JPH03219821A - Transgenic rat and production thereof - Google Patents

Abstract

PURPOSE:To utilize the subject rat as a disease-model animal, a useful substance-producing animal, etc., by developing the subject transgenic rat having heterogeneous objective gene in its cells and capable of transferring the heterogeneous objective gene to descendants. CONSTITUTION:A follicle matuation-inducing substance is administrated to a mature female rat on the first day in anestrus stage (fourth stage in estrus) and a fertility drug is administrated to the above-mentioned rat at proestrus stage (first stage in estrus) in synchronization with its sexual cycle. By carrying out natural crossing using the above-mentioned rat within that day and carrying out ovum collection next day when the ovum is at pronucleous stage or by carrying out external fertilization, a pronucleous stage ovum is produced. A heterogeneous objective gene is then injected to a collected fertilized ovum and transferred to a false-pregnancy female and development is carried out, thus producing the objective transgenic rat.

Description

DETAILED DESCRIPTION OF THE INVENTION (Field of Industrial Application) The present invention relates to a transgenic rat and a method for producing the same. The transgenic rat produced according to the present invention can be used as a disease model animal, as an animal that produces useful substances in milk, or as a screening model animal for gene expression systems.

(Prior art) Genes from other animals are introduced into mice, rabbits, pigs, sheep, or cows through breeding or genetic engineering to create transgenic animals, which are used as disease model animals or useful substance-producing animals. This has been known for a long time. For example, a mouse with a genetic obesity factor produced by breeding a recessive homozygous male mouse with genetic obesity whose obesity has been suppressed by adrenalectomy with a normal heterozygous female mouse (Japanese Patent Application Laid-open No. 61293329), mammals. The genome of the human tissue plasminogen activator contains a gene encoding a protein such as human tissue plasminogen activator, and is under the transcriptional control of a mammalian milk protein promoter that does not naturally control the transcription of the gene, and the genome further contains a gene encoding a protein such as human tissue plasminogen activator. Animals that contain DNA that enables the secretion of the protein encoded by the gene (
JP-A No. 63-291) and mice secreting human insulin (WO87707298) are known. However, there is no report that such transgenic rats have been obtained.

Regarding the sperm method, the CAT gene (
CAT
It was reported that transgenic mice carrying the gene could be produced, but no reproducibility was observed [Ce11, No. 57]
Vol. 717 (1989)], the production of transgenic animals by the sperm method has not been confirmed in any animal species.

(Problem to be solved by the invention) The reason why such a transgenic rat cannot be created is that the fertilized rat egg is elastic, so it is difficult to inject other genes, and the cell membrane of the fertilized rat egg is fragile. Easily broken by injection operation, D of rat fertilized eggs
The optimal time for NA injection had not been specified, and since the survival rate of fertilized eggs injected with DNA was low, it was necessary to prepare a large number of eggs, but the method for inducing superovulation for this purpose had not been sufficiently established. etc.

However, it is difficult to create transgenic rats in the same way as mice and use them as disease model animals, useful substance producing animals, screening model animals for gene expression systems, etc. It is short, and the number of offspring is as large as that of mice (around 10).
Shikashi weighs nearly 10 times that of a mouse, making it easier to remove organs and perform surgery, making it easier to use as a disease model animal.
Their milk production is 10 times that of mice, making them more useful than mice as useful substance-producing animals and as screening models for gene expression systems, so their development has been desired.

(Means for Solving the Problems) The present invention has been made as a result of intensive efforts to create such transgenic rats, which have a foreign target gene that expresses pathological conditions and useful substances in their cells, and which are capable of transmitting the foreign gene to their offspring. We have successfully created transgenic rats that can transmit the virus.

That is, the present invention relates to a genetically stable transgenic rat having the above properties and a method for producing the same. There are the following two manufacturing methods.

(1) A follicle maturation inducing agent is administered to an adult female rat on the first day of the diestrus period (fourth estrus period), and an ovulation inducing agent is administered to the rat during the proestrus period (first estrus period) to match the oestrous cycle. On the same day, they are allowed to naturally mate, and the eggs are collected at the pronuclear stage the next day, or pronuclear stage eggs are produced by in vitro fertilization, the foreign target gene is injected into the collected fertilized eggs, and cultured to produce two-cell stage embryos. A method for producing a transgenic rat, which comprises transplanting the rat into a pseudopregnant female and allowing the rat to develop.
Hereinafter referred to as MI method (microinjection method)]
.

