it is a 271bp band, it is a wild type control.
3. The method for constructing a Bag5 knockout mouse animal model according to claim 2, characterized in that: in the step (3), transplanting the fertilized eggs subjected to microinjection into an egg conveying pipe of a surrogate mother mouse to produce a mouse, namely an F0-generation mouse; extracting tail DNA of the F0 generation mouse, carrying out PCR amplification and sequencing a product, mating the positive mouse and a wild type heteromouse to obtain an F1 generation positive heterozygote mouse, and hybridizing the F1 generation positive heterozygote mouse to obtain an F2 generation positive homozygote mouse.
A Bag5 knock-out mouse animal model characterized by: the model is obtained by the method for constructing a Bag5 knockout mouse animal model according to any one of claims 1 to 3.
Application of the Bag5 gene knockout mouse animal model is characterized in that: deletion of the Bag5 gene results in a headless sperm disease sterile phenotype.
Application of the Bag5 gene knockout mouse animal model successfully rescues the headless sperm disease sterile phenotype caused by Bag5 gene deletion by the intracytoplasmic sperm microinjection technology, and is characterized in that: the method comprises the following steps:

(1) Releasing sperm heads from the epididymis tails of the mice with headless spermatozoa;

(2) Preparing an egg-supplying mother mouse in advance, and taking out egg cells;

(3) Injecting a single sperm into the center of an egg cell by microinjection using a fine needle of a micropipette;

and after fertilization is finished, observing the development states of the fertilized eggs including two-cell embryos, blastula and whether offspring can be generated, wherein if the fertilized eggs successfully develop into the two-cell embryos, the blastula and the generated offspring are the sterile phenotype for successfully rescuing the headless spermatozoa disease caused by the deletion of the Bag5 gene.
Application of Bag5 gene in screening headless spermatozoa caused by gene mutation.