(2) Administer a follicle maturation inducer to a young female rat, then administer an ovulation inducer, collect the ovulated unfertilized eggs, separately collect sperm from a mature male rat, and add the foreign target gene to the sperm. Adding it to a suspension and further culturing it, adding the unfertilized eggs thereto to carry out in vitro fertilization, and continuing the culture until it reaches a two-cell stage embryo, which is then transplanted into a pseudopregnant female and allowed to develop. A method for producing a transgenic rat characterized by: [Hereinafter referred to as SP method (sperm-vector method)].

First, to explain the Ml method, a follicle maturation inducing agent is administered to adult male rats on the first day of the diestrus period (fourth estrus period). Pregnant mare serum gonadotropin (PMSG) or the like is preferably used as the follicle maturation inducing agent, and is preferably administered intraperitoneally by injection, and the amount used is preferably 10 to 20 units/mouse. Next, an ovulation-inducing agent is administered to the thus treated rats two days later, ie, during the proestrus phase (first phase of estrus). As the ovulation-inducing agent, it is preferable to use human ciliated gonadotropin (hCG) or the like, and administer this intraperitoneally by injection in the same manner as in the follicle maturation induction treatment, and the amount used is 10 to 20 units/ Preferably. This processing step is shown in FIG. Female rats treated in this way are naturally mated with adult male rats in the evening of the same day. Then, the next day, fertilized eggs at the pronuclear stage are collected from female rats in which a vaginal plug has been confirmed. For egg collection, female rats are sacrificed approximately 32 hours after administration of the ovulation-inducing agent, the ovaries and fallopian tubes are removed from the abdomen, and the cumulus-egg complex is collected from the ampulla of the fallopian tube under a stereomicroscope. It is desirable to perform this by removing the cumulus cells and collecting only the fertilized eggs. The collected fertilized eggs are cultured in a TC medium etc. until the foreign target gene is injected. Foreign target genes include
A variety of DNAs can be used. Examples include oncogenes for developing pathological models, genes for mass-producing proteins by combining milk protein control parts and human structural genes, and genes for improving rats. These may be linear DNA or ring-shaped DNA, but it is desirable that the DNA be long enough to not be physically cut by microinjection (up to about 100,000 base pairs). In addition, any DNA for expression including enhancers, promoters and structural genes, only structural genes, only promoters or only enhancers can be used.
NA is also used. Furthermore, it is also possible to use biologically inactive DNA, viral DNA, or a regulatory gene and structural gene that are part of it for use in insertional mutagenesis. To inject such a foreign target gene, suspend the foreign target gene in a Tris-HCl buffer, etc., and inject this into the male pronucleus of a fertilized rat egg under an inverted microscope equipped with a Nomarski differential interference device. It is best to do this by The fertilized eggs injected with DNA are preferably cultured in a TC medium or the like until they reach a two-cell stage embryo. Ml of the present invention
According to the method, in particular, it is desirable that egg collection and exogenous target gene injection be performed in accordance with the oestrous cycle of the rat, during the estrous period 32 hours after administration of the ovulation-inducing agent. Transgenic rats can be efficiently produced by collecting eggs and injecting a foreign target gene at such a time.

The fertilized eggs injected with DNA in this manner are introduced into the oviducts of pseudopregnant female rats that have been mated with vasoligated male rats to perform transplantation and obtain offspring.

To determine whether or not these offspring have the target foreign gene, we cut off part of the rat's tail after weaning, and test the DNA from the rat's tail.
was extracted using the method of Ninomiya et al. [Mol.

Reprod, Dev, Vol. 1, p. 242 (198
It is recommended to perform the assay by PCR method according to [9) ].

In addition, in the SP method of the present invention, young female rats are first subjected to PMS.
Administer a follicle maturation inducer such as G. This is administered intraperitoneally as in method II, but the dose is preferably about 10 units/mouse. Next, 48 hours after this administration, an ovulation-inducing agent such as hCG is intraperitoneally administered at about 10 units/mouse. Ovulated immature eggs are collected from female rats treated in this way. To collect ovulated immature eggs, female rats are sacrificed, the ovaries and fallopian tubes are removed from the abdomen, only the fallopian tubes are separated, and the cumulus-egg complex is collected from the ampulla of the fallopian tube under a stereoscopic microscope.

On the other hand, an adult male rat is sacrificed, the testes and epididymis are removed, and only the cauda epididymis is separated from this, and spermatozoa are collected from this. The collected spermatozoa are placed in a culture solution such as a TC medium and precultured, and a foreign target gene solution is added thereto and cultured. As a foreign target gene, D
NA is used.

The cumulus-egg complex described above is transferred to this culture solution and cultured for several hours to perform in vitro fertilization. After completing this insemination process, the fertilized eggs are washed with a TC medium, etc., and cultured in this medium for one day and one night. After confirming that the fertilized eggs have reached the two-cell stage, they are classified as pseudopregnant females. Transplant into rats and obtain offspring.

To determine whether or not these offspring have the target foreign gene, we cut off part of the rat's tail after weaning, and test the DNA from the rat's tail.
Extract it and run it on a PC according to the method of Ninomiya et al.
It is preferable to detect by the R method.

Next, the method of the present invention will be specifically explained with reference to Examples.

Example 1 In this example, an example of producing a transgenic rat by a microinjection method will be described.

(1) Preparation of injected embryos The estrus cycle of adult female Wistar rats aged 8 weeks or older was examined using vaginal smear images. As shown in Figure 1, rats in the estrous cycle on the first day of diestrus (4th stage of estrus) were selected, and at noon (12:00) PMSG (pregnant mare serum gonadotropin) was administered at 10-20%. The unit was administered intraperitoneally. and noon (12 p.m.) 48 hours after PMSG administration.
:00), the same rats in proestrus (first stage of heat) were given 10-20 g of hCG (human ciliary gonadotropin).
The unit was administered intraperitoneally. From the evening of the same day (18:00), the acid rats that had been subjected to the above superovulation induction treatment were
The rats were allowed to live with adult male Wistar rats over 22 weeks of age overnight and mated with them. Females whose vaginal plugs were confirmed on the next day were used as test females for obtaining injected embryos. 32 hours after administering hCG to the test female [on the night of the plug confirmation day (20:
00)], the ovaries and fallopian tubes were removed from the abdomen by cervical dislocation. Further, only the oviduct was separated on a thermostatic plate heated to 37°C, and the cumulus-egg complex (fertilized egg) was collected from the ampulla of the oviduct under a stereomicroscope. The collection medium contains 0.
Using TC medium containing 1% hyaluronidase, leave to stand for several minutes to remove cumulus cells, wash fertilized eggs by pipetting, and incubate in TC medium at 37°C in 5% C0295% air until microinjection. It was left standing in a humidified gas phase incubator.

(2) The DNA to be microinjected is derived from human adenovirus type 12 (
7) Gene with EIA region, psV2-gpt-gE
IA [5hiroki et al., “J. Vir.
45, pp. 1074-1082 (198
3 years) linearized with EcoRI or pS
V2-cat plasmid [Gorman et al.
.

“Mo1. Ce11. Biol,” Volume 2, 10
pp. 44-1051, (1982)]
5V2-cat, a BamHI fragment, was used.

The structure of DNA is shown in Figure 2. This DNA is 0.1
It was prepared at 5 μg/ml in pl (7,6 lOmM) Lis-HCl buffer containing mMEDTA.

For DNA injection, under an inverted microscope equipped with a Nomarski differential interference device, the DNA solution aspirated into a glass micropipette attached to a micromanipulator is injected for approximately 2 pi into the male pronucleus of a fertilized rat egg held with a holding pipette. This was done by The fertilized eggs injected with DNA were cultured in TC medium covered with paraffin oil for 12-15 hours.

(3) Transplantation of DNA-injected embryos After culturing for 12-15 hours after DNA injection, embryos that had developed to the 2-cell stage were transplanted into pseudopregnant females.

For the pseudopregnant female, an adult Wistar female aged 8 weeks or older that was mated with a vasoligated male was used, and transplantation was performed on the day the plug was confirmed. Transplantation was performed by introducing a 2-cell stage fertilized egg into the fallopian tube from the fallopian tube using a glass micropipette under bendoparbital anesthesia.

(4) Assay of foreign DNA The injected DNA was introduced into rats using DNA extracted from a part of the rat's tail after weaning.
miya et al. [Mo1. Reprod,
Dev, Vol. 1, p. 242 (1989)]. DNA extraction is done by Ho
Gan et al.
e mouse embryo, Co1d Spri
ng Harbor (1986)]. Buffer and dNTP solution (dATP
, dCTP, dTTP, dGTP) is 5aiki
et at, [5science magazine Vol. 239 No. 487
(198B)]. Brimer is a 380A DNA synthesizer (
(manufactured by Abride Biosystems).

The base sequences of the primers used are shown in FIG. 25 units of Taq polymerase were added to the prepared DNA reaction solution, and the base sequence between two primers was amplified using a DNA thermal cycler (manufactured by Perkin Elmer-Cetus). Then, 15 μm of the reaction solution was subjected to electrophoresis, and the presence of amplified DNA fragments was examined by ethidium bromide staining.

Table 1 shows the number of DNA-injected eggs, number of viable eggs, number of transplanted eggs, number of offspring, and number of transgenic rats in this example.

Table 1: Example 2 of production of transgenic (Tg) rats by microinjection method In this example, an example of production of transgenic rats by the sperm-vector method is described.

(1) Preparation of animals to supply sperm and eggs. Randomly select immature Wistar female rats, 3 years old, and
At 22:00), 10 units of PMSG (pregnant mare serum gonadotropin) was administered intraperitoneally. Then, in the evening (22:00) 48 hours after PMSG administration, the same rats were given hc
10 units of ciliary gonadotropin (human ciliary gonadotropin) were administered intraperitoneally to the eggs, which were subjected to superovulation induction treatment and used as a source of eggs.

In addition, adult male Wistar rats (weighing 350 g or more) that were 12 weeks old were used as a source of spermatozoa.

(2) Introducing in vitro fertilization using sperm as a DNA vector D
NA is EcoRI-B of pSV2-gpt-gEIA.
The amHI fragment pSV2-gpt was used. DNA
The structure of is shown in Figure 4. -This DNA is 0,1m
501.501 in 10 mM) Lis-HCl buffer at pH 7.6 containing MEDTA. It was adjusted to have a concentration of tg/ml.

Adult male rats were sacrificed by cervical dislocation, and the testes and epididymis were removed. Furthermore, only the epididymal foot was separated on a thermostatic plate heated to 37°C, a cut was made with a scalpel, and the spermatozoa leaking from the epididymal foot were collected using a glass rod. The collected sperm were placed in TC medium, diluted to 1/1O, and
The cells were precultured in an incubator at 7°C under a humid atmosphere of 5% CO2 and 95% air. The sperm concentration at this time is 2 to IOX 10
5/ml, and the sperm preincubation time was 4 hours. Then, 30 minutes before the end of the preculture, the DNA solution was added to the final concentration of 1 μg/ml.

Next, the superovulated immature female rats were sacrificed by cervical dislocation, and the ovaries and fallopian tubes were removed from the abdomen. Furthermore, only the oviduct was separated on a thermostatic plate heated to 37℃, and the cumulus-egg complex (unfertilized egg) was examined from the ampulla of the oviduct under a stereomicroscope.
was collected. A TC medium was used as the collection medium, and the cumulus was collected into a culture medium containing pre-cultured DNA-treated spermatozoa.
In vitro fertilization was performed by transferring the egg complex. The insemination time for combining sperm and eggs was 4 hours, and after completion of insemination, the eggs were washed with a TC medium and cultured in the same medium for 20-24 hours.

(3) Transplantation of in vitro fertilized embryos After culturing, the in vitro fertilized embryos that had developed to the 2-cell stage were transplanted into pseudopregnant females. For pseudopregnant females, we used adult Wistar females aged 8 weeks or older that were mated with vasoligated males.
I did the porting on the day I checked the plug. Transplantation was performed by introducing the 2-cell stage embryo into the fallopian tube from the fallopian tube using a glass micropipette under pendoparbital anesthesia.

(4) Assay of foreign DNA Foreign DNA was introduced into rats using DNA extracted by cutting a part of the tail of a rat after weaning.
It was assayed by PCR method according to the method of Ya et al. DNA extraction followed the method described by Hogan et al. Buffer and dNTP solutions (dATP dCTP, dTTP, dGTP) are 5ai
Prepared according to the method described by Ki et al. Brimer was synthesized using a 380A DNA synthesizer (manufactured by Abride Biosystems). The base sequence of the brimer used is shown in FIG. 2.5 units of Taq polymerase were added to the prepared DNA reaction solution, and the base sequence between two primers was amplified using a DNA thermal cycler (manufactured by Perkin Elmer-Cetus). Then, 15 μl of the reaction solution was subjected to electrophoresis, and the presence of amplified DNA fragments was examined by ethidium bromide staining.

Table 2 shows the number of in vitro fertilized eggs, number of 2-cell stage embryos, number of transplanted cups, number of litters, and number of transgenic rats in this example.

Table 2: Production of transgenic (Tg) rats by sperm vector method (effects of the invention) The transgenic rats of the present invention are stable as a breed, and are disease model animals, useful substance producing animals, or screening for gene expression systems. Useful as a model animal. Furthermore, according to the method of the present invention, transgenic rats, which were conventionally considered impossible to produce, can be produced efficiently by a simple method.

[Brief explanation of drawings]

FIG. 1 shows the relationship between the optimal timing of injection when a foreign target gene is injected into a fertilized rat egg using the MI method of the present invention, the light/dark cycle of the breeding room, the estrous cycle of the rat, and the superovulation treatment. Figure 2 shows the foreign target gene used in Example 1, pS
The structures of the V2-gpt-gEIA gene and the 5V2-cat gene are shown, and FIG. 3 shows the DNA sequence of the primer used for testing the injected foreign target gene. Figure 4 shows the foreign target gene used in Example 2, ps
FIG. 5 shows the structure of the V2-gpt gene, and FIG. 5 shows the DNA sequence of the primer used for testing the introduced foreign target gene. 5゛0H OH3゜PTOO4 AAACATCCTGAAACCTCGACGCTAG
5°0H OH3' GPT 103 TCATCGTCGGTACGTTCGGCATCGC
Primer 5'0H 01 (3 ATOO2 AATATTTGCCCATGGTGAAAACGGG) used for detection of 5V2-cat
5'OH OH3 AT102 AGCAAAACTGAAACGTTTTCATCGCT
Brimer used for detection of μsV2-gpt-gEIA Fig. 3 eoRI 23bp psV2-gpt (4528bp) Fig. 4 Ba+1) 11

Claims (4)

[Claims] (1) Transgenic rats that have a foreign target gene in their cells and can transmit this foreign target gene to their offspring. (2) A follicle maturation inducing agent is administered to adult female rats on the first day of diestrus (4th estrus period), and an ovulation inducing agent is administered to these rats during proestrus (1st estrus period) to match the oestrous cycle. death,
Natural mating occurs on the same day, eggs are collected at the pronuclear stage the next day, or pronuclear stage eggs are produced by in vitro fertilization, a foreign target gene is injected into the collected fertilized eggs, and this is transplanted into a pseudopregnant female, and development occurs. A method for producing a transgenic rat, characterized by: (3) The method for producing a transgenic rat according to claim (2), wherein the pronuclear stage oocyte collection and the subsequent injection of the foreign target gene are performed in accordance with the oestrous cycle of the rat. (4) Administer a follicle maturation inducer to young female rats, then administer an ovulation inducer, collect the ovulated unfertilized eggs, separately collect sperm from a mature male rat, and add the foreign target gene to the sperm. Adding it to a suspension and further culturing it, adding the unfertilized eggs thereto to carry out in vitro fertilization, and continuing the culture until it reaches a two-cell stage embryo, which is then transplanted into a pseudopregnant female and allowed to develop. A method for producing a transgenic rat characterized by: